Skip to main content
PLOS ONE logoLink to PLOS ONE
. 2012 Nov 30;7(11):e50608. doi: 10.1371/journal.pone.0050608

The Essential yhcSR Two-Component Signal Transduction System Directly Regulates the lac and opuCABCD Operons of Staphylococcus aureus

Meiying Yan 1,¤, Jeffrey W Hall 1, Junshu Yang 1, Yinduo Ji 1,*
Editor: Michael Otto2
PMCID: PMC3511567  PMID: 23226327

Abstract

Our previous studies suggested that the essential two-component signal transduction system, YhcSR, regulates the opuCABCD operon at the transcriptional level, and the Pspac-driven opuCABCD partially complements the lethal effects of yhcS antisense RNA expression in Staphylococcus aureus. However, the reason why yhcSR regulon is required for growth is still unclear. In this report, we present that the lac and opuC operons are directly transcriptionally regulated by YhcSR. Using real-time RT-PCR we showed that the down-regulation of yhcSR expression affected the transcription of lacA encoding galactose-6-phosphotase isomerase subunit LacA, and opuCA encoding a subunit of a glycine betaine/carnitine/choline ABC transporter. Promoter-lux reporter fusion studies further confirmed the transcriptional regulation of lac by YhcSR. Gel shift assays revealed that YhcR binds to the promoter regions of the lac and opuC operons. Moreover, the Pspac-driven lacABC expression in trans was able to partially complement the lethal effect of induced yhcS antisense RNA. Likewise, the Pspac-driven opuCABCD expression in trans complemented the growth defect of S. aureus in a high osmotic strength medium during the depletion of YhcSR. Taken together, the above data indicate that the yhcSR system directly regulates the expression of lac and opuC operons, which, in turn, may be partially associated with the essentiality of yhcSR in S. aureus. These results provide a new insight into the biological functions of the yhcSR, a global regulator.

Introduction

The continuing increase of hospital- and community-associated methicillin resistant Staphylococcus aureus infections highlights an urgent need for the development of alternative potent antibacterial agents [1][3]. The ability of this organism to resist current antibiotic therapies and cause infection is partially due to the coordinated regulation of gene expression allowing the bacteria to survive in different stress conditions. Two-component signal (TCS) transduction systems are important sensory units and allow microbial organisms to adapt to different niches, as well as play a significant role in pathogenesis and biofilm formation for various bacterial species [4][7]. Therefore, interrupting these critical signaling pathways may provide an alternative strategy for the development of novel classes of preventive and/or therapeutic antibacterial agents [8].

A typical two-component system is composed of a histidine kinase sensor and a cognate response regulator responsible for sensing and responding to environmental signals by regulating gene expression, respectively [5]. In S. aureus, at least 16 different two-component signal systems have been identified [6], and two TCSs, yycFG and yhcSR (also known as airSR), are required for survival [9][11]. The yycFG system, which has orthologs in Bacillus subtilis [12] and Streptococcus pneumoniae [13], is the first reported TCS regulatory system that is indispensable for cell viability in S. aureus [9]. Analyses of conditional lethal yycFG mutants in B. subtilis suggested that this system controls the ftsAZ operon that is involved in the process of cell-wall division [14], as well as endopeptidase-type autolysins including YvcE and LytE [15]. However, YycFG is not involved in the regulation of ftsZ expression in S. pneumoniae and S. aureus, but, modulates the expression of genes involved in cell wall metabolism in S. aureus [16], and an essential gene, pcsB, encoding a cysteine, histidine-dependent amidohydrolase/peptidase involved in cell wall biosynthesis in S. pneumoniae and S. aureus [16][20].

We have identified another TCS, yhcSR, which is also required for survival of S. aureus [10]. However, the reason why yhcSR is required for growth is totally unknown. In order to elucidate the biological functions of yhcSR, we examined the effect of yhcSR on gene expression using a microarray assay. Our preliminary microarray analysis suggested that the down-regulation of yhcSR expression affects the expression of genes associated with a variety of biological functions. Recently, we demonstrated that YhcSR positively regulates the nreABC and narGHIJ operons which are responsible for dissimilatory nitrate reduction under anaerobic growth conditions [21]. We have also previously published data indicating regulation of the opuCABCD operon by YhcSR and showed that plasmid-borne expression of OpuCABCD partially complements the lethal effect of induced yhcS antisense RNA [22].

In this study, we employed quantitative RT-PCR, promoter-lux reporter fusions, and gel-shift technologies and demonstrated that the yhcSR system directly regulates the transcription of the lac operon encoding the structural genes for lactose and galactose metabolism, and opuCABCD operon encoding a glycine betaine/carnitine/choline ABC transporter [23], [24]. Moreover, we found that that the regulation of the lac and opuC operons may partially contribute to the essentiality of the yhcSR regulon in S. aureus.

Materials and Methods

Bacterial Strains, Plasmids and Growth Media

The bacterial strains and plasmids used in this study are listed in Table 1. The S. aureus cells were cultured in Trypticase soy broth (TSB) at 37°C with shaking. E. coli strains were grown in Luria-Bertani (LB) medium. Transformants containing recombinant plasmids were selected on LB agar containing ampicillin (100 µg/ml), chloramphenicol (50 µg/ml), or erythromycin (300 µg/ml) for E. coli, and TSA containing chloramphenicol (10 µg/ml) or erythromycin (5 µg/ml) for S. aureus. The isopropyl-β-D-thiogalactoside (IPTG) was added as 1 mM at final concentration. Where noted, NaCl (1 M) and choline (1 µM) were added to chemically defined medium (CDM).

Table 1. Bacterial strains and plasmids used in this study.

Strain or plasmid Description Reference or source
S. aureus strains
RN4220 Laboratory strain: rsbU [49]
WCUH29 Clinical human S. aureus isolate: rsbU+
YJ2002 WCUH29 containing plasmid pYH3 [30]
JAS909 WCUH29 containing plasmid pSAS909 carrying yhcS antisense; Ermr [10]
YJ606 WCUH29 containing plasmid pCY606; Ermr [22]
YJ1997 WCUH29 containing plasmid pMY1997; Ermr This study
YJ107 WCUH29 containing plasmid pMY107; Ermr [22]
YJ207 WCUH29 containing plasmid pMY207; Ermr [22]
YJ307 WCUH29 containing plasmid pMY307; Ermr This study
Plasmids
pET24b Vector for overproducing His-tagged proteins, Kanr Novagen
pyhcR-24b pET24b derivative for overproduction of YhcR, Kanr This study
pCY606 Shuttle vector, derived from pSAS909, containing luxABCDE and yhcS antisense; Ermr [22]
pMY1997 Derived from pCY606, with sa1997 promoter - luxABCDE reporter fusion; Ermr This study
pMY107 Derived from pCY606, with luxABCDE replaced by Pspac promoter region; Ermr [22]
pMY207 Derived from pMY107, with sa2237operon under the Pspac; Ermr [22]
pMY307 Derived from pMY107, with sa1997operon under the Pspac; Ermr This study

RNA Isolation and Purification

Overnight cultures of S. aureus were inoculated in 1% in TSB medium and grown to the mid-exponential (3 hr) phase of growth. Total RNA was purified from the above culture as described [25]. Briefly, bacterial cells were harvested by centrifugation, and the RNA was isolated by the RNAPrep kit (Promega). Contaminating DNA was removed with a DNA-free kit (Ambion), and the RNA yield was determined spectrophotometrically at 260 nm.

Quantitative Real-time RT-PCR (qPCR) Analysis

In order to determine whether the down-regulation of yhcSR expression has any impact on the expression of several identified essential genes, we employed quantitative real-time reverse transcription (RT) PCR to compare the RNA levels, as described [25], [26]. The first strand cDNA was synthesized using reverse transcriptase with the SuperScript III Platinum Two-Step qRT-PCR kit (Invitrogen). For each RNA sample, we performed duplicate reactions of reverse transcription, as well as a control without reverse transcriptase, in order to determine the levels of DNA contamination. PCR reactions were set up in triplicate by using the SYBR Green PCR Master Mix (Stratagene). Real-time sequence-specific detection and relative quantitation were performed with the Stratagene Mx3000P Real Time PCR System. Gene-specific primers were designed to yield ∼100 bp of specific products (Table 2). Relative quantification of the product was calculated using the Comparative CT method, as described for the Stratagene Mx3000P system. The housekeeping gene 16s rRNA was used as an endogenous control [26]. All samples were analyzed in triplicate and normalized against 16s rRNA gene expression. The experiments were repeated at least three times. To determine whether the complementary effect was attributed to the over-expression of a Pspac-driven lacABC operon, we also utilized the qPCR as the above described.

Table 2. Primers used in this study.

Primers Sequence(5′-3′)
yhcRforNdeI GGAATTCCATATGAACAAAGTAATATTAGTAG
yhcRrevXhoI CCGCTCGAGAATCAACTTATTTTCCATTGC
sa1997proNotFor TAGTGCGGCCGCATTAAAAGTATAACTGCATTG
sa1997proNotRev TAGTGCGGCCGCTAATAAGACTCCTTTTTACTTT
Sa2237prGSFor416bp TGCATTATTACAAAAATTCGAC
Sa2237prGSRev416bp AACATAATCATTTCTCCTTCC
Sa2237prGSFor312bp TATGAGTTATCTATTTAGTTGC
Sa2237prGSFor210bp AGTAATCGGTAGAAATTCAAC
Sa2237prGSFor172bp TACTGTTAAGTATTCACATTAC
SA1997prGSfor TTAAAAGTATAACTGCATTG
SA1997prGSrev CATCTGAACCAATAATAATC
Pspacfor TCTAGAGCTGCCTGCCGCGTTTCGGT
Pspacrev GCTTGAATTCCCGGGCGGCCGCCGCGGCCGGCCAATTGTTATCCG CTCACAATTC
Sa1997RBSfor TAGTGCGGCCGCGGCCGGCCAGGAGGGAGTCTTATT ATGGCGATTATTATTGG
Sa1995rev TAGTGCGGCCGCGGCCGGCC TTACACCTCTAAAACTTCAATTTG
SA2237RTfor CGTATCGGTGTCGTAAGAGCACT
SA2237RTrev GCACCACCTTACCTTCTGACAT
SA1997RTfor TGG TGC AGG TAG CTT TAT GGT TG
SA1997RTrev GCA TAT CTA CGC GGA TTT GGT GT
Sa0222-for AAG CAG TTA AAG AAG CAG ACG AAT CTT G
Sa0222-rev GTT GTG TTG TTT CTT CAG CTT TAC CAG
SA0959RTfor GGA TAC ACC AGG ACA TGC AGA CTT
SA0959RTrev CTA CAA CAC CCT CTG GAC GTG CT
SA1044RTfor CCT AAC ACA AGA CCG GTA CCA GAT
SA1044RTrev CTT CAC AGT GTG CTA CGA TGG CTT
P2290-F TGT CGT CTT GAA ATA CGG CTG T
P2290-R CTA TAT TGT TCG GTT TTT AAA AGC AAT G
SA1269RTfor GCC GTC AAG AGA GGC ATT TGA AG
SA1269RTrev CAA GAC CAC CTG CTC CTA CAA CAA
SA1271RTfor GAT GCA ACG ATT GTG ATG CCA G
SA1271RTfor ATT AGG CCA CCT CCA CCA ACT G

Construction of lac Promoter-lux Reporter Fusion

In order to further confirm whether the yhcSR regulatory system transcriptionally regulates the expression of lac we created a promoter-lux reporter fusion using the yhcS antisense expression vector, pCY606 as described and previously used to build an opuC promoter reporter [22]. The promoter region of structural lac genes was amplified by PCR respectively using the primers (Sa1997proNotFor/Sa1997proNotrev) listed in Table 2, digested with NotI and ligated upstream of the promoterless luxABCDE of pCY606, which was digested with the same enzymes. The resulting recombinant plasmids pMY1997 containing the promoter-lux reporter fusion was transformed into E. coli DH10B competent cells and correct orientation and DNA sequence was confirmed by PCR, restriction enzyme digestion, and DNA sequencing. The plasmid pMY1997 was purified and electroporated into S. aureus RN4220, and then into WCUH29, resulting in S. aureus strain, YJ1997. The lux expression was monitored during growth in TSB at 37°C with a Chiron luminometer. The relative light units (RLU) were calculated (bioluminescence intensity/optical density at 600 nm). Each experiment was repeated at least three times.

Cloning, Expression and Purification of YhcR-His Tagged Fusion Protein

In order to differentiate which identified genes are directly regulated by the yhcSR regulatory system, we cloned and purified a His-Tagged YhcR response regulator protein as described. The yhcR coding region was obtained by PCR from S. aureus and cloned into NdeI and XhoI sites of the E. coli expression vector pET24b. The recombinant plasmid (pETyhcR) was confirmed by PCR and DNA sequencing (data not shown) and transformed into E. coli strain BL21(DE3). The transformants were incubated until mid-log phase (OD600 nm = ∼0.6) followed by induction of yhcR expression by adding IPTG (final concentration 1 mM). After two hours of incubation, cells were harvested and lysed by sonication. The expression of YhcR was confirmed by SDS-PAGE followed by Coomassie Bright Blue staining (data not shown).

To purify the YhcR-His tagged protein a 500 ml culture of the BL21 (DE3) containing pETyhcR was induced, and the cell pellet was collected and lysed in Lysis Buffer (8 M Urea, 0.1 M NaH2PO4, 0.01 M Tris-Cl, pH8.0) by incubation at room temperature for 1 h with agitation. The supernatant was collected by centrifugation, applied to the Ni-NTA His-Binding Resin, and incubated for 30 min with shaking. The resin mixture was loaded onto the column and washed twice with washing buffer (8 M urea, 0.1 M NaH2PO4, 0.01 M Tris-Cl, pH6.3). The YhcR-His protein was eluted with elution buffer (8 M urea, 0.1 M NaH2PO4, 0.01 M Tris-Cl, pH5.6). Following Ni-NTA affinity purification the YhcR-His tag protein was further purified by size exclusion chromatography using Sephadex-50 (Sigma). The purified YhcR-His protein was confirmed by SDS-PAGE followed by Coomassie Bright Blue staining (data not shown). The concentration of purified YhcR-His protein was determined by the Bradford method.

Protein Phosphorylation in vitro

For YhcR phosphorylation in vitro, total of 3 µg of protein was incubated in 30 µl of phosphorylation buffer [20 mM NaH2PO4 (pH8.0), 10 mM MgCl2, 1 mM DTT, 32 mM acetyl phosphate] at 37°C for 90 min as described [27].

Gel Mobility Shift DNA-binding Assay

To determine which identified gene(s) are directly regulated by YhcSR, we performed gel-shift assays. DNA fragments of the upstream DNA regions of lacA (Plac, 397 bp) and opuCA (PopuC, 312 bp) were obtained by PCR using the primers listed in Table 2. The amplified DNA fragments were purified and labeled with Digoxigenin using the DIG GEL Shift Kits (Roche) according to the manufacturer’s protocol. The DNA-binding and electrophoresis were performed as described [28], [29]. Briefly, the purified PCR products were labeled with Digoxigenin using terminal transferase (Roche). The labeled DNA fragments were further purified to remove the redundant DIG-ddUTP and salts. The interaction of YhcR-His with DNA was conducted in a 20 µl reaction mixture containing 0.2 pmol DIG-labeled DNA, 1 mg of poly-(dI–dC), 25 mM NaH2PO4 (PH 8.0), 50 mM NaCl, 2 mM MgCl2, 1 mM DTT, 10% glycerol, and different concentrations of YhcR-His protein (final concentrations of YhcR-His were 1, 2, 4, and 6 µM corresponding to 0.5, 1, 2, and 3 µg, respectively). Unlabeled DNA fragments of the promoter region as a specific competitor was added into the reaction with 100-fold excess to labeled probe. Other unrelated proteins including BSA and SaeR (another response regulator of S. aureus) were used as nonspecific binding controls. The DNA binding reaction was initiated by the addition of YhcR-His and incubated at room temperature for 25 min. Samples were then loaded directly onto a 5% native polyacrylamide gel [acrylamide:bisacrylamide (29∶1) in 0.5x TBE buffer]. Electrophoresis was run for 2 h at 4°C with 7 V/cm, and the gels were transferred to Nylon membrane via electro-blotting in 0.5x TBE at 300 mA for 90 min at 4°C. After cross-linking of DNA fragments using UV, the membrane was hybridized with anti-digoxigenin-AP antibody and exposed to X-ray film for 4 hours to achieve the desired signal.

Construction and Characterization of Pspac-driven Complementary Strains

In order to determine whether the modulation of lac by YhcSR is involved in the essentiality of the YhcSR, we created Pspac-driven lacABC operon complement strains respectively within the yhcS antisense expression plasmid. Briefly, The 1905 bp PCR fragment of lacABC (sa1995–1997) was amplified using the primers Sa1997RBSfor/Sa1995rev digested with NotI, then cloned into the same site of pMY107 as previously described [22]. The resulting recombinant plasmid carrying the lacABC genes located downstream of the Pspac promoter region was obtained, confirmed by PCR and DNA sequencing, and correspondingly designated as pMY307. The pMY307 recombinant plasmid was electroporated into WCUH29 and resulted in Pspac-driven lacABC genes complement strains denoted as YJ307. To examine whether the Pspac-driven lacABC genes can complement the inhibitory growth effect of yhcS antisense RNA, we titrated the effect of induced yhcS antisense RNA on growth by kinetically monitoring the growth of the above complementary strains in TSB containing Erm (5 µg/ml) and different concentrations of inducer, anhydrotertacycline (ATc) in a 96-well format using a SpectrMax plus Spectrophotometer (Molecular Devices) as previous described [10], [22]. This experiment was repeated at least three times.

Results

Identification of Genes Regulated by the Essential yhcSR System

Using a Pspac-regulated yhcSR mutant and a TetR-regulated yhcS antisense RNA mutant, we have demonstrated that the down-regulation of yhcSR expression causes a lethal effect on bacterial growth [10]. In order to elucidate the biological functions of the essential yhcSR system in S. aureus, we comprehensively examined the effect of conditional knockdown of yhcSR on gene expression using regulated antisense RNA technology with the combination of microarray analysis. Our preliminary microarray data showed that the down-regulation of yhcS expression differentially affected expression of various genes, including the lac operon encoding the structural genes for lactose and galactose metabolism (decreased expression two to five-fold) and opuC encoding a glycine betaine/carnitine/choline ABC transporter (decrease expression four to five-fold), and virulence factors (Table 3). To confirm the preliminary results, we first selected four down-regulated genes and five up-regulated genes including several essential genes and conducted qPCR analysis. For the control strain, YJ2002 (WCUH29 carrying pYH3, [30], the addition of inducer (250 ng/ml of ATc) had no significant influence on the expression of the above selected 10 genes in both microarray and qPCR assays (data not shown). However, for the yhcS antisense RNA expression strain JAS909, the qPCR analysis showed that the down-regulation of yhcSR led to 4-fold decrease of both lacA and opuCA expressions, which are consistent with the microarray data (Table 3). Interestingly, we found that the down-regulated yhcSR expression significantly increased the transcription of several virulence factors, including coagulase, fibronectin binding protein, and exotoxin, suggesting that the YhcSR system may function as a repressor of these virulence factors, possibly through regulation of agr and saeR (Table 3) [11].

Table 3. Real-time RT-PCR (qPCR) and microarray analysis of gene expression in mid-log phase of growth, using the yhcS antisense RNA strain.

gene description fold change
qPCR* (control) microarray
coa taphylocoagulase +4 (0) +5.59
set15 exotoxin 15 +4 (0) +2.5
SA0959 GTP-binding elongation factor homolog +2 (0) +2.3
pyrC dihydroorotase +2 (0) +2.8
fnbB fibronectin-binding protein homolog +2 (0) +7.29
SA1269 Blt-like protein −4 (0) −33.4
SA1271 threonine dehydratase −8 (0) −51.67
lacA galactose-6-phosphate isomerase −4 (0) −4.89
opuCA glycine betaine/carnitine/choline ABC transporter −4 (0) −4.39

qPCR* (control): The number inside parentheses is the fold change of specific genes in control strain YJ2002 with versus without ATc. –represents down-regulated gene expression during inactivating yhcSR system; +represents up-regulated gene expression during inactivating yhcSR system.

Confirmation of Transcriptional Regulation of lac using a Promoter-lux Reporter Fusion System

To further confirm whether the yhcSR regulator transcriptionally regulates the expression of the lac genes, we created a promoter-lux reporter fusion system using the TetR-regulated yhcS antisense expression vector, pCY606. The promoter-lux reporter fusion strains (YJ1997) and the parental control strain (YJ606) were grown in TSB in the presence of the yhcS antisense RNA inducer ATc (200 ng/ml) and in the absence of ATc, at 37°C with shaking. Bioluminescence intensity and optical density of the cultures were measured at different times of growth. No light signal was detected for the control strain YJ606 with and without inducer, suggesting no detectable leaky luxABCDE transcription (data not shown) and expression. However, for the lac promoter-lux fusion strains (YJ1997), the light intensity obviously decreased in the early log-phase of culture, but increased after later log-phase of growth during the induction of yhcS antisense RNA expression with inducer ATc (Figure 1). These results and in conjunction with our previous results on opuC [22] indicate that the yhcSR system transcriptionally regulates the expression of lac operon and opuC operons.

Figure 1. Analysis of transcriptional regulation of lac operon by the YhcSR system using promoter-lux reporter fusion.

Figure 1

The impact of the down-regulation of yhcSR on the expression of lac operon was determined by monitoring the bioluminescence intensity during growth. The overnight cultures of S. aureus strains were diluted to ∼104 CFU/ml with TSB containing appropriate antibiotics and in the absence (solid dots ) or presence of 200 ng/ml of inducer, ATc (solid dashes). Both bioluminescence signals and cell growth were monitored at 37°C by measuring the light intensity with a Chiron luminometer and optical density at 600 nm (OD600) with a SpectraMax plus Spectrophotometer every 30 min. To eliminate the effect of bacterial growth, the relative light units (RLU) were calculated (light intensity/OD600) from triplicate readings at different times during growth.

YhcR Directly Interacts with the Upstream Regions of lacA and opuCA

To examine whether YhcR directly or indirectly regulates the expression of these essential genes, we conducted gel shift assays with the upstream regions of lacA and opuCA. Gel shift promoter probes containing the 300 to 400 bp upstream of the translational start site of the first structural gene of each operon were obtained by PCR and labeled with digoxigenin. Each gel shift assay consisted of a DNA probe-only control, the probe incubated with different concentrations of YhcR ranging from 1 to 6 µM, the probe plus 100-fold excess of unlabeled probe, and the probe with nonspecific protein BSA (2.3 µM) or another response regulator SaeR (5.6 µM).

The gel shift assays with the upstream region of lacA resulted in obviously shifted bands in a dose-dependent manner compared to the probe only and nonspecific proteins. Moreover, the addition of extra-unlabeled competitor apparently competed with the shifted band (Figure 2A). Furthermore, two apparent shifted bands were revealed in the gel shift analysis with the upstream region of opuCA probe, suggesting the possible presence of multiple YhcR binding sites in the promoter sequence. The extra-unlabeled competitor successfully competed with the shifted bands (Figure 2B). These results indicate that the YhcR response regulator may directly interact with the upstream regions of lacA and opuCA genes.

Figure 2. Gel shift mobility analysis of genes regulated by YhcR.

Figure 2

Promoter regions for each gene were obtained as described. The mobility of labeled promoter fragments without addition of YhcR is shown in lane 1 (0). Different amounts of YhcR (0.5, 1, 2, 3 µg) were incubated with each DIG-labeled promoter probes: Plac (A) and PopuC (B) in 20 µl reaction volume. –represents without unlabeled specific competitor;+represents in the presence of 100-fold extra unlabeled specific competitor. Both BSA (bovine serum albumin) and SaeR (an unrelated response regulator of S. aureus) were used as nonspecific binding controls. Approximate 0.2 pmol of DIG-labeled promoter DNA fragment was used in each reaction.

Expression of lacABC Genes in trans Partially Complements the Lethal Effect of Down-regulating yhcSR Expression

In order to determine whether the direct modulation of lac operon is associated with the essentiality of yhcSR system, we conducted complementary experiments using a multicopy plasmid. The lacABC genes were obtained by PCR using a high fidelity pfx DNA polymerase, and cloned downstream of Pspac promoter within the yhcS antisense RNA expression vector, pMY107 and labeled at pMY307. The recombinant plasmid was electroporated into the laboratory strain, RN4220, and subsequently, into the clinical isolate, WCUH29, labeled YJ307. The growth of the complementary strain YJ307 and control carrying parental plasmid DNA (YJ107) was kinetically monitored while increasing concentrations of inducer, ATc. Consistent with our previous findings [10], the induction of yhcS antisense expression with the inducer ATc dramatically inhibited the growth of the control strain (YJ107) in a dose-dependent manner (Figure 3A). In contrast, the expression of the lacABC genes partially restored the growth of the yhcS antisense RNA expression strain and shortened the differential lag-phase of growth from five to two hours in the presence of 250, 500, and 750 ng/ml of inducer ATc (Figure 3B). We previously observed similar results of partial complementation with the opuC operon [22].

Figure 3. Complementation of induced yhcS antisense RNA by Pspac-driven lacABC.

Figure 3

Growth curves of control strain, YJ107 (A), lacABC complemented strain, YJ307 (B), in TSB containing 5 µg/ml of erythromycin and various concentrations of ATc (in nanograms/milliliter). (C) Represents the growth curves of the above strains in the absence of ATc. The overnight cultures of S. aureus strains were diluted to ∼104 CFU/ml with TSB containing appropriate antibiotics and different concentrations of an inducer [anhydrotetracycline, (ATc), at concentrations of 0, 50, 250, 500, or 750 ng/ml]. Cell growth was monitored at 37°C by measuring the optical density at 600 nm (OD600) every 15 min, with 1 min of mixing before each reading in a SpectraMax plus Spectrophotometer. The growth curves represent one of three repeated experiments.

To exclude the possibility that the above complementation may be attributed to the over-expression of the LacABC proteins or OpuCABCD proteins in the multi-copy plasmid, we compared the growth between the control strain and each complementary strain in the absence of inducer. Without the induction of yhcS antisense RNA expression, the complementary strain carrying the multi-copy plasmids of lacABC genes and the opuC operon showed a similar pattern of growth as the control strain showed (Figure 3C).

To determine whether the complement effect of the lacABC genes and opuC operon on the yhcS antisense RNA lethal function resulted from the Pspac-driven lacABC gene and opuC operon over-expressions in trans, we performed qPCR using lacA, and opuCA specific primers (Table 2). Total RNA was isolated and purified from log-phase cultures, and cDNA was reverse transcribed. The transcriptional levels of lacA and opuCA in the complementary strains (YJ307 and YJ207) respectively increased 16- and 4-fold than those in the control strain (YJ107), suggesting the complementary effect seen in the assays was due to the Pspac-driven expression of the lacABC genes and opuC operon.

Expression of opuCABCD Genes in trans Enhances Bacterial Growth in High Osmotic Medium Conditions during yhcS Antisense RNA Induction

To further determine yhcSR’s regulation of the opuC operon, we conducted complementation experiments using an opuC operon expressing multicopy plasmid and chemically defined medium in the absence or presence of NaCl and the compatible solute, choline. Choline, oxidized in the cell to glycine betaine, is one of several osmoprotectants that S. aureus can use to shield itself from high osmolality environments [31], [32]. Consistent with previous reports regarding S. aureus growth in high osmotic conditions [24], [32], the addition of NaCl to the CDM dramatically alleviated the growth, but the addition of choline to the CDM improved the growth of the control strain YJ2002 (Figure 4A). The presence of inducer, ATc, had mild effect on the growth of S. aureus due to its toxicity, but the effect was equal across of the growth conditions for YJ2002 (Figure 4A). The yhcS antisense RNA strain YJ107 grew similarly to YJ2002 in the medium without ATc, whereas the induction of yhcS antisense RNA with ATc caused a remarkable growth defect, which was further exacerbated by adding NaCl to the CDM (Figure 4B); whereas adding choline to the NaCl-CDM partially recovered YJ107 growth (Figure 4B). The presence of the Pspac-driven opuCABCD genes in YJ207 resulted in S. aureus growing better in CDM containing NaCl and ATc, indicating protection of the cells from the high salt conditions (Figure 4C). Moreover, the addition of choline to the NaCl-ATc-CDM further enhanced the growth of YJ207 (Figure 4C). Taken together, the above data indicate that the Pspac-driven expression of opuCABCD in trans is able to complement the function of the down-regulated endogenous opuCABCD by YhcSR.

Figure 4. Effect of the complementation of opuC operon on bacterial growth in high osmotic medium conditions during the depletion of YhcSR.

Figure 4

Growth curves of control strain, YJ2002 (A), yhcSR antisense RNA strain, YJ107 (B), and opuCABCD complemented strain, YJ207 (C) in CDM containing 5 µg/ml erythromycin and where indicated 750 ng/µl ATc, 1 M NaCl, and 1 µM choline chloride were added. The overnight cultures of S. aureus strains were diluted with CDM containing appropriate antibiotics and additives as indicated. Cell growth was monitors at 37°C by measuring the optical density at 600 nm (OD600) every 15 min, with 1 min of mixing before each reading in a BioTek Synergy II microplate reader. The growth curves represent one of three repeated experiments.

Discussion

Two-component signal transduction systems play important roles in the ability of bacteria to adapt to various environments by sensing alterations in their surroundings and by altering gene expression [5]. In S. aureus genomes, at least 16 pairs of two-component signal transduction systems have been revealed [33]. However, most of them have not been functionally explored. Previous work in our laboratory led to the identification of a novel essential two-component signal transduction system, yhcSR, in S. aureus [10] and demonstrated its role in regulating disimilatory nitrate reduction [21]. In this study, we revealed that YhcSR is a global regulator and investigated two additional target genes that are directly regulated by the essential YhcSR system.

Our results demonstrate for the first time that the novel essential YhcSR system directly regulates the expression of lac and opuC operons [34], [35]. Using microarray approaches, we and other investigators have successfully identified genes that are directly and/or indirectly regulated by different regulators including two-component signal regulatory systems, such as ArlRS [26], SaeRS [36], AgrA and SarA [37], and MgrA [38]. In this study, we employed a similar approach to identify genes that are modulated by the YhcSR system. Our preliminary microarray data showed that the depletion of the YhcSR system apparently down-regulates the expression of lac and opuC operons, which were confirmed by semi-quantitative RT-PCR analysis. To further confirm whether YhcSR is able to regulate the expression of the lac operon at the transcriptional level, we performed promoter-lux reporter fusion assays. Consistent with the RT-PCR data, the down-regulation of yhcSR expression obviously decreased the bioluminescence intensity of the Plac-lux promoter fusion. Taken together, and in conjunction with our previous publication [22] results indicate that the essential yhcSR system transcriptionally regulates the lac and opuC operons in S. aureus. The different profiles of lux expression in the different promoter-lux reporter fusions during different stages of growth suggest that in the early log-phase YhcR controls lac transcription; in contrast, in the middle and late log-phases YhcR positively modulates opuC operon expression [22]. This finding is not surprising since it has been found that the well-studied agr system differentially regulates the expression of both cell-wall associated proteins and exported toxins in different phases of cell growth [33].

In order to elucidate whether the above regulatory effects on the lac and opuC operons expression are mediated directly by YhcR or indirectly through other regulators, we employed gel shift assays. The upstream promoter regions of the lac and opuC operons bound to YhcR-His in a dose-dependent manner. We also found that the upstream promoter regions showed multiple shifted bands with a low concentration of YhcR, suggesting that these promoter regions may bind YhcR as a dimer or at multiple sites. This phenomenon has been revealed in different regulators, including OmpR, SarA, and SrrA [29], [39], [40]. These results indicate that YhcR positively mediates the expression of the lac and opuC operons by directly binding to their promoter regions.

In addition, unlike OmpR its binding affinity to its target DNA is increased by phosphorylation [39], [41]; the phosphorylation of YhcR had no obvious impact on our gel shift assays (data not shown), which is consistent with the report of SrrA [40]. We cannot dismiss the possibility that the in vitro phosphorylation of YhcR in this study is not as effective as expected. It remains to be determined whether a phosphorylated YhcR has different binding sites and/or affinities in the promoter regions of lac and opuC.

To address whether the above transcriptional effects of YhcSR on lac expression are relevant to the biological function or essentiality of the yhcSR system, we conducted complement experiments by introducing Pspac-driven lacABC genes in a multicopy plasmid. The complementation of the lacABC dramatically curtailed the inhibitory effect of the induced yhcS antisense RNA. Biochemical evidence indicates YhcSR is an oxygen sensing two-component system [11], thus regulation of the lac operon by YhcSR links lactose fermentation to the absence of oxygen. The importation and ultimate fermentation of lactose provides an additional energy source during oxygen-limited growth.

A similar result of partial complementation was observed for Pspac-driven opuC operon [22]. Additionally, we found that the down-regulation of yhcSR expression effectively inhibited bacterial growth, whereas the complementation of the opuC operon enhanced bacterial growth of the bacteria in the high osmotic medium, and the supplementation of the high osmotic medium with choline restored bacterial growth to that equal of the cells in CDM with ATc alone. These data indicate that YhcSR is involved in the modulation of the transportation of the osmoprotectant choline through direct regulation of opuC operon expression. The transport of choline by OpuCABCD and their role in osmoprotection has been well established [24], [42][44]. In S. aureus, OpuCA interacts with and influences the level of phosphorylated TRAP protein, a protein that protects DNA from oxidative stress [24], [45]. The kinase activity of YhcS is influenced by oxidative stress (such as H2O2) [11] and the regulation of opuC by YhcSR is likely part of the overall stress response that occurs when S. aureus encounters stressful environmental conditions. The upregulation of multiple stress response pathways likely allows the cell to better handle additional environmental insults.

We have previously used yhcS antisense RNA to demonstrate the essential nature of YhcSR in a hospital-associated (HA)-MRSA strain, WCUH29 [10], [21]. A recent publication suggested the essential nature of YhcSR was strain specific, as their MSSA strain Newman yhcS antisense RNA strain had no growth defect [11]. To investigate this claim, we introduced our yhcS antisense RNA plasmid into S. aureus Newman and community associated (CA)-MRSA S. aureus 923 (supplementary Figure S1). Contrary to the other authors’ results, we found S. aureus Newman to be extremely sensitive to our yhcS antisense RNA. The yhcS antisense RNA Newman strain exhibited poorer growth without induction of the antisense RNA compared to the empty vector control; and severely inhibited growth was detected with as little as 250 ng/µl of antisense RNA inducer, anhydrotetracycline (ATc) in TSB. The other authors did not provide evidence that their antisense RNA actually reduced yhcS RNA or protein product, thus it is likely that their antisense RNA was ineffective and did not work as designed. We have previously demonstrated yhcS RNA knockdown and YhcR protein loss using our yhcS antisense RNA plasmid after ATc induced expression [10]. A similar growth defect was seen in S. aureus 923, but higher induction of the yhcS antisense RNA was needed to inhibit growth. The difference in sensitivity to the yhcS antisense RNA between MSSA Newman and the MRSA strains may be due to their genetic differences [8], [15]. Taken together, the above data indicate that the YhcSR system is essential for all S. aureus strains tested, including HA-MRSA, CA-MRSA, and MSSA.

Structural alignment indicates that YhcS and YhcR are more than 40% identical to YhcY and YhcZ in B. subtilis. However, unlike the YycFG system which is essential for B. subtilis and S. aureus [9], [12], YhcYZ is dispensable for B. subtilis growth [46]. The YhcSR system may play different roles in S. aureus compared to the YhcHZ system in B. subtilis. In B. subtilis, only limited genes are regulated by YhcHZ [47]. In contrast, in S. aureus our preliminary microarray results showed that more than 80 genes are modulated by YhcSR (data not shown). This is also true for the YycFG system because YycF is involved in the regulation of the FtsAZ operon in B. subtilis [14], whereas there is no such evidence in S. aureus and S. pneumoniae [16], [18][20], [33], [48].

Interestingly, our preliminary microarray and qPCR analyses also indicate that the essential YhcSR system is probably a repressor of virulence factors because the down-regulation of yhcSR expression dramatically increased the expression of coagulase, fibronectin binding protein, and exotoxin (Table 3), possibly through regulation of the agr and sae operons [11]. This suggests that the YhcSR system may function as a global regulator.

Supporting Information

Figure S1

Growth of S. aureus Newman and S. aureus 923 with yhcS antisense RNA plasmid. MSSA S. aureus Newman and MRSA S. aureus 923 were electroporated with the control plasmid, pYH3, or the yhcS antisense RNA plasmid, pSAS909 [10]. Overnight cultures of S. aureus strains were diluted to ∼104 CFU/ml with TSB containing 5 µg/ml of erythromycin and different concentrations of an inducer [anhydrotetracycline, (ATc), at concentrations of 0, 100, 250 ng/ml]. (A) Represents the growth curves of the control Newman strain and yhcS antisense RNA strain, Newman-606 and (B) represents the MRSA923 control and yhcS antisense RNA strain, MRSA923-606. Cell growth was monitored at 37°C by measuring the optical density at 600 nm (OD600) every 15 min, with 1 min of mixing before each reading in a BioTek Synergy II Microplate Reader. The grow curves represent one of three repeated experiments.

(TIFF)

Acknowledgments

We thank Aaron Becker for his assistance with the microarray analysis.

Funding Statement

This work was supported by a grant from the National Institutes of Health (AI057451). The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Grundmann H, Aires-de-Sousa M, Boyce J, Tiemersma E (2006) Emergence and resurgence of meticillin-resistant Staphylococcus aureus as a public-health threat. Lancet 368: 874–885 doi:10.1016/S0140-6736(06)68853-3. [DOI] [PubMed] [Google Scholar]
  • 2. Kazakova SV, Hageman JC, Matava M, Srinivasan A, Phelan L, et al. (2005) A clone of methicillin-resistant Staphylococcus aureus among professional football players. N Engl J Med 352: 468–475 doi:10.1056/NEJMoa042859. [DOI] [PubMed] [Google Scholar]
  • 3.Rice LB (2006) Antimicrobial resistance in gram-positive bacteria. Am J Med 119: S11–19; discussion S62–70. doi:10.1016/j.amjmed.2006.03.012. [DOI] [PubMed]
  • 4. Gross R (1993) Signal transduction and virulence regulation in human and animal pathogens. FEMS Microbiol Rev 10: 301–326. [DOI] [PubMed] [Google Scholar]
  • 5. Stock AM, Robinson VL, Goudreau PN (2000) Two-component signal transduction. Annu Rev Biochem 69: 183–215 doi:10.1146/annurev.biochem.69.1.183. [DOI] [PubMed] [Google Scholar]
  • 6. Li Y-H, Lau PCY, Tang N, Svensäter G, Ellen RP, et al. (2002) Novel two-component regulatory system involved in biofilm formation and acid resistance in Streptococcus mutans. J Bacteriol 184: 6333–6342. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Novick RA, Microbiology AS for (2006) Staphylococcal pathogenesis and pathogenicity factors: genetics and regulation. Gram-positive pathogens. Wiley-Blackwell.
  • 8. Barrett JF, Hoch JA (1998) Two-Component Signal Transduction as a Target for Microbial Anti-Infective Therapy. Antimicrob Agents Chemother 42: 1529–1536. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Martin PK, Li T, Sun D, Biek DP, Schmid MB (1999) Role in cell permeability of an essential two-component system in Staphylococcus aureus. J Bacteriol 181: 3666–3673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Sun J, Zheng L, Landwehr C, Yang J, Ji Y (2005) Identification of a novel essential two-component signal transduction system, YhcSR, in Staphylococcus aureus. Journal of bacteriology 187: 7876. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Sun F, Ji Q, Jones MB, Deng X, Liang H, et al. (2011) AirSR, a [2Fe-2S] Cluster-Containing Two-Component System, Mediates Global Oxygen Sensing and Redox Signaling in Staphylococcus aureus. J Am Chem Soc 134: 305–314 doi:10.1021/ja2071835. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Fabret C, Hoch JA (1998) A Two-Component Signal Transduction System Essential for Growth of Bacillus subtilis: Implications for Anti-Infective Therapy. J Bacteriol 180: 6375–6383. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Throup JP, Koretke KK, Bryant AP, Ingraham KA, Chalker AF, et al. (2000) A genomic analysis of two-component signal transduction in Streptococcus pneumoniae. Mol Microbiol 35: 566–576. [DOI] [PubMed] [Google Scholar]
  • 14. Fukuchi K, Kasahara Y, Asai K, Kobayashi K, Moriya S, et al. (2000) The essential two-component regulatory system encoded by yycF and yycG modulates expression of the ftsAZ operon in Bacillus subtilis. Microbiology (Reading, Engl) 146 (Pt 7): 1573–1583. [DOI] [PubMed] [Google Scholar]
  • 15. Bisicchia P, Noone D, Lioliou E, Howell A, Quigley S, et al. (2007) The essential YycFG two-component system controls cell wall metabolism in Bacillus subtilis. Molecular Microbiology 65: 180–200 doi:10.1111/j.1365-2958.2007.05782.x. [DOI] [PubMed] [Google Scholar]
  • 16. Dubrac S, Msadek T (2004) Identification of Genes Controlled by the Essential YycG/YycF Two-Component System of Staphylococcus aureus. J Bacteriol 186: 1175–1181 doi:10.1128/JB.186.4.1175-1181.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Howell A, Dubrac S, Andersen KK, Noone D, Fert J, et al. (2003) Genes controlled by the essential YycG/YycF two-component system of Bacillus subtilis revealed through a novel hybrid regulator approach. Mol Microbiol 49: 1639–1655. [DOI] [PubMed] [Google Scholar]
  • 18. Mohedano ML, Overweg K, de la Fuente A, Reuter M, Altabe S, et al. (2005) Evidence that the essential response regulator YycF in Streptococcus pneumoniae modulates expression of fatty acid biosynthesis genes and alters membrane composition. J Bacteriol 187: 2357–2367 doi:10.1128/JB.187.7.2357-2367.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Ng W, Robertson GT, Kazmierczak KM, Zhao J, Gilmour R, et al. (2003) Constitutive expression of PcsB suppresses the requirement for the essential VicR (YycF) response regulator in Streptococcus pneumoniae R6§. Molecular Microbiology 50: 1647–1663 doi:10.1046/j.1365-2958.2003.03806.x. [DOI] [PubMed] [Google Scholar]
  • 20. Ng W, Kazmierczak KM, Winkler ME (2004) Defective cell wall synthesis in Streptococcus pneumoniae R6 depleted for the essential PcsB putative murein hydrolase or the VicR (YycF) response regulator. Molecular Microbiology 53: 1161–1175 doi:10.1111/j.1365-2958.2004.04196.x. [DOI] [PubMed] [Google Scholar]
  • 21. Yan M, Yu C, Yang J, Ji Y (2011) The Essential Two-Component System YhcSR Is Involved in Regulation of the Nitrate Respiratory Pathway of Staphylococcus aureus. Journal of Bacteriology 193: 1799–1805 doi:10.1128/JB.01511-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Yan M, Yu C, Yang J, Ji Y (2009) Development of shuttle vectors for evaluation of essential regulator regulated gene expression in Staphylococcus aureus. Plasmid 61: 188–192 doi:10.1016/j.plasmid.2009.02.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Oskouian B, Stewart GC (1990) Repression and catabolite repression of the lactose operon of Staphylococcus aureus. J Bacteriol 172: 3804–3812. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Kiran MD, Akiyoshi DE, Giacometti A, Cirioni O, Scalise G, et al. (2009) OpuC–an ABC transporter that is associated with Staphylococcus aureus pathogenesis. Int J Artif Organs 32: 600–610. [DOI] [PubMed] [Google Scholar]
  • 25.Ji Y, Yu C, Liang X (2007) Transcriptomic Analysis of ArlRS Two‐Component Signaling Regulon, a Global Regulator, in Staphylococcus aureus. Two‐Component Signaling Systems, Part B. Academic Press, Vol. Volume 423. 502–513. Available:http://www.sciencedirect.com/science/article/pii/S0076687907230241. Accessed 7 February 2012. [DOI] [PubMed]
  • 26. Liang X, Zheng L, Landwehr C, Lunsford D, Holmes D, et al. (2005) Global regulation of gene expression by ArlRS, a two-component signal transduction regulatory system of Staphylococcus aureus. J Bacteriol 187: 5486–5492 doi:10.1128/JB.187.15.5486-5492.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Miller AA, Engleberg NC, DiRita VJ (2001) Repression of virulence genes by phosphorylation-dependent oligomerization of CsrR at target promoters in S. pyogenes. Mol Microbiol 40: 976–990. [DOI] [PubMed] [Google Scholar]
  • 28. Manna AC, Ingavale SS, Maloney M, van Wamel W, Cheung AL (2004) Identification of sarV (SA2062), a new transcriptional regulator, is repressed by SarA and MgrA (SA0641) and involved in the regulation of autolysis in Staphylococcus aureus. J Bacteriol 186: 5267–5280 doi:10.1128/JB.186.16.5267-5280.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Manna AC, Cheung AL (2006) Transcriptional regulation of the agr locus and the identification of DNA binding residues of the global regulatory protein SarR in Staphylococcus aureus. Mol Microbiol 60: 1289–1301 doi:10.1111/j.1365-2958.2006.05171.x. [DOI] [PubMed] [Google Scholar]
  • 30. Yin D, Fox B, Lonetto ML, Etherton MR, Payne DJ, et al. (2004) Identification of antimicrobial targets using a comprehensive genomic approach. Pharmacogenomics 5: 101–113 doi:10.1517/phgs.5.1.101.25679. [DOI] [PubMed] [Google Scholar]
  • 31. Vilhelmsson O, Miller KJ (2002) Humectant Permeability Influences Growth and Compatible Solute Uptake by Staphylococcus aureus Subjected to Osmotic Stress. Journal of Food Protection 65: 1008–1015. [DOI] [PubMed] [Google Scholar]
  • 32. Vijaranakul U, Nadakavukaren MJ, Bayles DO, Wilkinson BJ, Jayaswal RK (1997) Characterization of an NaCl-sensitive Staphylococcus aureus mutant and rescue of the NaCl-sensitive phenotype by glycine betaine but not by other compatible solutes. Appl Environ Microbiol 63: 1889–1897. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Kuroda M, Kuroda H, Oshima T, Takeuchi F, Mori H, et al. (2003) Two-component system VraSR positively modulates the regulation of cell-wall biosynthesis pathway in Staphylococcus aureus. Mol Microbiol 49: 807–821. [DOI] [PubMed] [Google Scholar]
  • 34. Forsyth R, Haselbeck RJ, Ohlsen KL, Yamamoto RT, Xu H, et al. (2002) A genome-wide strategy for the identification of essential genes in Staphylococcus aureus. Molecular microbiology 43: 1387–1400. [DOI] [PubMed] [Google Scholar]
  • 35. Ji Y (2001) Identification of Critical Staphylococcal Genes Using Conditional Phenotypes Generated by Antisense RNA. Science 293: 2266–2269 doi:10.1126/science.1063566. [DOI] [PubMed] [Google Scholar]
  • 36. Liang X, Yu C, Sun J, Liu H, Landwehr C, et al. (2006) Inactivation of a Two-Component Signal Transduction System, SaeRS, Eliminates Adherence and Attenuates Virulence of Staphylococcus aureus. Infection and Immunity 74: 4655–4665 doi:10.1128/IAI.00322-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Dunman PM, Murphy E, Haney S, Palacios D, Tucker-Kellogg G, et al. (2001) Transcription Profiling-Based Identification ofStaphylococcus aureus Genes Regulated by the agrand/or sarA Loci. J Bacteriol 183: 7341–7353 doi:10.1128/JB.183.24.7341-7353.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Luong TT, Dunman PM, Murphy E, Projan SJ, Lee CY (2006) Transcription Profiling of the mgrA Regulon in Staphylococcus aureus. J Bacteriol 188: 1899–1910 doi:10.1128/JB.188.5.1899-1910.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Huang KJ, Lan CY, Igo MM (1997) Phosphorylation stimulates the cooperative DNA-binding properties of the transcription factor OmpR. Proc Natl Acad Sci USA 94: 2828–2832. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Pragman AA, Yarwood JM, Tripp TJ, Schlievert PM (2004) Characterization of Virulence Factor Regulation by SrrAB, a Two-Component System in Staphylococcus aureus. J Bacteriol 186: 2430–2438 doi:10.1128/JB.186.8.2430-2438.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Head CG, Tardy A, Kenney LJ (1998) Relative binding affinities of OmpR and OmpR-phosphate at the ompF and ompC regulatory sites. J Mol Biol 281: 857–870 doi:10.1006/jmbi.1998.1985. [DOI] [PubMed] [Google Scholar]
  • 42. Chen C, Beattie GA (2007) Characterization of the osmoprotectant transporter OpuC from Pseudomonas syringae and demonstration that cystathionine-beta-synthase domains are required for its osmoregulatory function. J Bacteriol 189: 6901–6912 doi:10.1128/JB.00763-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Kappes RM, Kempf B, Kneip S, Boch J, Gade J, et al. (1999) Two evolutionarily closely related ABC transporters mediate the uptake of choline for synthesis of the osmoprotectant glycine betaine in Bacillus subtilis. Mol Microbiol 32: 203–216. [DOI] [PubMed] [Google Scholar]
  • 44. Verheul A, Glaasker E, Poolman B, Abee T (1997) Betaine and L-carnitine transport by Listeria monocytogenes Scott A in response to osmotic signals. J Bacteriol 179: 6979–6985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Kiran MD, Balaban N (2009) TRAP plays a role in stress response in Staphylococcus aureus. Int J Artif Organs 32: 592–599. [DOI] [PubMed] [Google Scholar]
  • 46. Ogura M, Yamaguchi H, Yoshida Ki, Fujita Y, Tanaka T (2001) DNA microarray analysis of Bacillus subtilis DegU, ComA and PhoP regulons: an approach to comprehensive analysis of B.subtilis two-component regulatory systems. Nucleic Acids Res 29: 3804–3813. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47. Kobayashi K, Ogura M, Yamaguchi H, Yoshida K, Ogasawara N, et al. (2001) Comprehensive DNA microarray analysis of Bacillus subtilis two-component regulatory systems. J Bacteriol 183: 7365–7370 doi:10.1128/JB.183.24.7365-7370.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Dubrac S, Boneca IG, Poupel O, Msadek T (2007) New insights into the WalK/WalR (YycG/YycF) essential signal transduction pathway reveal a major role in controlling cell wall metabolism and biofilm formation in Staphylococcus aureus. J Bacteriol 189: 8257–8269 doi:10.1128/JB.00645-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Kreiswirth BN, Löfdahl S, Betley MJ, O’Reilly M, Schlievert PM, et al. (1983) The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature 305: 709–712. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1

Growth of S. aureus Newman and S. aureus 923 with yhcS antisense RNA plasmid. MSSA S. aureus Newman and MRSA S. aureus 923 were electroporated with the control plasmid, pYH3, or the yhcS antisense RNA plasmid, pSAS909 [10]. Overnight cultures of S. aureus strains were diluted to ∼104 CFU/ml with TSB containing 5 µg/ml of erythromycin and different concentrations of an inducer [anhydrotetracycline, (ATc), at concentrations of 0, 100, 250 ng/ml]. (A) Represents the growth curves of the control Newman strain and yhcS antisense RNA strain, Newman-606 and (B) represents the MRSA923 control and yhcS antisense RNA strain, MRSA923-606. Cell growth was monitored at 37°C by measuring the optical density at 600 nm (OD600) every 15 min, with 1 min of mixing before each reading in a BioTek Synergy II Microplate Reader. The grow curves represent one of three repeated experiments.

(TIFF)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES