Skip to main content
PMC home page
PLOS ONE logoLink to PLOS ONE
. 2012 Dec 7;7(12):e51528. doi: 10.1371/journal.pone.0051528

The Mitochondrial Genome of the Venomous Cone Snail Conus consors

Age Brauer 1,2,*, Alexander Kurz 3, Tim Stockwell 4, Holly Baden-Tillson 4, Juliana Heidler 5, Ilka Wittig 6, Silke Kauferstein 3, Dietrich Mebs 3,7, Reto Stöcklin 8, Maido Remm 1,2
Editor: Mande Holford9
PMCID: PMC3517553  PMID: 23236512

Abstract

Cone snails are venomous predatory marine neogastropods that belong to the species-rich superfamily of the Conoidea. So far, the mitochondrial genomes of two cone snail species (Conus textile and Conus borgesi) have been described, and these feed on snails and worms, respectively. Here, we report the mitochondrial genome sequence of the fish-hunting cone snail Conus consors and describe a novel putative control region (CR) which seems to be absent in the mitochondrial DNA (mtDNA) of other cone snail species. This possible CR spans about 700 base pairs (bp) and is located between the genes encoding the transfer RNA for phenylalanine (tRNA-Phe, trnF) and cytochrome c oxidase subunit III (cox3). The novel putative CR contains several sequence motifs that suggest a role in mitochondrial replication and transcription.

Introduction

Most metazoan mitochondrial genomes contain 37 genes for 13 protein subunits of the oxidative phosphorylation enzymes, two ribosomal RNAs (rRNAs) and 22 transfer RNAs (tRNAs) [1]. In vertebrates and insects, mitochondrial genomes are well characterized but have been poorly investigated in other taxa. However, studies on molluskan mitochondrial genomes have revealed extensive variations when compared with the mitochondrial genomes of other animals [1], [2], [3], [4]. Among neogastropods, 13 entire mitochondrial genomes have been reported so far [5], [6], [7], [8], [9]. Interestingly, these genomes share a highly conserved gene arrangement with only two cases of tRNA gene translocations [7].

Typically, animal mitochondrial genomes are organized very tightly. They exhibit short intergenic sequences and neighboring genes may even overlap. As an exception, a large non-coding mtDNA region can reach up to several kilobases (kb) in length. In various species, the origin of replication and transcriptional start sites have been identified in this region, leading to the designation of this mtDNA section as the control region (CR) [10].

So far, the mitochondrial genomes of the venomous neogastropods Conus textile and Conus borgesi have been reported [5], [7]. Cone snails are marine mollusks that produce a complex cocktail of venomous peptides for hunting prey. Because of the specificity and high affinity to a variety of ion channels and receptors, these peptides - also known as conopeptides - have become important tools in pharmacological research and are of considerable interest in drug discovery and development.

Here, we present the mitochondrial genome of the fish-hunting cone snail Conus consors and describe some outstanding features of its mitochondrial DNA (mtDNA) sequence in comparison with C. textile and C. borgesi. This work is part of the Venomics initiative that was launched in 2003 by members of the International Society on Toxinology and joined by the J. Craig Venter Institute (JCVI) in 2005 [11](ref 4). In 2007, as part of CONCO, the Cone Snail Genome Project for Health (see www.conco.eu), a Consortium of CONCO partners was created, with the goal of performing the first genome sequencing of a venomous marine animal and to unravel the complexity of its venomous function.

Materials and Methods

Sampling and DNA Extraction

Live Conus consors were collected in June 2007 during the CONFIELD-I scientific expedition to the remote Chesterfield Islands in New Caledonia. All necessary permits were obtained for the described field studies from the Official Authorities of New Caledonia. The cone snails were kept in aquariums in the frame of the CONCO project. The foot tissue samples from one specimen of Conus consors (sample NC070619AB) were prepared early 2008. Several steps were optimized in order to produce the most DNA of acceptable molecular weight (greater than 10 Kbp dsDNA) per mg of tissue [12]. For Roche/454 sequencing, Conus consors genomic DNA (gDNA) was initially isolated using the following steps. DNA extraction was achieved using the EDTA/EGTA/SDS/Proteinase K protocol developed at the J. Craig Venter Institute, which is a modification of standard techniques [13]. 149.8 mg of Conus consors foot tissue was ground to powder using mortar and pestle under liquid nitrogen. The pulverized tissue was resuspended in TE/EGTA buffer and cells were lysed by three repeated freeze/thaw cycles, and treated with lysozyme and proteinase K. DNA was extracted with buffer saturated phenol, which was followed by overnight precipitation in 4°C ethanol. DNA extraction was achieved with cetyltrimethylammonium bromide (CTAB) buffer to remove phenolics, polysaccharides, and other PCR inhibitors. The CTAB interface was back-extracted with chloroform to recover additional gDNA, which was followed by phenol, phenol/chloroform extraction, ethanol precipitation and DNA resuspension. It was noted that even after multiple rounds of extraction/precipitation, the C. consors DNA exhibited an unusual brown-purple pigment and a relatively high viscosity. For Illumina/Solex sequencing an improved protocol was established for isolating Conus consors genomic DNA that was free of any pigments and exhibited a typical viscosity. The protocol was the same as above until DNA precipitation in 4°C ethanol. DNA was then extracted with CTAB/Polyvinylpolypyrrolidone (PVPP) buffer [14] to remove phenolics, polysaccharides, and other PCR inhibitors. DNA was purified on a hydroxyapatite column [15]. Seven column volumes of step gradient of 0.4 M phosphate and 1.0 M phosphate at 60°C were used to elute the gDNA from the column and fractions containing Conus consors gDNA were pooled. The Conus consors genomic DNA isolated using this revised protocol did not exhibit any pigment and was of typical viscosity. Analysis on 0.8% agarose gel indicated the pooled DNA was larger than 10 Kbp in size. UV/Vis spectrum of the pooled DNA showed a 260 nm/280 nm absorbance ratio of 1.78, and a 260 nm/230 nm absorbance ratio of 1.99. The species was confirmed by PCR using both 16S rRNA and 18S rRNA specific primers as previously described [12].

Roche/454 Titanium Fragment Library Pyrosequencing

7 µg of high molecular weight Conus consors genomic DNA was sheared to 500–800 bp in size using nebulization. Any small fragments generated during nebulization were removed by purification of size-selected DNA from an agarose gel. Size distribution was confirmed using Agilent DNA 7500 chip. A 454 Titanium fragment library was constructed and the quality of the single stranded DNA library was checked by an Agilent RNA Pico 6000 chip. Eighteen full plates of the Conus consors 454 Titanium fragment library were run on the Roche/454 Genome Sequencer [16]. The total sequencing generated 17,965,569 reads, and 5,538,744,227 bp of sequence data.

Illumina/Solexa Sequencing

The Conus consors gDNA from the improved isolation protocol was used to construct an Illumina/Solexa 300 bp paired-end library. This library was sequenced on a single lane of an 8 lane flowcell, using a 100 bp paired end read protocol on an Illumina/Solexa GAII sequencer. This single lane produced a total of 56,004,872 reads, and a total of 5,375,369,341 bp of sequence data.

Genome Assembly

Whole genome assembly was performed using the Roche/454 and Illumina/Solexa data with Roche/454’s GS De Novo Assembler [17]. The GS De Novo Assembler produced 2,091,744 contigs containing 975,801,793 bp of sequence data, had a contig maximum length of 56,875 bp, and a contig N50 value of 610 bp. The genome assembly is highly fragmented due to the abundant low-complexity repeats. Detailed protocol of Conus consors genomic DNA assembly and findings from the genome analysis will be presented elsewhere.

Annotation

The mitochondrial genome sequences of previously sequenced neogastropods were downloaded from NCBI’s RefSeq (http://www.ncbi.nlm.nih.gov/RefSeq/) (see Data S1 for accession numbers). The genomic contigs obtained from Conus bullatus were downloaded from the Conus bullatus project website http://derringer.genetics.utah.edu/conus/.

Protein coding genes were identified by homology search against available mtDNA sequences from C. borgesi [7] and C. textile [6]. For tRNA genes two alternative prediction programs were used. tRNAscan [18] was run with corresponding settings for organellar tRNA. ARWEN, which is designed for predicting metazoan mitochondrial tRNA genes [19], was run with invertebrate-specific settings. In addition, a homology search was performed against the annotated tRNA sequences of C. textile and C. borgesi. The exact start and end nucleotides of the tRNAs were determined by comparing the results obtained using all three methods. rRNA genes were determined based on homology to corresponding annotations in the mtDNA sequences of C. textile and C. borgesi which in turn were identified by homology to other mitochondrial rRNA genes. The annotation of 5′ and 3′ ends of 12S rRNA and 16S rRNA sequences is therefore tentative. Potential secondary structures and their folding energies in the control region were predicted using the mfold web server (http://mfold.rna.albany.edu/?q=mfold) [20].

Verification of the Putative Control Region in the mtDNA Sequence of Conus consors

The existence of the non-coding putative CR in the mtDNA sequence was verified by semi-manual assembly of the region of interest using additional raw sequencing reads from Illumina/Solexa as described above and previously [12]. The Illumina/Solexa reads were aligned by MUSCLE [21] to the automatically assembled mtDNA reference sequence. The resulting alignment was manually verified and tested for assembly errors. No misassembled sections were detected during manual reassembly.

In addition to the second-generation sequencing strategies, a PCR-based approached followed by classical Sanger sequencing was employed to verify and to determine the exact lengths of several sequence motifs (poly(A), poly(T) and poly(AT)) in the putative mtDNA CR of C. consors. According to the assembly of the mitochondrial genome derived from the Illumina/Solexa data, Primer3 (http://biotools.umassmed.edu/bioapps/primer3_www.cgi) was utilized to generate four primer pairs flanking the sequence motifs of interest (see Figure 1; Forward (F)1.1: GGTAACAACCATGTTTCGGGGTGA and Reverse (R)1.1: TGCGCGAGTGCACGCACATA, PCR protocol: 94°C for 10 min – (94°C for 45 sec –65°C for 45 sec –68°C for 45 sec) x40 cycles –68°C for 10 min, PCR product: 434 bp; F1.2: TGCGCGAGTGCACGCACATA and R1.2: TGTGCTAGGGGGTTTGGTGGA, PCR protocol: 94°C for 10 min – (94°C for 45 sec –56°C for 45 sec –68°C for 45 sec) x40 cycles –68°C for 10 min, PCR product: 279 bp; F1.3: TGATTTTGCTACTTTGAGTAGAATG and R1.3: TAGGGTATGGCACGAAATCC, PCR protocol: 94°C for 10 min – (94°C for 45 sec –52°C for 45 sec –68°C for 45 sec) x40 cycles –68°C for 10 min, PCR product: 206 bp; F1.4: CCCTGTCCTCCTAGCGAGAT and R1.4: TGATTTTGCTACTTTGAGTAGAATG, PCR protocol: 94°C for 10 min – (94°C for 45 sec –52°C for 45 sec –68°C for 45 sec) x40 cycles –68°C for 10 min, PCR product: 230 bp). Each PCR (total volume of 25 µl) contained 1.5 U AmpliTaq-Gold® polymerase (Applied Biosystems; Foster City, CA/USA), 4 µmol dNTPs (GE Healthcare Europe; Freiburg, Germany), 8 ng bovine serum albumin (BSA – Sigma-Aldrich; Taufkirchen, Germany), 10 pmol forward-primer, 10 pmol reverse-primer and 5 ng of total DNA obtained from C. consors. Amplified PCR products were separated via agarose gel electrophoresis. Those PCR products exhibiting the expected (or an approximate) size were excised and purified using the QIAquick® Gel Extraction Kit (QIAGEN; Hilden, Germany). Extracted PCR products were ligated into a pGEM®-T expression vector (pGEM®-T Vector System II, Promega; Madison, WI/USA). JM109 competent cells (Promega; Madison, WI/USA) were transformed with the corresponding vector constructs. Successfully transformed clones were selected, amplified and the plasmid constructs extracted using the QIAprep® Spin Miniprep Kit (QIAGEN; Hilden, Germany). Prior to Sanger sequencing, the corresponding C. consors-derived inserts were reamplified via PCR by utilizing the vector-specific primers T7 (TAATACGACTCACTATAGGG) and SP6 (ATTTAGGTGACACTATAGAA). These primers were also employed as sequencing primers. Sequence analysis was performed using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer’s instructions. Amplified DNA samples were purified by utilizing the DyeEx® 2.0 Spin Kit (QIAGEN) according to the manufacturer’s instructions, denatured for 2 min at 95°C and sequenced on an ABI 3130 Genetic Analyzer (Applied Biosystems). Obtained DNA sequences specific for the mtDNA of C. consors were analyzed using Sequencing Analysis v5.2 (Applied Biosystems) and aligned via Clustal W2 [22].

Figure 1. Detailed scheme of the putative mtDNA control region of Conus consors in comparison with C. borgesi and C. textile.

Figure 1

Open in a new tab

The non-coding putative mtDNA control region specific for C. consors is located between the genes for tRNA-Phe and COX3. The region spans 698 bp (12713–13411) and exhibits several striking sequence motifs. Comparisons between C. consors, C. borgesi and C. textile show that short inverted repeats (IR1; blue boxes) seem to be a common feature in the mitochondrial genomes of cone snails. However, a long inverted repeat (IR2; red boxes) of 71 bp seems to exist exclusively in C. consors. Further, the non-coding putative mtDNA control region of C. consors contains several poly(T), poly(A) and poly(AT) sequence motifs (highlighted in yellow). Four primer pairs (F/R1.1 - F/R1.4) were employed to validate the exact length of the poly(T), poly(A) and poly(AT) motifs and are shown with black-arrowed lines (F - forward, R- reverse).

Results

Gene Content and Arrangement of the Mitochondrial Genome of C. consors

The mtDNA of C. consors was sequenced and assembled using Illumina/Solexa and Roche/454 second-generation sequencing platforms. The assembled mtDNA sequence was 16,112 bp in size. The heavy strand of the mtDNA molecule consisted of 27.7% adenine (A), 13.5% cytosine (C), 19.4% guanine (G) and 39.4% thymine (T) with a total (A/T) content of 67.1%. The mitochondrial genome contained 13 genes encoding proteins of the respiratory chain, 22 tRNA genes and 2 rRNA genes. All protein coding genes as well as the tRNAs for Asp, Val, Leu1-2, Pro, Ser1-2, His, Phe, Lys, Ile, Ala, Arg, Asn and both ribosomal RNA genes were located on the heavy strand of the mtDNA molecule. In contrast, the tRNAs for Met, Tyr, Cys, Trp, Gln, Gly, Glu and Thr were located on the light mtDNA strand. All protein coding genes commenced with the standard ATG start codon. The gene order of the mitochondrial genome of C. consors was similar to that of other neogastropods for which sequence data are available [5], [6], [7], [8], [9] (Figure 2). Remarkably, sequence overlaps existed between the same genes and showed exactly the same length as in C. textile [6]. The longest overlap (7 bp) was observed for the genes encoding NADH dehydrogenase subunit 4 L (nad4L) and NADH dehydrogenase subunit 4 (nad4).

Figure 2. Gene arrangement of the mitochondrial genome of Conus consors in comparison with other neogastropods.

Figure 2

Open in a new tab

The gene order of the mitochondrial genome of C. consors was compared with the mitochondrial genomes of two other cone snails (C. borgesi and C. textile) and further marine neogastropods. The scheme visualizes genes encoding proteins (yellow), transfer-RNAs (blue) and ribosomal RNAs (green). Non-coding mtDNA regions larger than 50 bp are white-colored, while the non-coding and putative control region between the genes for tRNA-Phe and COX3 in the mitochondrial genomes of C. consors and T. dimidiata is highlighted in red.

The Longest Intergenic mtDNA Sequence Exhibits Several Characteristics of a Control Region

The longest intergenic sequence in the mitochondrial genome of C. consors was found to be located between the genes for tRNA-Phe (trnF) and cytochrome c oxidase subunit III (cox3). The size of this region was 698 bp, five-fold longer than in the mtDNA of C. textile and C. borgesi with 126 bp and 127 bp, respectively [5], [7]. In animal mitochondrial genomes, the longest intergenic part of the mtDNA sequence usually contains several elements which regulate the initiation of replication and transcription and is therefore referred to as control region (CR) [1]. Based on analogy in the mitochondrial genomes of Lophiotoma cerithiformis and Ilyanassa obsoleta, the intergenic sequence between trnF and cox3 was suggested to represent the CR in the mitochondrial genome of C. textile [6]. Indeed, in C. consors, the mtDNA region between trnF and cox3 showed several CR-specific characteristics: (I) the sequence represented the longest non-coding region in the mitochondrial genome, (II) exhibited a high (A/T) content (70.3%) and (III) contained possible stem-loop-like secondary structures as well as (IV) repetitive elements.

Interestingly, numerous homopolymeric sequence motifs (poly(A), poly(T) and a long poly(AT) tandem repeat stretch) were detected in the putative mtDNA CR of C. consors, while no comparable sequence motifs were reported in the mitochondrial genomes of C. textile and C. borgesi. In these cone snail species, the corresponding intergenic mtDNA sequence was found to be more than five times shorter than in C. consors. Recently, a partial nuclear genome of another cone snail (Conus bullatus) has been reported [23]. None of the C. bullatus contigs provided matches against the putative mtDNA CR detected in the cone snails C. consors, C. borgesi and C. textile. Based on homology, some short contigs belong to the mitochondrial genome but no full-length sequence is available. Therefore, the existence of a similar CR on the mitochondrial genome of C. bullatus is currently unclear.

In order to exclude potential artifacts due to sequencing and/or data assembling repeated regions in the control region, the corresponding mtDNA section was further investigated. The original assembly which was based on Roche/454 sequencing reads contained 44 (AT) tandem repeat motifs (poly(AT)44) in the putative CR. Additional reads obtained from Illumina/Solexa sequencing were not useful to estimate the exact length of the poly(AT) stretch. These reads either ended before the poly(AT) sequence motif or reached up to a maximum of seven (AT) tandem repeats (poly(AT)7) only (data not shown). However, the other parts of the CR were well covered and confirmed the existence of long intergenic sequence motifs in the mitochondrial genome of C. consors. In addition, homology studies indicated that the CR did not exhibit any sequence homology in the nuclear genome of C. consors (data not shown). Thereby the possibility that sequencing reads from the nuclear genome had been misassembled into the mitochondrial genome was excluded.

The putative CR between trnF and cox3 in the mitochondrial genome of C. consors represents the longest non-coding mtDNA sequence known among the cone snail species investigated so far (Figure 2). Although differing in length, this mtDNA region in C. consors, C. borgesi and C. textile is sharing one common aspect: All three mitochondrial genomes contain a short inverted repeat (IR1) motif that is very similar regarding sequence and location (Figure 1). In C. textile and C. borgesi, the IR1 contains 18 bp and 19 bp, respectively. Here, in C. consors, the IR1 was found to be shorter (8 bp) and immediately followed by a long segment, which is missing in the mtDNA of the other two cone snail species.

Furthermore, another, even longer inverted repeat (IR2) sequence motif consisting of more than 70 bp and surrounding the stretch of poly(AT) tandem repeats (Figure 1) was found in the mitochondrial genome of C. consors. However, the exact length of the IR2 region remained unclear due to the existence of poly(T) and poly(A) sequence motifs. Based on the original assembly, the IR2 contained poly(T)12 and poly(A)16 homopolymers. Interestingly, manual validation with additional Illumina/Solexa sequencing reads resulted in longer homopolymer tracts, poly(T)22 and poly(A)22, respectively.

In order to verify and to determine the exact length of the poly(T) and poly(A) IR2 sequence motifs, the putative CR was also analyzed in an additional and independent PCR-based approach followed by classical Sanger sequencing. Since poly(AT) motifs have been reported to create problems in CR sequencing [24], [25], this experimental strategy was also employed to determine the exact length of the poly(AT) stretch. Optimized PCR protocols were developed and applied to amplify the IR2 sequence parts containing the poly(T) and poly(A) motifs as well as the poly(AT) stretch. PCR-based amplification of both IR2 sequence parts including the poly(T) and poly(A) motifs was successful. However, in case of the poly(AT) stretch, no distinct PCR products of the expected size were obtained. PCR products exhibiting the expected size (poly(T) and poly(A) analyses) or an approximate size (poly(AT) analyses) were employed for Sanger sequencing.

Sequence analyses of multiple clones confirmed the existence of both IR2 poly(T) and poly(A) sequence motifs as well as the presence of poly(AT) tandem repeats. The length of the homopolymeric poly(T) and poly(A) sequence motifs and the poly(AT) tandem repeat stretch could not exactly be determined. However, the data obtained by Sanger sequencing suggested that, most likely, both homopolymeric IR2 sequence motifs (poly(T) and poly(A)) are 18 or 19 bp in length (Figure 3).

Figure 3. Analyses of poly(T) and poly(A) motifs in the IR2 sequence of Conus consors.

Figure 3

Open in a new tab

25 clones representing the first IR2 sequence part (blue bars; primer pair F/R-1.1, PCR product includes poly(T) stretch) and 17 clones representing the second IR2 sequence part (red bars; primer pair F/R-1.3, PCR product includes poly(A) stretch) were sequenced according to Sanger and analyzed. Since, the quality of the poly(A) sequences obtained had been suboptimal, the reverse complement sequences containing a poly(T) stretch instead of the poly(A) motif were analyzed. For both IR2 sequence parts investigated, variations in length due to the phenomenon of strand slippage were observed. Accordingly, it was not possible to determine the exact length of the poly(T) and the poly(A) stretches. Most likely, both homopolymeric sequence motifs are 18 or 19 bp in length.

In order to determine the exact length of the poly(AT) tandem repeat stretch and to exclude errors of the sequencing data by contamination with genomic DNA, a novel protocol for the extraction of mtDNA from cone snail tissue was established and pure mtDNA was employed for Sanger sequencing (see Data S1, S2, S3). The existence of the poly(AT) sequence motif was confirmed by this experimental strategy. However, the exact length of the stretch was still not clear, since the detected signals could not be analyzed after 10 to 12 poly(AT) tandem repeats (data not shown).

In invertebrates the CR apparently lacks conserved sequence blocks and is not as well characterized as in vertebrates. However, it is known that in Drosophila mtDNA the origin of the light/minor coding strand is located in the middle of the large AT-rich non-coding region [26]. Increased AT-content is one characteristic that is used for the identification of the replication origins. Similarly, the AT-rich section in C. consors mtDNA could refer to the existence of the replication origin inside the intergenic sequence between the genes for trnF and cox3. Among vertebrate species, the conserved sequence located around the replication origin of the light strand could form stem-loop configuration which is suggested to be required for the initiation of replication by acting as the recognition structure for the mitochondrial primase enzyme [27]. The analysis of the secondary structure of the mtDNA molecule via mfold showed that the region preceding the IR2 has a potential to form stem-loop-like structures (Figure 4). Interestingly, one of these structures is formed by the IR1 and also found in the mtDNA of C. textile and C. borgesi (Figure 1, 4). There exists also a larger but weaker stem-loop after IR1 (Figure 4). The largest and C. consors specific inverted repeat IR2 could also form a complex secondary structure (Figure S1). It is unclear whether such a complex structure actually exists and exhibits a regulatory function.

Figure 4. Predicted secondary structures before IR2 of the mtDNA control region of Conus consors in comparison with C. borgesi and C. textile.

Figure 4

Open in a new tab

Short inverted repeat IR1 (highlighted with yellow circles) is a common feature of the non-coding region in the mitochondrial genomes of C. consors, C. borgesi and C. textile. Structures and folding energies were predicted with mfold [20].

Discussion

To date, 13 complete mitochondrial genomes of snails from the order of the Neogastropoda are available and show a very high level of similarity [5], [6], [7], [8], [9]. Among cone snails, the order and even the overlaps of the mitochondrial genes are highly conserved. It is interesting to note that mtDNA sequences of cone snails show a major difference regarding the putative CR between trnF and cox3. Rather, the CR of the fish-hunting species C. consors shares several similar motifs with the phylogenetically more distant Terebra dimidiata, a marine snail from the family of the Terebridae [28], [29]. So far, T. dimidiata [7], [28], [29], another venomous marine snail feeding on worms, is the only known neogastropod which exhibits a similar non-coding and putative mtDNA CR between trnF and cox3 observed in C. consors. However, this region is even longer (848 bp) and does not align well with the putative CR in the mitochondrial genome of C. consors. Both regions share short and very similar segments, including the preceding mtDNA sequence and also 39 bp of the IR2 sequence motif itself (Figure 5). It would be of interest to investigate the possible correlation of this observation with the venomous function. So far, no long IRs in the CR of the mitochondrial genome of T. dimidiata have been reported. However, in that genome, a short (10 bp) IR is located in the mtDNA region which is homologous to the IR2 sequence motif of C. consors. In addition, the intergenic mtDNA sequence between trnF and cox3 in T. dimidiata contains a poly(AT) motif, but it is shorter and preceded by a poly(AC) tandem repeat. No similar mtDNA segments were observed between the putative control region of C. consors and the largest intergenic sequence of Cancellaria cancellata, located between the genes for NADH dehydrogenase subunit 1 (nad1) and the tRNA for proline (trnP). The CR is found to be the fastest evolving region of the mtDNA [30], [31]. It is hard to speculate which specific mechanisms are involved in the CR variation among cone snails. In some organisms long non-coding regions were shown to contain pseudogenes [32], [33]. However, no known pseudogenes were observed in the mtDNA of C. consors. When comparing the intergenic mtDNA region between trnF and cox3 with the whole mitochondrial genome sequence, no homologies were found that would refer to duplications of the coding areas. Also, no homologies were detected when compared to the corresponding nuclear genome sequence. A comparative study of the mitochondrial genomes from other cone snail species and neogastropods would be useful to estimate the extent of variation of the long non-coding mtDNA sequences in this group. It is likely that the variable control region will prove to be additional feasible and valuable marker sequence for phylogenetic analysis of cone snails or neogastropods. The existence of comparable region in T. dimidiata supports the potential usability, however due to the limited number of available mitochondrial genome sequences among neogastropods it remains to be studied in the future.

Figure 5. Highly similar segments of the longest non-coding mtDNA region in the neogastropods Conus consors and Terebra dimidiata .

Figure 5

Open in a new tab

[7] . CRs in C. consors and T. dimidiata share short and very similar segments, including the 39 bp of the IR2 sequence motif (the second alignment). Sequence alignment was done by MUSCLE [20]. Sequence similarities are highlighted in green (A), blue (C), yellow (G) and red (T).

Tandem repeats (like poly(AT) motifs) as well as the high (A/T) content are well known features of the CRs in animal mtDNA [1]. Poly(AT) stretches have been described in several putative CRs of various species including mollusks [34], [35], [36], [37], [38]. The present data suggests that the mtDNA CR of C. consors exhibits 44 poly(AT) tandem repeats. Notably, poly(AT) stretches of a similar or larger size have been identified in non-coding regions of other molluskan mitochondrial genomes as well, e.g. in Haliotis rubra [25] and Katharina tunicata [34].

The inconsistencies observed regarding the lengths of the poly(T) and poly(A), as well as the poly(AT) sequence motifs in the mtDNA CR of C. consors may be due to sequencing and/or assembling errors. It is also possible that those mtDNA regions could be highly polymorphic. Previously, several variations of the poly(AT) stretches in molluskan mitochondrial genomes have been reported [39], [40], [41]. Therefore, it would be reasonable to compare the lengths of the poly(AT) stretches in other specimens of C. consors to prove whether such polymorphisms also occur in this cone snail species. On the other hand, several variations of the mtDNA region may exist due to a phenomenon called strand slippage which can occur during enzymatic replication. Strand slippage is a result of mispairing between the template and the newly synthesized strand and can occur especially when long homopolymeric and/or short tandem repeat sequence motifs are present.

Several sequence motifs similar to well known cis-acting elements are also present in the mtDNA CR of C. consors. The ATATAA box is a common modular element for most promoters. The motif TATATATAA as a consensus sequence has been identified in the sea urchin Arbacia lixula [42] as well as the marine mussel Mytilus [43] and may represent a bidirectional promoter [44] or a binding site for transcription termination factors [44], [45]. It is possible that the mtDNA sequence region around the poly(AT) stretch in C. consors exhibits a similar function. The conserved sequence motif GYRCAT is present in the terminal associated sequences (TAS) of mammalian and avian mitochondrial CRs [46], [47]. The TAS element is considered to represent the termination site of the mtDNA’s heavy strand synthesis [48]. A similar sequence motif, GCACAT, precedes the poly(AT) stretch in C. consors. However, it is difficult to prove whether these sequence motifs play a role in the regulation of mtDNA homeostasis in C. consors.

The sequence of the second largest intergenic region in C. consors, located between the genes cox1 and cox2, has been previously published [6]. The alignment of this 132 bp long sequence with the corresponding region in the current assembly revealed nine mismatches (6.8%). All of those nine mismatches were transition type changes (purine-purine and pyrimidine-pyrimidine). Whether these differences represent the actual polymorphisms remains to be verified.

Conclusions

Here, we present the sequence and gene annotation of the mitochondrial genome of the cone snail Conus consors. The mitochondrial genome contains a long intergenic sequence (about 700 bp) that exhibits several characteristic motifs typical for the control region of animal mtDNA. Remarkably, the reported putative CR is unique among the mitochondrial genomes of cone snails since a comparable mtDNA region has not been described for other Conus species investigated so far.

Supporting Information

Figure S1

mfold predicted secondary structure for the whole CR of Conus consors . IR2 could potentially form a large stem-loop-like structure.

(PDF)

Click here for additional data file. (73.3KB, pdf)
Data S1

Accession numbers of Neogastropoda mitochondrial genomes.

(PDF)

Click here for additional data file. (37.7KB, pdf)
Data S2

Preparation of mitochondria from fresh or frozen Conus consors tissue samples.

(PDF)

Click here for additional data file. (47.9KB, pdf)
Data S3

Isolation of mitochondrial DNA.

(PDF)

Click here for additional data file. (32.2KB, pdf)

Acknowledgments

We would like to express our deepest gratitude to the Government of New Caledonia, the French Navy, the IRD-Nouméa “Institut de Recherche pour le Développement” (Fabrice Colin, Napoléon Colombani, Jean-Louis Menou, Claude Payri), to Robin Offord from the Mintaka Foundation for Medical Research (Geneva, Switzerland), as well as to the Toxinomics Foundation office in Nouméa (Alain Gerbault and Jacques Pusset) for their constant support. We also acknowledge Dr David Piquemal from Skuld-Tech (France) for providing EST sequences to allow confirmation of our genome sequencing. DNA extraction, library construction and sequencing were performed at the J. Craig Venter Institute, in Rockville, Maryland, USA. We wish to thank Cindi Pfannkoch for her guidance for sample preparation and useful suggestions for DNA isolation.

Funding Statement

This study has been performed as part of the CONCO cone snail genome project for health (www.conco.eu) funded by the European Commission within the 6th Framework Program (LIFESCIHEALTH-6 Integrated Project LSHB-CT-2007, contract number 037592) with Dr Torbjörn Ingemansson as scientific officer. AB and MR were partially supported by SF0180026s09 from the Estonian Ministry of Education and Research and by the European Union European Regional Development Fund through the Estonian Centre of Excellence in Genomics. IW was supported by the German Network for Mitochondrial Disorders mitoNET 01GM1113B of the Bundesministerium für Bildung und Forschung. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Boore JL (1999) Animal mitochondrial genomes. Nucleic Acids Res 27: 1767–1780. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Kurabayashi A, Ueshima R (2000) Complete sequence of the mitochondrial DNA of the primitive opisthobranch gastropod Pupa strigosa: systematic implication of the genome organization. Mol Biol Evol 17: 266–277. [DOI] [PubMed] [Google Scholar]
  • 3. Boore JL, Medina M, Rosenberg LA (2004) Complete sequences of the highly rearranged molluscan mitochondrial genomes of the Scaphopod Graptacme eborea and the bivalve Mytilus edulis. Mol Biol Evol 21: 1492–1503. [DOI] [PubMed] [Google Scholar]
  • 4. Grande C, Templado J, Zardoya R (2008) Evolution of gastropod mitochondrial genome arrangements. BMC Evol Biol 8: 61. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Bandyopadhyay PK, Stevenson BJ, Cady MT, Olivera BM, Wolstenholme DR (2006) Complete mitochondrial DNA sequence of a Conoidean gastropod, Lophiotoma (Xenuroturris) cerithiformis: gene order and gastropod phylogeny. Toxicon 48: 29–43. [DOI] [PubMed] [Google Scholar]
  • 6. Bandyopadhyay PK, Stevenson BJ, Ownby JP, Cady MT, Watkins M, et al. (2008) The mitochondrial genome of Conus textile, coxI-coxII intergenic sequences and Conoidean evolution. Mol Phylogenet Evol 46: 215–223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Cunha RL, Grande C, Zardoya R (2009) Neogastropod phylogenetic relationships based on entire mitochondrial genomes. BMC Evol Biol 9: 210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. McComish BJ, Hills SF, Biggs PJ, Penny D (2010) Index-free de novo assembly and deconvolution of mixed mitochondrial genomes. Genome Biol Evol 2: 410–424. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Simison WB, Lindberg DR, Boore JL (2006) Rolling circle amplification of metazoan mitochondrial genomes. Mol Phylogenet Evol 39: 562–567. [DOI] [PubMed] [Google Scholar]
  • 10. Shadel GS, Clayton DA (1997) Mitochondrial DNA maintenance in vertebrates. Annu Rev Biochem 66: 409–435. [DOI] [PubMed] [Google Scholar]
  • 11. Menez A, Stocklin R, Mebs D (2006) ‘Venomics’ or : The venomous systems genome project. Toxicon 47: 255–259. [DOI] [PubMed] [Google Scholar]
  • 12.Stockwell T, Baden-Tillson H, Favreau P, Mebs D, Ducancel F, et al. (2010) Sequencing the genome of Conus consors: preliminary results. In: Advances and new technologies in toxinology (Barbier, J., Benoit, E., Marchot, P., Mattéi, C. and Servent, D. Eds) SFET Editions, Gif sur Yvette, France Epub on http://wwwsfetassofr: 11–16.
  • 13.Sambrook J, Fritch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual: Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, ed.2.
  • 14. Lodhi MA, Guang-Ning Y, Weeden NF, Reisch BI (1994) Simple and efficient method for DNA extraction from grapevine cultivars Vitis species Ampelopsis. Plant Molecular Biology Reporter 12(1): 6–13. [Google Scholar]
  • 15. Bernardi G (1965) Chromatography of nucleic acids on hydroxyapatite. Nature 206: 779–783. [DOI] [PubMed] [Google Scholar]
  • 16. Margulies M, Egholm M, Altman WE, Attiya S, Bader JS, et al. (2005) Genome sequencing in microfabricated high-density picolitre reactors. Nature 437: 376–380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Miller JR, Koren S, Sutton G (2010) Assembly algorithms for next-generation sequencing data. Genomics 95: 315–327. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Lowe TM, Eddy SR (1997) tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res 25: 955–964. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Laslett D, Canback B (2008) ARWEN: a program to detect tRNA genes in metazoan mitochondrial nucleotide sequences. Bioinformatics 24: 172–175. [DOI] [PubMed] [Google Scholar]
  • 20. Zuker M (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res 31: 3406–3415. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Edgar RC (2004) MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res 32: 1792–1797. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, et al. (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947–2948. [DOI] [PubMed] [Google Scholar]
  • 23. Hu H, Bandyopadhyay PK, Olivera BM, Yandell M (2011) Characterization of the Conus bullatus genome and its venom-duct transcriptome. BMC Genomics 12: 60. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Machida RJ, Miya MU, Yamauchi MM, Nishida M, Nishida S (2004) Organization of the mitochondrial genome of Antarctic krill Euphausia superba (Crustacea: Malacostraca). Mar Biotechnol (NY) 6: 238–250. [DOI] [PubMed] [Google Scholar]
  • 25. Maynard BT, Kerr LJ, McKiernan JM, Jansen ES, Hanna PJ (2005) Mitochondrial DNA sequence and gene organization in the [corrected] Australian blacklip [corrected] abalone Haliotis rubra (leach). Mar Biotechnol (NY) 7: 645–658. [DOI] [PubMed] [Google Scholar]
  • 26. Wolstenholme DR (1992) Animal mitochondrial DNA: structure and evolution. Int Rev Cytol 141: 173–216. [DOI] [PubMed] [Google Scholar]
  • 27. Hixson JE, Wong TW, Clayton DA (1986) Both the conserved stem-loop and divergent 5′-flanking sequences are required for initiation at the human mitochondrial origin of light-strand DNA replication. J Biol Chem 261: 2384–2390. [PubMed] [Google Scholar]
  • 28. Holford M, Puillandre N, Modica MV, Watkins M, Collin R, et al. (2009) Correlating molecular phylogeny with venom apparatus occurrence in Panamic auger snails (Terebridae). PLoS One 4: e7667. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Castelin M, Puillandre N, Kantor YI, Modica MV, Terryn Y, et al. (2012) Macroevolution of venom apparatus innovations in auger snails (Gastropoda; Conoidea; Terebridae). Mol Phylogenet Evol 64: 21–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Aquadro CF, Greenberg BD (1983) Human mitochondrial DNA variation and evolution: analysis of nucleotide sequences from seven individuals. Genetics 103: 287–312. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Cann RL, Brown WM, Wilson AC (1984) Polymorphic sites and the mechanism of evolution in human mitochondrial DNA. Genetics 106: 479–499. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Mueller RL, Boore JL (2005) Molecular mechanisms of extensive mitochondrial gene rearrangement in plethodontid salamanders. Mol Biol Evol 22: 2104–2112. [DOI] [PubMed] [Google Scholar]
  • 33. Arndt A, Smith MJ (1998) Mitochondrial gene rearrangement in the sea cucumber genus Cucumaria. Mol Biol Evol 15: 1009–1016. [DOI] [PubMed] [Google Scholar]
  • 34. Boore JL, Brown WM (1994) Complete DNA sequence of the mitochondrial genome of the black chiton, Katharina tunicata. Genetics 138: 423–443. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Boore JL (2006) The complete sequence of the mitochondrial genome of Nautilus macromphalus (Mollusca: Cephalopoda). BMC Genomics 7: 182. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Oliveira MT, Azeredo-Espin AM, Lessinger AC (2007) The mitochondrial DNA control region of Muscidae flies: evolution and structural conservation in a dipteran context. J Mol Evol 64: 519–527. [DOI] [PubMed] [Google Scholar]
  • 37. Yuan Y, Li Q, Kong L, Yu H (2012) The complete mitochondrial genome of the grand jackknife clam, Solen grandis (Bivalvia: Solenidae): a novel gene order and unusual non-coding region. Mol Biol Rep 39: 1287–1292. [DOI] [PubMed] [Google Scholar]
  • 38. Milbury CA, Gaffney PM (2005) Complete mitochondrial DNA sequence of the eastern oyster Crassostrea virginica. Mar Biotechnol (NY) 7: 697–712. [DOI] [PubMed] [Google Scholar]
  • 39. Jiang L, Wu WL, HUANG PC (1995) The mitochondrial DNA of Taiwan abalone Haliotis diversicolor Reeve, 1846 (Gastropoda: Archaeogastropoda: Haliotidae). Mol Mar Biol Biotechnol 4: 353–364. [Google Scholar]
  • 40. Snyder M, Fraser AR, Laroche J, Gartner-Kepkay KE, Zouros E (1987) Atypical mitochondrial DNA from the deep-sea scallop Placopecten magellanicus. Proc Natl Acad Sci U S A 84: 7595–7599. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Gjetvaj B, Cook DI, Zouros E (1992) Repeated Sequences and Large-Scale Size Variation of Mitochondrial-DNA - a Common Feature among Scallops (Bivalvia, Pectinidae). Molecular Biology and Evolution 9: 106–124. [Google Scholar]
  • 42. De Giorgi C, Martiradonna A, Lanave C, Saccone C (1996) Complete sequence of the mitochondrial DNA in the sea urchin Arbacia lixula: conserved features of the echinoid mitochondrial genome. Mol Phylogenet Evol 5: 323–332. [DOI] [PubMed] [Google Scholar]
  • 43. Cao L, Kenchington E, Zouros E, Rodakis GC (2004) Evidence that the large noncoding sequence is the main control region of maternally and paternally transmitted mitochondrial genomes of the marine mussel (Mytilus spp.). Genetics 167: 835–850. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Roberti M, Polosa PL, Musicco C, Milella F, Qureshi SA, et al. (1999) In vivo mitochondrial DNA-protein interactions in sea urchin eggs and embryos. Curr Genet 34: 449–458. [DOI] [PubMed] [Google Scholar]
  • 45. Fernandez-Silva P, Polosa PL, Roberti M, Di Ponzio B, Gadaleta MN, et al. (2001) Sea urchin mtDBP is a two-faced transcription termination factor with a biased polarity depending on the RNA polymerase. Nucleic Acids Res 29: 4736–4743. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Randi E, Lucchini V (1998) Organization and evolution of the mitochondrial DNA control region in the avian genus Alectoris. J Mol Evol 47: 449–462. [DOI] [PubMed] [Google Scholar]
  • 47. Brehm A, James Harris AD, Alves CD, Jesus JD, Thomarat FD, et al. (2003) Structure and evolution of the mitochondrial DNA complete control region in the lizard Lacerta dugesii (Lacertidae, Sauria). J Mol Evol 56: 46–53. [DOI] [PubMed] [Google Scholar]
  • 48. Doda JN, Wright CT, Clayton DA (1981) Elongation of displacement-loop strands in human and mouse mitochondrial DNA is arrested near specific template sequences. Proc Natl Acad Sci U S A 78: 6116–6120. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1

mfold predicted secondary structure for the whole CR of Conus consors . IR2 could potentially form a large stem-loop-like structure.

(PDF)

Click here for additional data file. (73.3KB, pdf)
Data S1

Accession numbers of Neogastropoda mitochondrial genomes.

(PDF)

Click here for additional data file. (37.7KB, pdf)
Data S2

Preparation of mitochondria from fresh or frozen Conus consors tissue samples.

(PDF)

Click here for additional data file. (47.9KB, pdf)
Data S3

Isolation of mitochondrial DNA.

(PDF)

Click here for additional data file. (32.2KB, pdf)

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES