Frequency of ace, epa and elrA Genes in Clinical and Environmental Strains of Enterococcus faecalis

Abstract

Surface proteins play an important role in the pathogenesis of enterococcal infections. Some of them are candidates for a vaccine, e.g., the frequency of endocarditis in rats vaccinated with Ace protein was 75 % as 12 opposed to 100 % in those who weren’t. However, there are other components of enterococcal cells, such as Epa antigens or internalin-like proteins, which may be used in the prophylaxis of infections caused by them. However, also other virulence factors and resistance to antibiotics are important during enterococcal infection. Therefore, the relevance of ace, epa, elrA, other virulence genes, as well as resistance to antibiotics was investigated. 161 Enterococcus faecalis strains isolated from teaching hospitals in Lodz, cultured according to standard microbiological methods, were investigated for the presence of genes encoding surface proteins by PCR. Results were analyzed with χ² test. The elrA gene was found in all clinical and environmental strains, the ace gene was also widespread among E. faecalis (96.9 %). Both tested epa genes were found in the majority of isolates (83.25 %). There was correlation between the presence of esp and ace genes (p = 0.046) as well as between epa and agg genes (p = 0.0094; χ² test). The presence of the genes encoding surface proteins investigated in our study in the great majority of isolates implies that they would appear to be required during E. faecalis infection. Therefore, they could be excellent targets in therapy of enterococcal infections or, as some studies show, candidates for vaccines.

Introduction

Enterococci belong to the natural flora of human and animal intestines. Two species in particular, E. faecalis and E. faecium, have emerged as opportunistic pathogens causing a wide range of hospital-acquired infections [1]. Their resistance to several groups of antibiotics is responsible for treatment failure in many cases. Additionally, many important virulence factors have been identified in the enterococcal genome so far. They may play a role in the pathogenesis at different stages: in taking part in the initial attachment, in destroying tissues, in acquiring resistance to commonly used drugs as well as in avoiding immune system response. However, many of these processes are not fully understood.

One of the virulence factors of enterococci is Ace protein (Adhesin to collagen of E. faecalis), found commonly among E. faecalis strains [2]. It was shown that Ace mediates in the attachment of E. faecalis cells to human collagen type IV, bovine and rat collagen type I, laminin of mice and human dentin [3]. Expression of Ace was induced in vivo by the presence of serum or by compounds of extracellular matrix proteins (ECM) [4]. It was shown that diverse strains of E. faecalis synthesize Ace while infecting humans and Ace presented properties of an antigen in vivo. It is suggested that the Ace protein may be the target for drugs, because E. faecalis strains causing UTI often had the ace gene [5]. However, Ace protein was not necessary to cause this disease [6].

The other important virulence factors of E. faecalis strains are polysaccharide antigens [7]. They are encoded by the “orfde1” to “orfde16” genes found in the cluster of enterococcal polysaccharide antigen (epa) genes. It was suggested that orfde4 (epaB) and orfde6 (epaE), but not orfde1 or orfde2, are necessary for polysaccharide synthesis [8]. orfde4 (epaB), orfde6 (epaE) mutants showed disturbed biofilm synthesis [9] and were vulnerable to attack by polynuclear neutrophiles [10]. What is more, those mutants were also attenuated in a mice peritonitis model [8], and E. faecalis TX5179 mutants were also attenuated in a urinary tract infection model in mice [11].

Bacteria have evolved a plethora of molecular mechanisms to adhere to and invade host cells and tissues. Some important virulence factors, such as the proteins of Listeria monocytogenes, share a common leucine-rich repeat (LRR) domain which interact with host cell receptors and induce endocytosis and dissemination in tissues [12]. Some novel internalin-like proteins named Elr were found in E. faecalis strains. Inactivation of the elrA gene significantly reduced virulence in a mouse peritonitis model and dissemination within tissues as well as elicited the inflammatory interleukin-6 response [13].

The aim of our work was to evaluate the occurrence of ace, elrA and epa genes among clinical and environmental E. faecalis strains. Additionally, we checked the possible relationship between the occurrence of those genes and the presence of agg, cylL/S, esp, gelE, sprE genes, as well as the susceptibility of enterococcal strains to antibiotics.

Materials and Methods

Enterococcus faecalis strains (n = 161) were isolated from operative wards in two hospitals of Lodz, Poland. Isolates were obtained from urology ward (n = 66), surgical ward (n = 40), internal medicine ward (n = 31), laryngology (n = 11), intensive care unit (n = 8) and outpatient clinic (n = 5). Strains were isolated from patient samples (wound swabs n = 37, urine n = 54, bile n = 1, blood n = 1, peritoneum exudates n = 1, throat swabs n = 9, groin swabs n = 2, swabs from catheters n = 14 and central venous catheters n = 2), swabs from healthcare staff (hands, white coats, nose, throat n = 14 strains), swabs from medical equipment and unanimated surfaces (n = 25 strains).

Enterococci were cultured according to standard microbiological methods. Bacteria were identified by API 20 Strep tests (bioMerieux), then identification was confirmed by PCR method for d-alanine-d-alanyl ligase (ddl) [14]. The presence of the ace gene was tested according Mannu et al. [15]. Reaction for epa genes was carried out in 25 μl according to Teng et al. [10] with primers for orfde5, and for ordfe 6. The reaction mixture consisted of 0.5 U Hypernova polymerase (DNA Gdańsk), 600 nM of primers (IBB, Warsaw) [10], 2 mM MgCl₂ (DNA Gdańsk), 2.5 μl PCR buffer and 400 μM dNTP (Fermentas). The presence of the elrA gene was checked with primers (for E. faecalis V583 EF_2686): 5′ ACAGGTTGGACGACTGTTCC 3′ and 5′ CTATTTCCACCGCTGACGAT 3′ (product size, 161 bp). The PCR profile used was as follows: denaturation 94 °C, 5 min; 38 cycles of denaturation 94 °C, 40 s; annealing 58 °C, 40 s; 72 °C, 40 s, and final elongation 72 °C, 5 min. The PCR profiles for agg, cyl, esp, gelE, sprE were described previously [14, 16]. PCR products were separated on 1 % agarose (Prona) in 1× TAE (Fermentas), and stained with ethidine bromide (Sigma). A statistical analysis of the relationship between ace and epa, agg, cylL/S, esp, gelE, sprE [16] and resistance to ampicillin, ciprofloxacin, gentamicin, erythromycin, linezolid and vancomycin was prepared by a χ² test.

Enterococcus faecalis ATCC 29212 and Enterococcus faecium ATCC 35667 strains were used as controls. Standard and clinical strains were stored in −70 °C for further investigations. Susceptibility testing was carried out by disc-diffusion method on Mueller–Hinton II Agar (bioMerieux) for ampicillin (10 μg), ciprofloxacin (5 μg), erythromycin (15 μg), and gentamicin (120 μg) [1] (Becton–Dickinson). Results were interpreted according to Clinical and Laboratory Standard Institute guideline (CLSI) [17] and National Institute of Health, Poland [18].

Results

Only five E. faecalis strains did not have the ace gene (3.1 %) and these were isolated from environmental samples (n = 2), wounds (n = 2) or urine (n = 1). There were no isolates resistant to ampicillin among strains without the ace gene. There was correlation between the presence of esp and ace genes (p = 0.046; χ² test).

Both epa genes were found in 136 enterococcal strains (84.5 %). Strains without the genes (epa 5, epa 6, or both) were obtained from urine (n = 7), wounds (n = 2), swabs from medical staff (n = 1), environmental swabs (n = 2), catheters (n = 3). Table 1 shows detailed results concerning ace and epa gene occurrence. All enterococcal isolates possessed the elrA gene.

Table 1.

Occurrence of ace and epa genes

Sample	Number of isolates	Gene
		ace+ (n)	epa+ (n)
Urine	54	53	47
Wound	37	35	35
Blood	1	1	1
Bile	1	1	1
Peritoneum exudate	1	1	1
Central venous catheters	2	2	2
Epidemiological swabs	28	28	25
Swabs from medical staff	14	14	13
Environmental swabs	25	23	23
Together	161	156	134

All the investigated strains were susceptible to vancomycin and linezolid. Among enterococcal isolates without at least one epa gene all were also susceptible to ampicillin, but eight were resistant to ciprofloxacin, five moderately resistant to ciprofloxacin, seven resistant to erythromycin, three moderately resistant to erythromycin, two resistant to gentamycin. Table 2 presents data about the relationship of ace and epa gene frequency and resistance to antibiotics. There were seven strains isolated from urine that not possessed one epa gene but all isolates from urine had ace gene. Three strains from catheters were without one epa gene but had ace gene. Table 3 shows data about the presence of particular virulence genes. A correlation was found between the presence of epa and agg genes (p = 0.0094; χ² test).

Table 2.

Occurrence of ace, epa genes and resistance to ampicillin, ciprofloxacin, gentamicin and erythromycin

	Ampicillin		Ciprofloxacin			Gentamicin			Erythromycin
	S (n)	R (n)	S (n)	I (n)	R (n)	S (n)	I (n)	R (n)	S (n)	I (n)	R (n)
Ace(+)	146	10	29	61	66	80	6	70	45	30	81
Ace(−)	4	1	1	0	4	3	0	2	2	2	1
epa(+)	135	11	33	51	62	73	6	67	45	28	73
epa(−)	15	0	3	4	8	10	0	5	5	2	8

S sensitive strain, I intermediate sensitive strain, R resistant strain

Table 3.

Occurrence of ace, epa genes and other genes

	Strains with agg gene (n)	Strains with cylL gene (n)	Strains with cylS gene (n)	Strains with esp gene (n)	Strains with gelE gene (n)	Strains with sprE gene (n)
Strains with ace gene (n)	100	82	83	112	134	130
Strains with epa gene (n)	98	78	78	103	122	121

Discussion

Enterococci may posses diverse genes, which make them more virulent [16, 19]. It was shown that clinical strains of E. faecalis are more likely to present virulence genes than E. faecium strains. Of these, ace is the gene which participates in the pathogenesis of enterococcal infections at the stage of adhesion to human cells [19]. It was shown that strains of E. faecalis with ace gene were often isolated from urinary tract infections (UTI) [20]. In the present study we found the ace gene in the majority of tested strains of E. faecalis (n = 156; 96.9 %), both in clinical and environmental strains. Over 90 % of isolates obtained from urine had the ace gene, which supports its role in the pathogenesis of UTI.

Ace protein has often been found in the teeth roots of endodontic patients, but the frequency of isolation was diverse, probably because of the clinical and geographical background [21, 22]. In the present study, although there were no isolates from persistent endodontic infections, all strains isolated from the oral cavity (n = 16) had the ace gene, and all but one of them possessed the epa gene (6.25 %). Therefore the presence of enterococcal strains in the oral cavity which have genes crucial for adhesion could be associated with those infections. Our work strongly supports those results.

In our study, we checked the frequency of two genes from the epa cluster (epa5, epa6) among 161 strains of E. faecalis. Our results confirm the common presence of epa genes among enterococci, but in a lower number of strains when compared with the literature. Malathum et al. [23] showed that the orfde4 to orfde10 epa genes were in all the 12 genotypically and geographically diverse strains of E. faecalis investigated in their study. In our work, epa genes (at least one) were found in 136 enterococcal strains (84.5 %). The presence of these genes appears to facilitate infection by sheltering infectious agents from killing by polymorphonuclear neutrophils, probably as a result of resistance to phagocytosis, or increased ability to survive within phagosomes [10]. Our results show that most strains had at least one of the investigated genes, only two of them having none (1.24 %; environmental swab and swab from wound). Both of the isolates had no other virulence genes and were sensitive to all but one of the tested antibiotics. Those results seem to support the theory that epa genes are required during infection. Isolates without epa genes could be noninvasive environmental strains. However that area of our study is limited and further investigation of expression of those genes is needed to confirm its role in human infections.

According to previous studies, the elrA gene is widespread among E. faecalis strains and its product is required during infection in a mouse peritonitis model. Therefore ElrA may play an important role in the pathogenesis of enterococcal infection. In our studies, the elrA gene was found in all strains investigated, which is in accord with previous studies [13] and means that that gene is necessary during enterococcal pathogenesis. However, further investigation is required to establish whether and how that protein is expressed by diverse clinical and environmental strains.

We also investigated some relationship between the occurrence of virulence genes among enterococcal strains and their resistance to antibiotics. E. faecalis isolates are usually sensitive to ampicillin [1]. In our study, there was no significant relationship between the occurrence of epa genes and resistance to ampicillin. Enterococci are also very often resistant to fluoroquinolones [1, 24]. Among investigated enterococcal strains resistant to ciprofloxacin (n = 74), there were only four without the ace gene (5.40 %). However, there was no correlation found between the presence of ace or epa genes and resistance to ciprofloxacin nor gentamicin which can be used in therapy of enterococcal infections. The only correlation (p = 0.0124) was shown for erythromycin and the presence of epa genes, which might suggest simultaneous transfer of those genes.

The possibility of horizontal transfer of genes very often is characteristic of hospital pathogens. Pathogenicity Islands (PAIs) discovered in E. faecalis isolates enable these bacteria to spread virulence genes as well as resistance genes among each other [25]. It would be interesting to see whether there is any correlation between occurrence of epa and ace genes and other virulence genes (for aggregation substance, cytolisin, Esp protein, gelatinase and serine protease). Therefore, it is suggested that these virulence factors may occur altogether and be transferred between Enterococcus spp. strains [26]. In our study, agg genes were found in 101 of 161 E. faecalis strains (62.7 %) [16] and there was significant difference between the occurrence of agg and epa genes (p = 0.0094) and ace and esp genes (p = 0.046), which may suggest their common transfer.

To summarize, the presence of the genes encoding surface proteins investigated in our study in the great majority of isolates implies that they would appear to be required during E. faecalis infection. As our and previous studies show, investigated genes are widespread. Therefore, they could be excellent targets in therapy of enterococcal infections or, candidates for vaccines. The development of such a vaccine would be especially important in case of infections caused by multidrug resistant strains of E. faecalis.