Skip to main content
Neoplasia (New York, N.Y.) logoLink to Neoplasia (New York, N.Y.)
. 2012 Nov;14(11):1043–1056. doi: 10.1593/neo.121358

Unveiling the Association of STAT3 and HO-1 in Prostate Cancer: Role beyond Heme Degradation1

Belen Elguero *, Geraldine Gueron *, Jimena Giudice *,†, Martin A Toscani *,‡, Paola De Luca *, Florencia Zalazar *, Federico Coluccio-Leskow *,‡, Roberto Meiss §, Nora Navone , Adriana De Siervi *, Elba Vazquez *
PMCID: PMC3514752  PMID: 23226098

Abstract

Activation of the androgen receptor (AR) is a key step in the development of prostate cancer (PCa). Several mechanisms have been identified in AR activation, among them signal transducer and activator of transcription 3 (STAT3) signaling. Disruption of STAT3 activity has been associated to cancer progression. Recent studies suggest that heme oxygenase 1 (HO-1) may play a key role in PCa that may be independent of its catalytic function. We sought to explore whether HO-1 operates on AR transcriptional activity through the STAT3 axis. Our results display that HO-1 induction in PCa cells represses AR activation by decreasing the prostate-specific antigen (PSA) promoter activity and mRNA levels. Strikingly, this is the first report to show by chromatin immunoprecipitation analysis that HO-1 associates to gene promoters, revealing a novel function for HO-1 in the nucleus. Furthermore, HO-1 and STAT3 directly interact as determined by co-immunoprecipitation studies. Forced expression of HO-1 increases STAT3 cytoplasmic retention. When PCa cells were transfected with a constitutively active STAT3 mutant, PSA and STAT3 downstream target genes were abrogated under hemin treatment. Additionally, a significant decrease in pSTAT3 protein levels was detected in the nuclear fraction of these cells. Confocal microscopy images exhibit a decreased rate of AR/STAT3 nuclear co-localization under hemin treatment. In vivo studies confirmed that STAT3 nuclear delimitation was significantly decreased in PC3 tumors overexpressing HO-1 grown as xenografts in nude mice. These results provide a novel function for HO-1 down-modulating AR transcriptional activity in PCa, interfering with STAT3 signaling, evidencing its role beyond heme degradation.

Introduction

Prostate cancer (PCa) is the second leading cause of cancer-associated death in men. Androgens and the androgen receptor (AR) are critical in PCa development and progression [1]. AR-mediated transcription requires the formation of an activation complex through the recruitment of several co-activators of transcription and transcription factors, which will ultimately determine target activation [2]. The potency and selectivity for subreactions of transcription reside in the co-activators, and thus, they are critically important for tissue-selective gene function [3,4]. There is an increasing recognition that co-activators also regulate a variety of biological processes outside of the nucleus such as mRNA translation, mitochondrial function, invasion, and motility [3].

Cytokines have been implicated in the modulation of AR activation as well as the growth and differentiation of PCa [5]. Oxidative damage also plays key roles in prostate carcinogenesis [6]. Elevated reactive oxygen species generation has been associated with inflammation and malignant transformation [7]. An altered cellular microenvironment could induce posttranslational changes in certain co-regulators with different compartmental functions [3,4].

The induction of heme oxygenase 1 (HO-1), the rate-limiting enzyme in heme degradation, represents a key event in cellular responses to pro-oxidative and pro-inflammatory insults [8]. It participates in the maintenance of cellular homeostasis by reducing oxidative injury, attenuating inflammation and regulating cell proliferation. There are differences in HO-1 basal expression profiles among cells and tissues and its pleiotropic effects to restore homeostasis. Thus, HO-1 has been proposed to act as a biosensor regulating cell destination [9]. Previous reports from our laboratory documented for the first time the nuclear expression of HO-1 in human primary prostate carcinomas [10]. We also showed that HO-1 nuclear localization inhibits cell proliferation, migration, and invasion in vitro and that HO-1 impairs tumor growth in vivo [11]. In addition, we previously established a key role for HO-1 as a modulator of the angiogenic switch in prostate carcinogenesis [12]. Moreover, we showed evidence that the anti-angiogenic function of HO-1 was mediated by repression of nuclear factor kappa-light-chain-enhancer of activated B cells (NFκB) signaling pathway [12].

A better understanding of the molecular mechanisms underlying the development of PCa may help to identify novel targets for pharmacological intervention in this disease. In this regard, the nature of signal transduction pathways whose aberrant activity promotes the unregulated growth and survival of PCa cells and tumors is continuously under study. The signal transducer and activator of transcription 3 (STAT3) modulates the expression of genes induced by interleukins (ILs), such as IL-6, and this transcription factor associates to AR and activates AR response elements [13,14]. It has been reported that STAT3 is constitutively active in PCa and its expression was correlated with the malignant severity of these tumors [13,15]. Furthermore, STAT3 inhibitor PIAS3 can compete with AR for STAT3 binding, thus repressing the expression of STAT3-mediated AR downstream target genes [16]. These data suggest a direct interaction and cross talk between cytokines and AR signaling pathways in PCa [17].

Here, we present data that support a novel function for HO-1 in the nucleus. We found that HO-1 associates to the proximal promoter of genes involved in PCa progression. We also show a cross talk between AR/STAT3 and HO-1 pathways. These data further support the anti-tumorigenic properties of HO-1 in PCa.

Materials and Methods

Cell Culture, Treatments, Reagents, and Antibodies

LNCaP and PC3 cells were obtained from the American Type Culture Collection (Manassas, VA) and were routinely cultured in RPMI 1640 (Invitrogen, Buenos Aires, Argentina) supplemented with 10% FBS. PC3 stable transfected cells (PC3HO-1 and PC3pcDNA3) were previously described [11].

Testosterone undecanoate was purchased from SCHERING (Buenos Aires, Argentina). Hemin was obtained from Sigma-Aldrich (St Louis, MO) and IL-6 from Endogen (Thermo Fisher Scientific Inc, Rockford, IL). Cells were incubated 24 hours in phenol red-free RPMI media containing 10% charcoal-stripped FBS and then were exposed to testosterone (10 µM), hemin (80 µM), and/or IL-6 (10 ng/ml) by 24 hours.

Polyclonal anti-HO-1 and monoclonal anti-HO-1 were from Stressgen Biotechnologies Corp (San Diego, CA). Anti-AR, laminin A/C, and anti-STAT3 antibodies were from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-β-actin antibody was from Sigma-Aldrich. Anti-mouse and anti-rabbit secondary antibodies were from Amersham (GE Healthcare, Piscataway, NJ). Anti-pSTAT3 antibody was from Cell Signaling Technology (Beverly, MA). Alexa Fluor 488 goat anti-mouse and Alexa Fluor 555 goat anti-rabbit antibodies were from Molecular Probes (Invitrogen).

Plasmids and PSA Luciferase Cloning

The human pcDNA3 AR5 expression vector was kindly provided by Dr G. Jenster (Department of Urology, Josephine Nefkens Institute, Erasmus University Rotterdam, Rotterdam, The Netherlands). The human pcDNA3 HO-1 expression vector was kindly provided by Dr M. Mayhofer (Clinical Institute for Medical and Chemical Laboratory Diagnostics, University of Vienna, Vienna, Austria). The dominant negative STAT3 vector (STAT3 DN) and the constitutively activated STAT3 mutant (STAT-C) were kindly provided by Dr James Darnell (Rockefeller University, New York, NY). The pSPAX2, pMD2G, pSEW-shSTAT3.1, pSEW-shSTAT3.2, and pSEW-GL2 were kindly provided by Bernd Groner (Georg Speyer Haus, Institute for Biomedical Research, Frankfurt, Germany).

The pGL3 prostate-specific antigen (PSA) luciferase vector was generated. Briefly, long PCR Enzyme Mix (Fermentas; Thermo Fisher Scientific Inc, Rockford, IL) was used to amplify the PSA promoter region (4.3-kb upstream the transcription start site) from human DNA using specific primers: 5′ATTCTCGAGTTCATGTTCACATTAGTACACCTTGC3′ and 5′GTTAAGCTTTGCTGCTGGAGGCTGGAC3′. Cycling included a step at 94°C for 2 minutes followed by 10 cycles of 94°C to 20 seconds, 68°C to 3 minutes and 25 cycles of 94°C to 20 seconds, 68°C to 3 minutes + 10 seconds per cycle, with a final step at 68°C to 10 minutes. The pGL3 empty vector and the polymerase chain reaction (PCR) product were purified (Qiaquick PCR Purification Kit; QIAGEN, Valencia, CA) and digested with 0.5 U/µl of HindIII and XhoI (37°C, overnight; Fermentas). After pGL3 dephosphorylation [calf intestinal alkaline phosphatase (CIAP), 0.034 U/µl; Invitrogen], the PCR-digested fragment and vector (3:1) were ligated using T4 DNA Ligase (Invitrogen) and used to transform competent Escherichia coli DH5α. PSA promoter insert was checked on the clones by digestion and sequencing using specific primers (F1:5′ATTCTCGAGGGCACACGGCACCTGTAATCC3′, F2:5′ TTCTCGAGCTCACTGTGCTTGGAGTTTACCTG3′, F3:5′ ATTCTCGAGGGTGTCATCCACTCATCATCCAG3′, F4:5′ ATTCTCGAGTTCATGTTCACATTAGTACACCTTGC3′, R1:5′GTTAAGCTTTGCTGCTGGAGGCTGGAC3′, R2:5′ GGCAGGAGAATCACTTGAAC3′, R3:5′GCTCACGCCTGTAATCCCAAC3′).

Transfections and Luciferase Assay

LNCaP and PC3 cells were seeded on 12-well plates (1.2 x 105 cells per well). Expression vectors (2 µg) and/or PSA luciferase plasmid (2 µg) were co-transfected in PC3 or LNCaP cells using Lipofectamine 2000 (Invitrogen). Luciferase activity was determined by the Luciferase Assay System (Promega, Madison, WI) in a Glomax luminometer (Promega). Transfections were performed in triplicate and each experiment was repeated at least three times. Data were normalized to total protein determined by the Bradford assay.

RNA Isolation and Reverse Transcription-Quantitative PCR

Total RNA was isolated with TRIREAGENT (Molecular Research Center, Cincinnati, OH) according to the manufacturer's protocol. cDNAs were synthesized with RevertAid Premium First Strand cDNA Synthesis Kit (Fermentas) and used for real-time PCR amplification with Taq DNA Polymerase (Invitrogen) in a DNA Engine Opticon (MJ Research, Esco Technologies, Inc, Hatboro, PA). Primers sequences used were given as follows: HO-1, 5′GAGTGTAAGGACCCATCGGA3′ and 5′GCCAGCAACAAAGTGCAAG3′; survivin, 5′GGAGCCAGATGACGACCCCA3′ and 5′AGCGCAACCGGACGAATGCT3′; cyclin D1, 5′GCGGAGGAGAACAAACAGAT3′ and 5′TGAGGCGGTAGTAGGACAGG3′; Bcl-xL, 5′ GGTATTGGTGAGTCGGATCG3′ and 5′TTCCACAAAAGTATCCCAGC3′; STAT3, 5′AGCATCCTGAAGCTGACCCAGGT3′ and 5′TCGGCAGGTCAATGGTATTGCTGC3′; PSA, 5′GTTGTCTTCCTCACCCTGTCC3′ and 5′ACTGCCCTGCCACGAGAG3′; uPA, 5′GAGATCACTGGCTTTGGAAAA3′ and 5′CCAGCTCACAATTCCAGTCA3′; and β-actin, 5′CGGTTGGCCTTAGGGTTCAGGGGGG3′ and 5′GTGGGCCGCTCTAGGCACCA3′. Data were analyzed by Opticon-3 software and normalized to β-actin and control. Errors were calculated as previously described [11].

Immunoblot Analysis

The nuclear/cytoplasmic lysates and immunoblot analysis were carried out as previously described [10].

Co-immunoprecipitation

LNCaP cells were treated as described above and harvested in lysis buffer [20 mM Tris-HCl (pH 8), 137 mM NaCl, 10% glycerol, 2 mM EDTA, 1% Triton X-100, 1 x protease inhibitor mixture (Sigma-Aldrich), 100 µg/ml PMSF, 20 mM NaF, and 1 mM NaVO4]. Five hundred micrograms of protein in lysis buffer was incubated overnight at 4°C with 8 µg of anti-HO-1 antibody. Protein G Agarose beads (Invitrogen) were added to each tube for 3 hours at 4°C. Beads were washed with ice-cold lysis buffer. Fifty micrograms of the lysate was used as input. Immune complexes were analyzed by immunoblot with anti-STAT3 and anti-HO-1 antibodies.

Immunofluorescence and Microscopy

Cells were seeded in 12-well plates at a density of 1 x 105 cells per well on coverslips overnight. Cells were treated as described above and were fixed in ice-cold methanol and permeabilized for 10 minutes with 0.5% Triton X-100/phosphate-buffered saline (PBS), washed with PBS, and then blocked with 5% BSA/PBS. Cells were incubated overnight with primary antibodies diluted in 4% BSA and 0.1% Tween 20 in PBS. Cells were then washed with PBS and incubated with fluorescent secondary antibodies. Negative controls were carried out using PBS instead of primary antibodies. Cells were washed, mounted, and imaged by confocal laser scanning microscopy, which was performed with an Olympus Fluo view FV 1000 microscope, using an Olympus 60x/1.20 NA UPLAN APO water immersion objective. Excitation and emission filters were given as follows: Alexa Fluor 488: excitation, 488 nm; emission, band pass 505 to 525 nm; Alexa Fluor 555: excitation, 543 nm; emission, band pass 560 to 620 nm.

Wide field microscopy was carried out using an Olympus IX71 microscope with a 40x 1.15 numerical aperture (NA) water immersion objective, a mercury arc lamp excitation, and suitable filters (camera: Hamamatsu Orca CCD C4742-95).

Image Processing

Confocal and wide field microscope images were processed for presentation with ImageJ (http://rsb.info.nih.gov, National Institutes of Health). Background of each channel was subtracted, and in some cases a median filter (radius, 1 pixel), was applied only for presentation.

Co-localization Analysis

After background subtraction and segmentation of each cell, we applied the ImageJ plug-in Intensity correlation to calculate Manders coefficients. Product of the Differences from the Mean (PDM) and frequency plot graphs were performed also with ImageJ plug-ins. We analyzed 14 to 26 cells of each treatment.

STAT3 Translocation Experiments by Microscopy

Image processing was performed by creation of a homemade routine using Matlab.

Segmentation (nucleus and cytoplasm). Channel backgrounds (median) were subtracted and a median filter (1 pixel) was applied. Segmentation was performed for each cell using the HO-1 (green) images. After cell segmentation, the nucleus was defined as the pixels where the 4′,6-diamidino-2-phenylindole (DAPI) signal (blue) was higher than 60 counts. This segmentation leaded to the creation of two masks: “cell” and “nucleus.”

Estimation of the cellular distribution of STAT3. Values in the “nucleus” and in the “cell” were summed for the red channel (STAT3). Therefore, we obtained the total STAT3 (STAT3t) and the nuclear STAT3 (STAT3n). To compute the distribution of the red fluorescence, we calculated the ratio STAT3n/STAT3t. This “internal calibration” approach was chosen to remove the influence of the amplifier gain and the zoom factor for each image acquisition conditions.

Chromatin Immunoprecipitation

HO-1 chromatin immunoprecipitation (ChIP) experiments were conducted as previously described [18] using a polyclonal anti-HO-1 antibody and a nonspecific control antibody (GAL4 or IgG). Briefly, treated LNCaP cells were fixed with formaldehyde and fixation was stopped with 125 mM glycine. The cells were lysed in IP buffer [50 mM Tris (pH 7.4), 150 mM NaCl, 5 mM EDTA (pH 8), 0.5% NP40, and 1% Triton X-100] with 1 x protease inhibitor mixture (Sigma-Aldrich). Chromatin was sheared to an average size of 300 bp by sonication using a Branson Sonifier Cell Disruptor. Polyclonal anti-HO-1 (12 µg) or GAL4 (0.5 µg) antibodies were added to lysates and rotated at 4°C overnight. Protein G Sepharose beads and 50 µl of salmon sperm DNA (1 mg/ml; Invitrogen) were added and incubated for 3 hours at 4°C. Immunocomplexes were washed. After reversal cross-link, the immunoprecipitated chromatin was dissolved in 200 µl of water. Ten percent of total protein of cross-linked lysate was used as a positive control (total input). Immunopurified DNA was used for qPCR. Data from ChIP assay were presented as fold enrichment (the ratio between precipitated DNA over total input) and then relative to nonspecific control β-globin. Primers used are located at the proximal promoter region of the selected targets. Primer sequences were given as follows: matrix metalloproteinase 9 (MMP9), 5′-CCCTCCCTCCCTTTCATACAGTTC-3′ and 5′-GCTTACACCACCTCCTCCTCTC-3′; cyclin D1, 5′-CCCCGCAAGGACCGACTG-3′ and 5′-AAATTCCAGCAGCAGCCCAAG-3′; vascular endothelial growth factor A (VEGF-A), 5′-GGGTTGAGGGCGTTGGAG-3′ and 5′-GAGGGAGCAGGAAAGTGAGG- 3′; uPA, 5′-TGAGGCAGTCTTAGGCAAGTTGG- 3′ and 5′-GGCTTGTAAATTCTCCGTGCTTCC-3′; PSA, 5′-GCTCTCCCTCCCCTTCCACAG-3′ and 5′-GGCACCCAGAGGCTGACCAAG- 3′; β-globin, 5′-TTTGCAGCCTCACCTTCTTT-3′ and 5′-TGGGGGATATTATGAAGGGC-3′.

Human PCa Xenograft Model

Mice xenografts using PC3HO-1 and PC3pcDNA3 cell lines were previously described [11].

Immunohistochemical and Immunocytochemical Analyses

Immunohistochemical and immunocytochemical techniques were performed as previously described [10,11].

shSTAT3 Transduction Protocol

For lentivirus packaging, HEK293LTV were transfected with 3.64 µg of pSPAX2, 1.45 µg of pMD2G, and 1.97 of µg pSEW-shSTAT3.1 plus 2.43 µg of pSEW-shSTAT3.2 or 4.4 µg of pSEW-GL2 as control using 15 µl of Lipofectamine 2000 (Invitrogen). LNCaP cells were transduced every 24 hours for four rounds with the viral supernatant previously filtered and 8 µg/ml polybrene. After 72-hour post-transduction, cells were harvested for RNA isolation.

Statistical Analysis

All results are given as mean ± SD of n separate independent experiments unless stated otherwise. Student's t test was used to ascertain statistical significance with a threshold of P < 0.05 (*) and P < 0.01 (**).

Results

HO-1 Overexpression Attenuates AR Signaling

Because of the critical role of HO-1 and AR in prostate carcinogenesis, we investigated the hypothesis that HO-1 could function as a modulator of AR activity in response to testosterone. LNCaP cells were co-transfected with the PSA-luc plasmid (4.3 kb PSA promoter fragment cloned upstream of the luciferase gene) and the HO-1 expression vector. Luciferase activity was determined after testosterone stimulation. The transcriptional activity of the PSA promoter induced by hormone was significantly repressed by HO-1 overexpression (Figure 1A). In addition, LNCaP cells were either transiently transfected with an HO-1 expression vector or treated with hemin (80 µM, 24 hours), a selective HO-1 inducer, and the levels of PSA mRNA were assessed by reverse transcription-quantitative PCR (RT-qPCR). As shown in Figure 1B, in both cases, PSA was transcriptionally repressed when HO-1 was induced genetically or pharmacologically (28.2% and 63.7%, respectively; P < 0.05). In both cases, HO-1 overexpression was validated by RT-qPCR (Figure 1B).

Figure 1.

Figure 1

HO-1 down-modulates hormone-induced PSA transcription in PCa cells. (A) LNCaP cells transiently transfected with pcDNA3HO-1 or empty vector (pcDNA3) were transfected with the PSA luciferase reporter plasmid. Cells were serum starved in phenol red-free media with or without testosterone (10 µM, 24 hours). Then, cells were lysed and luciferase activity assay was performed. Data were normalized to total protein values. One representative from at least three independent experiments is shown. (B) mRNA expression levels by real-time RT-qPCR of PSA (left panel) and HO-1 (right panel) in LNCaP cells transfected with pcDNA3HO-1 or empty vector (upper panels) or exposed to hemin (80 µM, 24 hours) or vehicle (lower panels). Data were normalized to β-actin. One representative from at least three independent experiments is shown. (C) PC3 cells transient transfected with the pcDNA3 AR5 expression vector (PC3 AR) and with pcDNA3HO-1 or empty vector (pcDNA3) were transfected with the PSA luciferase reporter plasmid. Cells were serum starved in phenol red-free media with or without testosterone (10 µM, 24 hours). Then, cells were lysed and luciferase activity assay was performed. Data were normalized to protein values. One representative from at least three independent experiments is shown. Significant differences at **P < 0.01 and *P < 0.05.

To further confirm the inhibitory effect of HO-1 over AR transactivation, HO-1 overexpressing PC3 cells (PC3HO-1) and control cells (PC3pcDNA3) were co-transfected with AR expression vector and PSA-luc plasmid and then were exposed to testosterone or vehicle. We found that HO-1 overexpression partially abrogated (27.3%, P < 0.05) the hormone-induced PSA promoter activity in PC3 cells (Figure 1C).

These data revealed that HO-1 decreases hormone-induced AR transactivation, suggesting a direct role of HO-1 as a regulator of AR activity in response to testosterone.

HO-1 Binds to the uPA, MMP9, and PSA Promoters and Interacts with STAT3

We have previously reported the nuclear localization of HO-1 in human primary prostate carcinomas [10], in hemin-treated PCa cells and in PCa xenografts [11]. To further investigate the role of HO-1 in the nucleus, we examined the ability of HO-1 to associate to promoters of genes relevant to prostate carcinogenesis, such as uPA, MMP9, PSA, VEGF, and cyclin D1 by anti-HO-1 CHIP-qPCR. Interestingly, HO-1 was significantly enriched at the uPA, MMP9, and PSA proximal promoter regions in testosterone-stimulated LNCaP cells. However, HO-1 enrichment was not detected at the VEGF and cyclin D1 promoters (Figure 2A). β-Globin promoter was used as nonspecific enrichment. This is the first report showing HO-1 association to promoters, suggesting a novel function for HO-1 in the nucleus beyond its classic cytoplasmic role in heme degradation.

Figure 2.

Figure 2

HO-1 protein binds to genes involved in prostate carcinogenesis and associates to STAT3. (A) HO-1-ChIP was conducted from LNCaP cells exposed to testosterone (10 µM, 24 hours) or vehicle. DNA-ChIP was analyzed by qPCR using primers located at the proximal promoter region of uPA, MMP9, PSA, VEGF, and cyclin D1 genes or β-globin as negative control. Fold enrichment was calculated normalizing data to input and GAL4 antibody. Significant difference at *P < 0.05. (B) Left panel: LNCaP cells were treated with testosterone (10 µM, 24 hours), hemin (80 µM, 24 hours), both or vehicle. Cell extracts were immunoprecipitated using an anti-HO-1 polyclonal antibody or IgG as negative control. Complexes were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis/immunoblot assay with anti-STAT3, anti-AR, and anti-HO-1 antibodies. Right panel: AR protein levels were determined by Western blot analysis in whole-cell lysates extracted from LNCaP cells cultured with testosterone (10 µM, 24 hours), hemin (80 µM, 24 hours), both, or vehicle. β-Actin levels are shown to control for equal loading. (C) pSTAT3Y705, STAT3, and HO-1 protein levels were determined by Western blot analysis in whole-cell lysates extracted from control or IL-6 (10 ng/ml, 24 hours)-stimulated LNCaP cells and treated with testosterone (10 µM, 24 hours), hemin (80 µM, 24 hours), both, or vehicle (left lower panel). β-Actin levels are shown to control for equal loading. Bar graphs represent the quantitative measurement of pSTAT3Y705 normalized to total STAT3 (right upper panel) or STAT3 normalized to β-actin (right lower panel). The results were expressed as mean ± SEM.

Given that HO-1 is a short protein with no DNA binding motif [19], we next sought to test the hypothesis that HO-1 suppresses AR transcriptional activity as a result of a protein-protein interaction. We first analyzed the putative interactions by endogenous HO-1 co-immunoprecipitation in LNCaP cells exposed to hemin and stimulated with testosterone. As shown in Figure 2B, we detected no direct interaction between HO-1 and AR under any treatment.

Considering that STAT3 has been implicated in the pathogenesis of PCa [13] and has been shown to interact with AR [16,20], we investigated whether there was a direct protein-protein association between HO-1 and STAT3, which could mediate the effect of HO-1 in AR transcriptional activation. We detected by immunoblot STAT3 and HO-1 co-immunoprecipitation in LNCaP cells treated or not with hemin and/or testosterone (Figure 2B, left panel). By Western blot analysis, we corroborated AR induction under testosterone treatment (Figure 2B, right panel). In spite of the down-modulation of PSA (Figure 1), AR levels did not change by forcing the expression of HO-1 (Figure 2B, right panel), suggesting that HO-1 was affecting a signaling pathway involved in AR activation.

HO-1 Is a Negative Regulator of STAT3

To determine if HO-1 inhibitory effect on PSA levels might involve STAT3 signaling, we assessed whether HO-1 blocked STAT3 activation induced by IL-6, a well-known activator of STAT3 pathway in LNCaP cells. As shown in Figure 2C, IL-6 increased STAT3 activation (pSTAT3) and total protein (STAT3) levels in LNCaP cells. Interestingly, hemin significantly reduced STAT3 phosphorylation in the presence or absence of testosterone (Figure 2C).

Surprisingly, Western blot analysis of nuclear and cytoplasmic protein extracts from IL-6-treated LNCaP cells revealed that hemin exposure decreases the translocation of pSTAT3 to the nucleus, while at the same time pSTAT3 retention is increased in the cytoplasmic compartment (Figure 3A). The cytoplasmic and nuclear fraction enrichment was verified in all samples by detection of β-actin and laminin A/C, respectively (Figure 3A). Accordingly, quantitative analysis of confocal immunofluorescence showed that hemin treatment retained STAT3 in the cytoplasm over the predominant nuclear localization produced by IL-6 alone (Figure 3, B and C).

Figure 3.

Figure 3

HO-1 represses IL-6-stimulated STAT3 in LNCaP cells. (A) LNCaP cells were cultured for 24 hours and then were activated with IL-6 (10 ng/ml) and exposed to hemin (80 µM) or vehicle for 24 hours. Nuclear and cytoplasmic fractions were extracted, and pSTAT3Y705, STAT3, and HO-1 expression were analyzed by Western blot analysis. The purity of the cytoplasmic and nuclear fractions was verified in all samples by detection of β-actin and laminin A/C, respectively. One representative from at least three independent experiments is shown. Bar graph represents the quantitative measurement of pSTAT3Y705 normalized to STAT3. The results were expressed as mean ± SEM. Significant differences at **P < 0.01 and *P < 0.05. (B) STAT3 expression and cellular distribution was visualized by immunofluorescence staining of LNCaP cells treated with IL-6 plus hemin or IL-6 alone. A representative image for each group is shown. Cytoplasmic STAT3 retention is observed under hemin treatment. Scale bar, 10 µm. (C) Segmentation of the whole cell and nucleus (DAPI) was performed to calculate the ratio of STAT3n/STAT3t and Stat3c/STAT3t in a cell-by-cell analysis. Quantification of the subcellular localization of STAT3 is expressed as a percentage of STAT3 in the cytoplasm (red bar) and STAT3 in the nucleus (blue bar). (D) mRNA expression levels of Bcl-xL, STAT3, and cyclin D1 were analyzed by real-time PCR. Data were normalized to β-actin. One representative from at least three independent experiments is shown. Significant difference at **P < 0.01 and *P < 0.05.

Next, we assessed whether the differences triggered by hemin in STAT3 activation and localization could affect the expression of STAT3 transcriptional target genes by RT-qPCR. We found that hemin decreases Bcl-xL and cyclin D1 mRNA levels in the presence of IL-6 (Figure 3D). As control, STAT3 expression induction by IL-6 was determined (Figure 3D).

Altogether, these data strongly demonstrated that HO-1 diminishes AR and STAT3 transactivation in LNCaP cells.

STAT3 Mediates HO-1 Down-modulation of AR Signaling

The data support the view that STAT3 is involved in the anti-tumorigenic function of HO-1. Therefore, to test whether STAT3 by itself could mediate HO-1 repression of PSA transcription, LNCaP cells were co-transfected with the PSA-luc construct and STAT3C or STAT3-DN mutants. STAT3C generates STAT3 constitutively active protein as a result of substituting the cysteine residues for C661A and C663N, allowing STAT3 dimerization and activation [21,22]. The STAT3 DN mutant cannot be phosphorylated on tyrosine 705, competing with the wild-type protein for the activating kinase [23]. Figure 4A (upper left panel) shows that STAT3C highly increases testosterone-induced PSA promoter activity in LNCaP cells and the repressive effect of hemin in testosterone-stimulated cells was still observed (Figure 4, upper left panel). We also assessed the PSA mRNA levels by RT-qPCR in the same conditions. As shown in Figure 4A (right panel), we further confirmed the inhibitory effect of hemin on testosterone-induced PSA transcripts in LNCaP cells. Accordingly, STAT3DN mutant co-transfection abolished the induction provoked by the hormone; however, the repression exerted by hemin is still observed (Figure 4A, upper panels). STAT3 mRNA levels after transfection were determined by RT-qPCR (Figure 4A, lower left panel). In addition, HO-1 mRNA level induction by hemin was confirmed by RT-qPCR in cells transfected with both STAT3 mutants (Figure 4A, lower right panel).

Figure 4.

Figure 4

HO-1 abrogates STAT3 induction and attenuates AR signaling. LNCaP cells transient transfected with a constitutively active STAT3 mutant (pcDNA3 STAT3C) or a dominant negative mutant (pcDNA3 STAT3DN) or empty vectors (pcDNA3) were serum starved in phenol red-free media with testosterone (10 µM, 24 hours), hemin (80 µM, 24 hours), both, or vehicle. (A) Cells were co-transfected with the PSA luciferase reporter plasmid, and after treatment, cells were lysed and luciferase activity assay was performed (left upper panel). Data were normalized to protein values. One representative from at least three independent experiments is shown. mRNA expression levels of PSA and HO-1 were analyzed by real-time PCR (right upper and lower panels). Levels of STAT3 mRNA for pcDNA3 STAT3C and pcDNA3 STAT3DN transfection were analyzed by real-time PCR (left lower panel). Data were normalized to β-actin. One representative from at least three independent experiments is shown. (B) mRNA expression levels of uPA, survivin, and cyclin D1 in pcDNA3 STAT3C LNCaP cells or controls (pcDNA3) were analyzed by RT-qPCR. Data were normalized to β-actin. One representative from at least three independent experiments is shown. (C) LNCaP cells transduced with pSEW-GL2 and pSEW-shSTAT3 were treated with testosterone (10 µM, 24 hours), hemin (80 µM, 24 hours), both, or vehicle. mRNA expression levels of PSA and HO-1 were analyzed by real-time PCR (right and left upper panels). Levels of STAT3 mRNA and proteins for pSEW-G2 and pSEW-shSTAT3 transduction were analyzed by real-time PCR (left lower panel) and Western blot analysis (right lower panel). Data were normalized to β-actin. One representative from at least three independent experiments is shown. Significant differences at **P < 0.01 and *P < 0.05.

To further validate STAT3C constitutive activation, we examined the expression of STAT3 downstream target genes. STAT3C significantly increases the mRNA levels of uPA, survivin, and cyclin D1. As expected, hemin significantly diminished STAT3C induction of these target genes (Figure 4B).

We also examined the effects of STAT3 protein knockdown by RNA interference using a lentivirus small hairpin delivery system on PSA expression in LNCaP cells. Exposure of cells to pSEW-shSTAT3 significantly reduced STAT3 mRNA and protein levels (50% and 88%, respectively, P < 0.01), which was further reflected in PSA down-modulation compared to cells transduced with control plasmid (pSEW-Gl2; Figure 4C). HO-1 induction by hemin was not affected by STAT3 down-modulation (Figure 4C).

In summary, these data strongly suggest that HO-1 induction blocks the STAT3 signal pathway and plays negative roles in AR transactivation.

HO-1 Induces STAT3 Cytoplasmic Retention in Tumor Tissues and PCA Cells

As the role of STAT3 as aDNA-binding transcription factor naturally depends on its ability to gain entrance to the nucleus [24], we test whether HO-1 retains STAT3 in the cytoplasm and disrupts STAT3-AR interaction. By confocal microscopy, STAT3 and AR co-localization was evaluated in LNCaP cells treated with testosterone (to activate AR) and stimulated with IL-6 (to activate STAT3) and exposed or not to hemin. The images displayed in Figure 5A show a nuclear localization of AR induced by the hormone and of STAT3 stimulated by the cytokine. A high degree of co-localization between STAT3 (green) and AR (red) signals was quantitatively observed in the overlay images (yellow). However, a significant diminution in the nuclear co-localization of AR and STAT3 is detected when cells were exposed to hemin, which can be assigned to the cytoplasmic retention of STAT3 in HO-1-induced cells (Figure 5A). The quantitative co-localization analysis to estimate the degree of overlap of fluorescence signals also shows a significant diminution in Manders coefficient values in the presence of hemin relative to the untreated controls (0.88 ± 0.01 vs 0.91 ± 0.01, P < 0.05; n = 25 cells, Figure 5B). We plotted the PDM, applying an intensity correlation analysis plug-in (Figure 5C). In addition, frequency scatter plots were computed (Figure 5D), showing that while before hemin treatment both signals were close to a line at 45°; this high correlation is lost after HO-1 induction. Consistently, under the same experimental conditions, STAT3 and HO-1 displayed a greater co-localization degree in the presence of hemin with respect to controls (0.90 ± 0.01 vs 0.86 ± 0.01, P < 0.001; n = 21 cells, Figure 5, E–H). We further confirmed STAT3 cytoplasmic retention calculating the ratio of nuclear STAT3/total STAT3 by quantifying immunofluorescence experiments (Figure 6). Additionally, immunocytochemistry studies validated these findings, showing that the exclusive STAT3 nuclear localization induced by IL-6 was impaired under hemin treatment in cells exposed or not to testosterone (Figure 7A). IL-6-stimulated cells showed high nuclear and cytoplasmic staining for STAT3. This staining was almost abolished under hemin treatment. In accordance, the same pattern was observed in cells further exposed to testosterone. The differential STAT3 immunoreactivity was also quantitatively assessed (Figure 7B).

Figure 5.

Figure 5

HO-1 abrogates nuclear STAT3 and AR co-localization. (A) Hemin treatment disrupts the nuclear co-localization between STAT3 and AR. LNCaP cells were treated with hemin (80 µM, 24 hours) or vehicle and activated with testosterone (10 µM, 24 hours) and stimulated with IL-6 (10 ng/ml, 24 hours). Cells were fixed and stained with anti-STAT3 primary antibody and a secondary antibody conjugated to Alexa Fluor 488 (green fluorescence) and anti-AR primary antibody and a secondary antibody conjugated to Alexa Fluor 555 (red fluorescence). Cells were imaged by confocal microscopy. The degree of overlap between the green and red channels is observed in the overlay. (B) Manders coefficient (STAT3/AR) in individual cells was calculated. Significant difference at *P < 0.05. (C) Representative PDM graphs are shown. (D) Frequency scatter plots were performed with the ImageJ intensity correlation analysis plug-in (channel 1, Alexa Fluor 488; channel 2, Alexa Fluor 555). (E) Hemin treatment increases the cytoplasmic co-localization of STAT3 and HO-1. LNCaP cells were treated with hemin (80 µM, 24 hours) or vehicle and activated with testosterone (10 µM, 24 hours) and stimulated with IL-6 (10 ng/ml, 24 hours). Cells were fixed and stained with anti-HO-1 primary antibody (green fluorescence) and anti-STAT3 primary antibody (red fluorescence) and imaged by confocal microscopy. The degree of overlap between the green and red channels is observed in the overlay. (F) Manders coefficient (STAT3/HO-1) in individual cells was calculated. Significant difference at *P < 0.001. (G) Representative PDM graphs are shown. (H) Frequency scatter plots of one slice per treatment were performed with the ImageJ intensity correlation analysis plug-in (channel 1, Alexa Fluor 488; channel 2, Alexa Fluor 555).

Figure 6.

Figure 6

HO-1 retains STAT3 in the cytoplasm under testosterone treatment. (A) STAT3 expression and cellular distribution was visualized by immunofluorescence staining of LNCaP cells treated with IL-6 (10 ng/ml, 24 hours) plus hemin (80 µM, 24 hours) or IL-6 alone under testosterone (10 µM, 24 hours) exposure. A representative image for each group is shown. Cytoplasmic STAT3 retention is observed under hemin treatment. Scale bar, 10 µm. (B) Cell-by-cell quantification of the subcellular localization of STAT3 expressed as a percentage of STAT3 signal in the nuclear compartment (blue bar) or in the cytoplasm (red bar) is shown.

Figure 7.

Figure 7

Forced expression of HO-1 correlates with reduced STAT3 expression in PCa cells and xenografts. (A) Immunocytochemical analysis of STAT3 in IL-6 (10 ng/ml, 24 hours)-stimulated LNCaP cells treated with testosterone (10 µM, 24 hours), hemin (80 µM, 24 hours), both, or vehicle. The STAT3 nuclear localization induced by IL-6 was impaired under hemin treatment in cells exposed or not to testosterone. Original magnification, x40. (B) The differential STAT3 immunoreactivity was quantitatively assessed. The results were expressed as mean ± SEM. Significant difference at **P < 0.01. (C) Athymic nude (nu/nu) mice were injected subcutaneously in the right flank with PC3 cells overexpressing HO-1 (PC3HO-1) or control (PC3pcDNA3). Animals were sacrificed after 23 days and tumors were excised. Immunohistochemical staining of STAT3 in PC3HO-1 and PC3pcDNA3 tumors was performed. PC3pcDNA3 tumor (left panel) shows positive STAT3 immunostaining, predominantly nuclear, in a moderate number of tumor cells (25x), inset: strong nuclear immunostaining (40x). PC3HO-1 tumor (right panel) shows positive STAT3 immunostaining both in the nucleus and cytoplasm in a large number of tumor cells (25x); inset: area showing positive cells with an intense, diffuse, and mainly cytoplasmic staining pattern (40x). (D) Harvested tumors (PC3HO-1 and PC3pcDNA3) were snap-frozen in liquid nitrogen and subsequently processed for RNA isolation. Total RNA was extracted, and STAT3 mRNA levels were analyzed by real-time PCR. Data were normalized to β-actin. One representative from at least three independent experiments is shown. Significant difference at *P < 0.05.

To further explore the cross talk between HO-1 and STAT3 in vivo, we examined STAT3 expression in PC3 tumors overexpressing HO-1 grown (subcutaneously for 23 days) as xenografts in nude mice [11]. Both PC3HO-1 and PC3pcDNA3 tumors showed STAT3 nuclear and cytoplasmic immunostaining. However, HO-1-overexpressing tumors clearly displayed STAT3 cytoplasmic retention compared to controls (Figure 7C). PC3pcDNA3 tumor showed positive STAT3 immunostaining, predominantly nuclear, in a moderate number of tumor cells, while in the PC3HO-1 xenografts, a large number of tumor cells displayed positive STAT3 cytoplasmic immunoreactivity. Accordingly, STAT3 mRNA levels were significantly decreased (20%, P < 0.05) in PC3HO-1 tumors compared to control xenografts (Figure 7D). As previously reported, PC3HO-1 tumors grown for 23 days were smaller [11] and less vascularized [12]. Thus, the HO-1 impairment of the STAT3 signaling axis backs up the anti-tumoral effect of HO-1 in PCa previously reported [11,12].

Discussion

During PCa progression, tumors initially respond to androgen ablation therapy but often become castration resistant [25] and several mechanisms may underlie this progression [26]. One of those mechanisms involves the activation of alternative cellular signaling pathways that switch on the AR and consequently the AR-regulated transcription, even in the absence of hormone [27]. Among them, IL-6 was recognized to activate the AR signaling in LNCaP, an androgen-sensitive cell line that expresses AR [28]. IL-6 is frequently elevated in patients with prostate carcinoma [29] and is thought to influence tumor growth through autocrine or paracrine loops [14,30] through activation of the Janus kinase (JAK)-STAT pathway [31]. Androgens were demonstrated to enhance the IL-6/STAT3 response [20,32] and activated STAT3 is frequently found in prostate carcinomas [15].

In the present study, we determined whether HO-1 was able to provoke changes either in the levels of transcription regulators or affecting their interactions that in turn would modify the signal of routing within several networks. In this context, we explored whether HO-1 is altering the AR-mediated response by affecting STAT3 signaling. We focused on STAT3 pathway, as it is critically associated to PCa progression [33,34].

Herein, we demonstrate for the first time that HO-1 induction represses PSA transcription in PCa cells, indicating that HO-1 down-modulates AR signaling and further supporting the nuclear role of HO-1. By immunoprecipitation, we also determined that HO-1 interacts with STAT3. We then analyzed STAT3 cellular status in HO-1-induced PCa cells and in HO-1-overexpressing tumors generated in nude mice. Our results clearly demonstrated that HO-1 induction retained cytoplasmic localization of STAT3. In vitro studies showed that HO-1 overexpression also reduced STAT3 signaling in PCa.

We previously reported the nuclear expression of HO-1 in human primary prostate carcinomas [10]. In PCa cell lines, we further confirmed that HO-1 up-regulation induced its nuclear localization and inhibited cell proliferation, migration, and invasion. Moreover, it impaired tumor growth in vivo and downregulated the expression of target genes associated with inflammation and angiogenesis [11]. Among them, IL-6 expression was diminished in PCa cells with higher levels of HO-1. We recently confirmed that HO-1 forced expression in PC3 cells, a highly aggressive and invasive PCa cell line, repressed VEGF-A, VEGF-C, and hypoxia inducible factor-1 α (HIF-1α) at the transcriptional level and that HO-1 overexpression greatly inhibited the VEGF promoter activity [12]. Interestingly, in vivo studies showed that HO-1 overexpression significantly impaired the ability of early stage PC3HO-1 xenografts to form vascular structures, with a marked decrease in the number of small vessels and in the expression levels of endothelial cell-specific markers such as cluster of differentiation 34 (CD34) and VEGFR-2. These results correlated with repressed NFκB-mediated transcription from an NFκB responsive luciferase reporter construct, induced accumulation of inhibitor of kappa B (IκB), and decreased IκB kinase (IKK) mRNA levels, strongly suggesting that HO-1 may regulate angiogenesis through this pathway [12].

Given that inflammation is a critical component of tumor growth and progression [35], the control of the inflammatory mediators plays a pivotal role in triggering this process [36]. Highly reactive chemical compounds, such as reactive oxygen species, produced during inflammation, could cause oxidative damage to DNA in epithelial cells or react with other cellular components initiating a free radical chain reaction, thus sustaining the prostate carcinogenic process [7,36]. We demonstrated that up-regulation of HO-1 correlates with reduced levels of pro-inflammatory and pro-angiogenic factors [angiopoietin 1 (ANGPT1), angiopoietin-like 3 (ANGPTL3), chemokine (C-X-C motif) ligand 1 (CXCL1), CXCL3, CXCL10, and CXCL5, VEGF-D, IL-6, IL-8, MMP9, thrombospondin 1 (THBS1), and VEGF-A] in PCa cells. The identification of MMP9 as a downstream target of HO-1 in PCa cells is of particular interest and suggests that increased expression of HO-1 by PCa cells could define a less invasive and therefore less aggressive phenotype [11]. HO-1 expression was also reported in other tumor types such as lymphosarcoma, breast adenocarcinoma, hepatoma, glioblastoma, melanoma, Kaposi sarcoma, squamous carcinoma, pancreatic cancer, and brain tumors (for a review, see reference [8]).

These observations prompted us to explore the nature of the molecular mechanism underlying the functional anti-tumorigenic role of HO-1 in PCa. In this study, the involvement of STAT3 signaling in HO-1-induced PCa cells was addressed.

Various cytokines and growth factors regulate cellular processes by activating STAT3 phosphorylation [37], which causes dimerization and nuclear translocation that mediates transcriptional responses to many extracellular signals. IL-6 and other IL-6-related polypeptides bind to the transmembrane receptors GP130 and JAK and enhance STAT3 phosphorylation. STAT3 plays diverse roles in cellular processes and is required for normal embryogenesis in the mouse [38]. However, a JAK/STAT noncanonical pathway has been described, in which cytokine receptors may be dimerized in the absence of the ligand. Instead of inducing dimerization, the ligand stabilizes a preformed dimer and/or triggers a conformational change from an inactive to an active dimer. In this model, these nonphosphorylated nuclear STAT molecules also contribute to gene regulation [39]. STAT3 influences cell survival, metabolism, growth, differentiation, and migration in multiple organs [40] and has been reported to impact on epithelial repair in some organs [41]. Furthermore, the role of STAT3 in cell migration has been demonstrated in a number of experimental models [42], affecting cell motility through both transcriptional and nontranscriptional pathways [41,43,44].

In advanced PCa, active STAT3 is expressed and the increased expression of pSTAT3 in patients correlates with augmented disease severity and shorter survival times [15,32]. The induced expression of activated STAT3 is thought to be a consequence of the increased levels of circulating IL-6 detected in hormone refractory PCa patients [45].

Dynamic changes in response to extracellular stimuli can occur through several mechanisms [14]. Here, we show that HO-1 down-modulates AR signaling by abrogating STAT3 activity. The sensitization of the AR to testosterone is dependent on STAT3 because expression of the STAT3 DN inhibits AR response to the hormone and ectopic expression of STAT3C vector increases PSA transcription. HO-1 induction clearly represses this activation, interfering STAT3 signaling as detected by down-modulation of the expression of STAT3 target genes.

The HO-1/STAT3 axis has also drawn attention in other malignancies such as lung injury, ischemia/reperfusion injury (IRI), and malaria. It appears that both HO-1 and carbon monoxide, one of its catalytic products, require endothelial STAT3 to exert their protective effects, and STAT3 confers endothelial cell protection through both HO-1-dependent and independent mechanisms. Apparently, there is a positive feedback system between STAT3 and HO-1, in which STAT3 activates HO-1, leading to the production of carbon monoxide, which in turn activates STAT3. These observations delineate an interdependence between HO-1 and STAT3. The speculation relies in that the presence of this system presumably ensures optimal activation of two vital protective pathways mediated by HO-1 and STAT3 optimizing defense against lethal lung injury [46].

Additionally, this axis is implicated in the regulation of innate immune responses in liver IRI, altering the phosphatidyl inositol 3-kinase (PI3K)/phosphatase and tensin homolog (PTEN) signaling, down-regulating PI3K/Akt, and hence providing the negative feedback mechanism for hepatic toll-like receptor 4 (TLR4)-driven inflammation. These results set new grounds for innovative therapeutic avenues to manage hepatic inflammation and IRI in liver transplant recipients [47].

Severe malaria also shows an interesting cross talk between HO-1, CXCL10/CXCR3, and STAT3, linking these molecules in the pathogenesis of this disease [48].

During the past years, the cancer field has witnessed how the regulation of the tumoral immune response has step forward in cancer immunotherapy. The comprehension of the cellular and molecular mechanisms underlying immune cell activation and homeostasis will unravel the intricacy of tumoral immune escape [49]. In this context, HO-1 could also be involved in the tumoral escape, exerting a protective action in the diseases mediated by effector T lymphocytes such as T helper (Th) 1, Th2, and Th17 [50]. Furthermore, the constitutive activation of STAT3 both in tumor cells and in the diverse immune cells in the tumoral stroma also has been shown to inhibit the expression of numerous factors and molecules necessary for immune-mediated tumor rejection. These include chemokine (C-C motif) ligand 5 (CCL5), IL-12, tumor necrosis factor (TNF), interferon (IFN)-γ, IFN-β, CXCL10, CD40, CD80, CD86, and major histocompatibility complex (MHC) class II molecules [51]. These reports further point out the relevance of HO-1/STAT3 as an interesting axis for cancer immunotherapy.

Complexes between STAT3 and AR protein in PCa were previously reported and their functionalities are affected by paracrine/autocrine loops, which in turn activate different signaling cascades [14]. Here, we demonstrate that HO-1 does not directly associate to AR, but it interacts with STAT3. Our results show that hemin treatment diminishes AR and STAT3 co-localization in the nuclear compartment and enhances STAT3 and HO-1 co-localization in the cytoplasm. Thus, we propose that HO-1 is influencing the association of AR and STAT3, probably affecting the operativeness of the active complex formed by these two proteins. The interaction between STAT3 and HO-1 abrogates STAT3 activation, and in this way, HO-1 induction represses AR activity, affecting PCa cells tumorigenicity.

Biological systems frequently exhibit redundancy that can explain altered response to different factors. Thus, we cannot discard that other signaling pathways are affected by HO-1, such as NFγB pathway. We recently reported that the anti-angiogenic activity of HO-1 in PCa cells is mediated by impairment of NFγB pathway [12]. Several genes involved in tumorigenesis are regulated by STAT3 and NFγB, either synergistically or individually. It was recently proposed that STAT3 was required for proper induction of IL-6 by NFγB, demonstrating that both factors existed as identical nuclear complexes in proximal IL-6 promoters and that STAT3 participates in the nuclear retention of NFγB [52]. These findings prompted authors to suggest that these two oncogenic transcriptional factors are activated simultaneously by an intrinsic mechanism during stressful conditions of cancer cells, cooperatively inducing various survival factors [52]. Thus, we can hypothesize that HO-1 induction down-modulates the activation and signaling pathways of both factors, and in turn, both may contribute to the control of PCa cell proliferation, invasion, and migration and PCa tumor growth.

Further studies are needed to understand the complexity of the disruption of the cooperative signaling cross talk and if these evidences could support an unprecedented role of HO-1 outlining a rationale for its development as an anticancer target in PCa.

Acknowledgments

We thank Bernd Groner, Monica Costas, and Alejandra Guberman for kindly providing us with some reagents used in this paper. We are also very grateful to Pablo Vallecorsa (Instituto de Estudios Oncológicos, Academia Nacional de Medicina) for his technical support in the IHQ analysis.

Footnotes

1

This work was supported by grants from the University of Buenos Aires, Argentina, UBACyT (20020100100179) and ANPCYT (PICT RAICES 2010-0431). The authors disclose no potential conflicts of interest.

References

  • 1.Zhu ML, Kyprianou N. Androgen receptor and growth factor signaling cross-talk in prostate cancer cells. Endocr Relat Cancer. 2008;15:841–849. doi: 10.1677/ERC-08-0084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Roy AK, Tyagi RK, Song CS, Lavrovsky Y, Ahn SC, Oh TS, Chatterjee B. Androgen receptor: structural domains and functional dynamics after ligand-receptor interaction. Ann N Y Acad Sci. 2001;949:44–57. doi: 10.1111/j.1749-6632.2001.tb04001.x. [DOI] [PubMed] [Google Scholar]
  • 3.Lonard DM, O'Malley BW. Nuclear receptor coregulators: judges, juries, and executioners of cellular regulation. Mol Cell. 2007;27:691–700. doi: 10.1016/j.molcel.2007.08.012. [DOI] [PubMed] [Google Scholar]
  • 4.O'Malley BW, Kumar R. Nuclear receptor coregulators in cancer biology. Cancer Res. 2009;69:8217–8222. doi: 10.1158/0008-5472.CAN-09-2223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Chun JY, Nadiminty N, Dutt S, Lou W, Yang JC, Kung HJ, Evans CP, Gao AC. Interleukin-6 regulates androgen synthesis in prostate cancer cells. Clin Cancer Res. 2009;15:4815–4822. doi: 10.1158/1078-0432.CCR-09-0640. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Aydin A, Arsova-Sarafinovska Z, Sayal A, Eken A, Erdem O, Erten K, Ozgok Y, Dimovski A. Oxidative stress and antioxidant status in non-metastatic prostate cancer and benign prostatic hyperplasia. Clin Biochem. 2006;39:176–179. doi: 10.1016/j.clinbiochem.2005.11.018. [DOI] [PubMed] [Google Scholar]
  • 7.De Marzo AM, Platz EA, Sutcliffe S, Xu J, Gronberg H, Drake CG, Nakai Y, Isaacs WB, Nelson WG. Inflammation in prostate carcinogenesis. Nat Rev Cancer. 2007;7:256–269. doi: 10.1038/nrc2090. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Jozkowicz A, Was H, Dulak J. Heme oxygenase-1 in tumors: is it a false friend? Antioxid Redox Signal. 2007;9:2099–2117. doi: 10.1089/ars.2007.1659. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Wegiel B, Chin BY, Otterbein LE. Inhale to survive, cycle or die? Carbon monoxide and cellular proliferation. Cell Cycle. 2008;7:1379–1384. doi: 10.4161/cc.7.10.5948. [DOI] [PubMed] [Google Scholar]
  • 10.Sacca P, Meiss R, Casas G, Mazza O, Calvo JC, Navone N, Vazquez E. Nuclear translocation of haeme oxygenase-1 is associated to prostate cancer. Br J Cancer. 2007;97:1683–1689. doi: 10.1038/sj.bjc.6604081. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Gueron G, De Siervi A, Ferrando M, Salierno M, De Luca P, Elguero B, Meiss R, Navone N, Vazquez ES. Critical role of endogenous heme oxygenase 1 as a tuner of the invasive potential of prostate cancer cells. Mol Cancer Res. 2009;7:1745–1755. doi: 10.1158/1541-7786.MCR-08-0325. [DOI] [PubMed] [Google Scholar]
  • 12.Ferrando M, Gueron G, Elguero B, Giudice J, Salles A, Leskow FC, Jares-Erijman EA, Colombo L, Meiss R, Navone N, et al. Heme oxygenase 1 (HO-1) challenges the angiogenic switch in prostate cancer. Angiogenesis. 2011;14:467–479. doi: 10.1007/s10456-011-9230-4. [DOI] [PubMed] [Google Scholar]
  • 13.Ni Z, Lou W, Leman ES, Gao AC. Inhibition of constitutively activated Stat3 signaling pathway suppresses growth of prostate cancer cells. Cancer Res. 2000;60:1225–1228. [PubMed] [Google Scholar]
  • 14.Aaronson DS, Muller M, Neves SR, Chung WC, Jayaram G, Iyengar R, Ram PT. An androgen-IL-6-Stat3 autocrine loop re-routes EGF signal in prostate cancer cells. Mol Cell Endocrinol. 2007;270:50–56. doi: 10.1016/j.mce.2007.02.006. [DOI] [PubMed] [Google Scholar]
  • 15.Mora LB, Buettner R, Seigne J, Diaz J, Ahmad N, Garcia R, Bowman T, Falcone R, Fairclough R, Cantor A, et al. Constitutive activation of Stat3 in human prostate tumors and cell lines: direct inhibition of Stat3 signaling induces apoptosis of prostate cancer cells. Cancer Res. 2002;62:6659–6666. [PubMed] [Google Scholar]
  • 16.Yamamoto T, Sato N, Sekine Y, Yumioka T, Imoto S, Junicho A, Fuse H, Matsuda T. Molecular interactions between STAT3 and protein inhibitor of activated STAT3, and androgen receptor. Biochem Biophys Res Commun. 2003;306:610–615. doi: 10.1016/s0006-291x(03)01026-x. [DOI] [PubMed] [Google Scholar]
  • 17.Culig Z. Androgen receptor cross-talk with cell signalling pathways. Growth Factors. 2004;22:179–184. doi: 10.1080/08977190412331279908. [DOI] [PubMed] [Google Scholar]
  • 18.De Luca P, Vazquez ES, Moiola CP, Zalazar F, Cotignola J, Gueron G, Gardner K, De Siervi A. BRCA1 loss induces GADD153-mediated doxorubicin resistance in prostate cancer. Mol Cancer Res. 2011;9:1078–1090. doi: 10.1158/1541-7786.MCR-11-0155. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Lin Q, Weis S, Yang G, Weng YH, Helston R, Rish K, Smith A, Bordner J, Polte T, Gaunitz F, et al. Heme oxygenase-1 protein localizes to the nucleus and activates transcription factors important in oxidative stress. J Biol Chem. 2007;282:20621–20633. doi: 10.1074/jbc.M607954200. [DOI] [PubMed] [Google Scholar]
  • 20.Ueda T, Bruchovsky N, Sadar MD. Activation of the androgen receptor N-terminal domain by interleukin-6 via MAPK and STAT3 signal transduction pathways. J Biol Chem. 2002;277:7076–7085. doi: 10.1074/jbc.M108255200. [DOI] [PubMed] [Google Scholar]
  • 21.Bromberg JF, Wrzeszczynska MH, Devgan G, Zhao Y, Pestell RG, Albanese C, Darnell JE., Jr Stat3 as an oncogene. Cell. 1999;98:295–303. doi: 10.1016/s0092-8674(00)81959-5. [DOI] [PubMed] [Google Scholar]
  • 22.Liddle FJ, Alvarez JV, Poli V, Frank DA. Tyrosine phosphorylation is required for functional activation of disulfide-containing constitutively active STAT mutants. Biochemistry. 2006;45:5599–5605. doi: 10.1021/bi0525674. [DOI] [PubMed] [Google Scholar]
  • 23.Bromberg JF, Horvath CM, Besser D, Lathem WW, Darnell JE., Jr Stat3 activation is required for cellular transformation by v-src. Mol Cell Biol. 1998;18:2553–2558. doi: 10.1128/mcb.18.5.2553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Liu L, McBride KM, Reich NC. STAT3 nuclear import is independent of tyrosine phosphorylation and mediated by importin-α3. Proc Natl Acad Sci USA. 2005;102:8150–8155. doi: 10.1073/pnas.0501643102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Dayyani F, Gallick GE, Logothetis CJ, Corn PG. Novel therapies for metastatic castrate-resistant prostate cancer. J Natl Cancer Inst. 2011;103:1665–1675. doi: 10.1093/jnci/djr362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Devlin HL, Mudryj M. Progression of prostate cancer: multiple pathways to androgen independence. Cancer Lett. 2009;274:177–186. doi: 10.1016/j.canlet.2008.06.007. [DOI] [PubMed] [Google Scholar]
  • 27.Culig Z, Santer FR. Androgen receptor co-activators in the regulation of cellular events in prostate cancer. World J Urol. 2011;30:297–302. doi: 10.1007/s00345-011-0797-6. [DOI] [PubMed] [Google Scholar]
  • 28.Culig Z, Bartsch G, Hobisch A. Interleukin-6 regulates androgen receptor activity and prostate cancer cell growth. Mol Cell Endocrinol. 2002;197:231–238. doi: 10.1016/s0303-7207(02)00263-0. [DOI] [PubMed] [Google Scholar]
  • 29.Nakashima J, Tachibana M, Horiguchi Y, Oya M, Ohigashi T, Asakura H, Murai M. Serum interleukin 6 as a prognostic factor in patients with prostate cancer. Clin Cancer Res. 2000;6:2702–2706. [PubMed] [Google Scholar]
  • 30.Culig Z, Steiner H, Bartsch G, Hobisch A. Interleukin-6 regulation of prostate cancer cell growth. J Cell Biochem. 2005;95:497–505. doi: 10.1002/jcb.20477. [DOI] [PubMed] [Google Scholar]
  • 31.Aaronson DS, Horvath CM. A road map for those who don't know JAK-STAT. Science. 2002;296:1653–1655. doi: 10.1126/science.1071545. [DOI] [PubMed] [Google Scholar]
  • 32.Tam L, McGlynn LM, Traynor P, Mukherjee R, Bartlett JM, Edwards J. Expression levels of the JAK/STAT pathway in the transition from hormone-sensitive to hormone-refractory prostate cancer. Br J Cancer. 2007;97:378–383. doi: 10.1038/sj.bjc.6603871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Abdulghani J, Gu L, Dagvadorj A, Lutz J, Leiby B, Bonuccelli G, Lisanti MP, Zellweger T, Alanen K, Mirtti T, et al. Stat3 promotes metastatic progression of prostate cancer. Am J Pathol. 2008;172:1717–1728. doi: 10.2353/ajpath.2008.071054. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Blando JM, Carbajal S, Abel E, Beltran L, Conti C, Fischer S, DiGiovanni J. Cooperation between Stat3 and Akt signaling leads to prostate tumor development in transgenic mice. Neoplasia. 2011;13:254–265. doi: 10.1593/neo.101388. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Bonecchi R, Locati M, Mantovani A. Chemokines and cancer: a fatal attraction. Cancer Cell. 2011;19:434–435. doi: 10.1016/j.ccr.2011.03.017. [DOI] [PubMed] [Google Scholar]
  • 36.Gueron G, De Siervi A, Vazquez E. Key questions in metastasis: new insights in molecular pathways and therapeutic implications. Curr Pharm Biotechnol. 2011;12:1867–1880. doi: 10.2174/138920111798376996. [DOI] [PubMed] [Google Scholar]
  • 37.Chang M, Kanwar N, Feng E, Siu A, Liu X, Ma D, Jongstra J. PIM kinase inhibitors downregulate STAT3(Tyr705) phosphorylation. Mol Cancer Ther. 2010;9:2478–2487. doi: 10.1158/1535-7163.MCT-10-0321. [DOI] [PubMed] [Google Scholar]
  • 38.Mohr A, Chatain N, Domoszlai T, Rinis N, Sommerauer M, Vogt M, Muller-Newen G. Dynamics and non-canonical aspects of JAK/STAT signalling. Eur J Cell Biol. 2011;91:524–532. doi: 10.1016/j.ejcb.2011.09.005. [DOI] [PubMed] [Google Scholar]
  • 39.Li WX. Canonical and non-canonical JAK-STAT signaling. Trends Cell Biol. 2008;18:545–551. doi: 10.1016/j.tcb.2008.08.008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Levy DE, Lee CK. What does Stat3 do? J Clin Invest. 2002;109:1143–1148. doi: 10.1172/JCI15650. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Ridley AJ, Schwartz MA, Burridge K, Firtel RA, Ginsberg MH, Borisy G, Parsons JT, Horwitz AR. Cell migration: integrating signals from front to back. Science. 2003;302:1704–1709. doi: 10.1126/science.1092053. [DOI] [PubMed] [Google Scholar]
  • 42.Yamashita S, Miyagi C, Fukada T, Kagara N, Che YS, Hirano T. Zinc transporter LIVI controls epithelial-mesenchymal transition in zebrafish gastrula organizer. Nature. 2004;429:298–302. doi: 10.1038/nature02545. [DOI] [PubMed] [Google Scholar]
  • 43.Silver DL, Naora H, Liu J, Cheng W, Montell DJ. Activated signal transducer and activator of transcription (STAT) 3: localization in focal adhesions and function in ovarian cancer cell motility. Cancer Res. 2004;64:3550–3558. doi: 10.1158/0008-5472.CAN-03-3959. [DOI] [PubMed] [Google Scholar]
  • 44.Fan ZP, Lin SH, Cai SP, Ji YJ, Gao F, Zhang HY, Luo SQ, Zhang WJ. An analysis of the clinical characteristics of patients with chronic hepatitis B superinfected with acute hepatitis E. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi. 2007;21:325–327. [PubMed] [Google Scholar]
  • 45.Drachenberg DE, Elgamal AA, Rowbotham R, Peterson M, Murphy GP. Circulating levels of interleukin-6 in patients with hormone refractory prostate cancer. Prostate. 1999;41:127–133. doi: 10.1002/(sici)1097-0045(19991001)41:2<127::aid-pros7>3.0.co;2-h. [DOI] [PubMed] [Google Scholar]
  • 46.Zhang X, Shan P, Jiang G, Zhang SS, Otterbein LE, Fu XY, Lee PJ. Endothelial STAT3 is essential for the protective effects of HO-1 in oxidant-induced lung injury. FASEB J. 2006).;20:2156–2158. doi: 10.1096/fj.06-5668fje. [DOI] [PubMed] [Google Scholar]
  • 47.Ke B, Shen XD, Ji H, Kamo N, Gao F, Freitas MC, Busuttil RW, Kupiec-Weglinski JW. HO-1-STAT3 axis in mouse liver ischemia/reperfusion injury: regulation of TLR4 innate responses through PI3K/PTEN signaling. J Hepatol. 2012;56:359–366. doi: 10.1016/j.jhep.2011.05.023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Liu M, Amodu AS, Pitts S, Patrickson J, Hibbert JM, Battle M, Ofori-Acquah SF, Stiles JK. Heme mediated STAT3 activation in severe malaria. PLoS One. 2012;7:e34280. doi: 10.1371/journal.pone.0034280. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Zwirner NW, Croci DO, Domaica CI, Rabinovich GA. Overcoming the hurdles of tumor immunity by targeting regulatory pathways in innate and adaptive immune cells. Curr Pharm Des. 2010;16:255–267. doi: 10.2174/138161210790170175. [DOI] [PubMed] [Google Scholar]
  • 50.Xia ZW, Zhong WW, Meyrowitz JS, Zhang ZL. The role of heme oxygenase-1 in T cell-mediated immunity: the all encompassing enzyme. Curr Pharm Des. 2008;14:454–464. doi: 10.2174/138161208783597326. [DOI] [PubMed] [Google Scholar]
  • 51.Yu H, Kortylewski M, Pardoll D. Crosstalk between cancer and immune cells: role of STAT3 in the tumour microenvironment. Nat Rev Immunol. 2007;7:41–51. doi: 10.1038/nri1995. [DOI] [PubMed] [Google Scholar]
  • 52.Yoon S, Woo SU, Kang JH, Kim K, Shin HJ, Gwak HS, Park S, Chwae YJ. NF-κB and STAT3 cooperatively induce IL6 in starved cancer cells. Oncogene. 2011;31:3467–3481. doi: 10.1038/onc.2011.517. [DOI] [PubMed] [Google Scholar]

Articles from Neoplasia (New York, N.Y.) are provided here courtesy of Neoplasia Press

RESOURCES