Abstract
FOXM1 is a critical regulator of the G1/S and G2/M cell cycle transitions, as well as of the mitotic spindle assembly. Previous studies have suggested that FOXM1 regulates CDC25A gene transcription, but the mechanism remains unknown. Here, we provide evidence that FOXM1 directly regulates CDC25A gene transcription via direct promoter binding and indirect activation of E2F-dependent pathways. Prior literature reported that CDC25B and CDC25C activate CDK1/cyclinB complexes in order to enable phosphorylation of FOXM1. It was unknown if CDC25A functions in a similar manner. We report that FOXM1 transcriptional activity is synergistically enhanced when co-expressed with CDC25A. The increase is dependent upon CDK1 phosphorylation of FOXM1 at T600, T611 and T620 residues. We also report a novel protein interaction between FOXM1 and CDC25A via the C-terminus of FOXM1. We demonstrate that the phosphorylation of Thr 600 and Thr 611 residues of FOXM1 enhanced this interaction, and that the interaction is dependent upon CDC25A phosphatase activity. Our work provides novel insight into the underlying mechanisms by which FOXM1 controls the cell cycle through its association with CDC25A.
Introduction
Cell cycle regulation and oncogenesis are inextricably linked through their use of common signaling pathways. The cell cycle relies upon tightly regulated checkpoints at the G1/S and G2/M transitions and fidelity through mitotic spindle formation to ensure cellular integrity. Progression through the cell cycle relies upon a complex temporal interplay among assorted cyclins, associated cyclin-dependent kinases (CDKs), and CDK inhibitors [1]. Cyclins, CDKs, and CDK inhibitors require precise regulation at the DNA and protein levels in order to fulfill these integral functions.
The Forkhead box M1 (FOXM1) gene belongs to the evolutionarily-conserved FOX superfamily of transcriptional regulators. The human FOXM1 is spliced into three classes of transcripts FOXM1A, FOXM1B and FOXM1C, [2]. Recent studies revealed critical roles for FOXM1 in mediating G1/S and G2/M cell cycle transitions, chromosome segregation, and cytokinesis [3]–[6]. Phosphorylation at the C-terminal region is required for the transcriptional activation of FOXM1 during different stages of the cell cycle [7]. FOXM1 contains two RXL docking sequences at the N-terminus, which are bound by CDK2/cyclin E during G1 and S phase and CDK1/cyclin B during G2 phase. In addition, the transcriptional activation of FOXM1 requires an LXL motif for binding of CDK/cyclin complexes, for efficient phosphorylation of FOXM1B Thr residue 596 that is essential for the recruitment of co-transactivator p300/CBP [7]. Raf/MEK/MAPK mediates the phosphorylation of FOXM1 on residues S331 and S704 in late S phase and stimulates nuclear translocation [8]. Moreover, phosphorylation of residues T600 and T611 is required for relief of the inhibitory function of the N-terminal repressor domain [9]. After activation, FOXM1 regulates genes important for cell cycle progression. FOXM1 promotes G1/S transition through its relief of p21Cip1 and p27Kip1 inhibition [10] and its regulation of JNK1 [11]. It has also been implicated, although not directly shown, to mediate the transcriptional regulation of the dual phosphatase gene cell division cycle 25A (CDC25A) [6], [10], [12].
To facilitate G2/M transition, FOXM1 is activated by PLK1-mediated phosphorylation (S715 and S724), which in turn upregulates PLK1 [5], [13]. Activated FOXM1 can trigger cyclin B transcription through direct promoter binding, thereby exerting potent effects on mitotic entry [14]–[16]. Additionally, FOXM1 regulates the transcription of cyclin A [15], [17], AURKB [5], and CDC25B [6]. FOXM1-deficient cells exhibit chromosomal instability, which has been attributed to its role in mediating the transcription of genes critical to proper chromosome segregation and cytokinesis [14], [18]. FOXM1 mediates the transcription of CENPF, which is essential to kinetochore localization and the spindle assembly checkpoint [14]. Additionally, FOXM1 regulates the transcription of mitotic spindle assembly checkpoint genes such as CENPA, NEK2, and KIF20A [10], [19].
CDC25 phosphatases catalyze cell cycle progression by dephosphorylating and activating the cyclin-dependent kinase (CDK) complexes, which in turn regulate cell cycle progression. Three CDC25 isoforms have been identified in mammalian cells: CDC25A, CDC25B and CDC25C. Each regulates different phases of the cell cycle [20]–[22]. CDC25A mainly regulates G1/S cell cycle transition and S phase progression by activating CDK2/cyclin E and CDK2/cyclin A complexes [23], [24]; it also plays a role in the G2/M cell cycle transition by activating CDK1/cyclin B complexes [25], [26].
A positive feedback model between FOXM1 and CDC25B has been proposed in which CDC25B phosphatase is a direct target for FOXM1 transcriptional activation [6], CDC25B protein activates CDK2/cyclin E or CDK1/cyclin B complexes through dephosphorylation, and the activation of CDK/cyclin complexes maintains phosphorylation of FOXM1 [7]. We hypothesize that a similar positive feedback loop of signal transduction may exist between FOXM1 and CDC25A. We previously reported that low doses of arsenic promoted cell proliferation and G1/S cell cycle progression in the human mammary epithelial cell line MCF10A; we used high throughput methods to identify upregulation of CDC25A twenty four hours after low doses of arsenic exposure [27]. We observed that upon long-term exposure to low doses of arsenic, there is a consistently elevated level of FOXM1 and CDC25A expression (unpublished data). These data suggested that there were functional and structural interactions between FOXM1 and CDC25A. However, such interactions between FOXM1 and CDC25A have not been previously characterized.
In this study, we show, for the first time, that FOXM1 directly binds at specific cis-regulatory consensus sites and activates the CDC25A promoter. We also report that FOXM1 indirectly activates the CDC25A promoter through an E2F-dependent mechanism. Additionally, FOXM1 transcriptional activity is synergistically enhanced when co-expressed with CDC25A. Consistent with known mechanisms involving CDC25B and CDC25C, our data support a CDC25A-CDK1-FOXM1 signal transduction pathway that promotes the transcriptional activity of FOXM1. Our data also support a new mechanism in which FOXM1 and CDC25A proteins interact via the C-terminus of FOXM1. The phosphorylation of Thr 600 and Thr 611 residues of the FOXM1 protein enhanced the interaction and the interaction required a functional CDC25A with intact phosphatase activity. This study reveals novel transcriptional and protein-protein interaction mechanisms involving FOXM1 and CDC25A that influence how cell cycle progression is regulated.
Materials and Methods
Cell culture
Human U2OS osteosarcoma and HEK293T cells (American Type Culture Collection, ATCC, Manassas, VA) were cultured at 37°C, 5% CO2 in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (P/S). CWR22rv prostate cancer cells (obtained from Dr. Chinghai Kao, Department of Urology, Indiana University School of Medicine [28]) were maintained in RPMI1640 supplemented with 10% FBS and 1% P/S.
Antibodies
Western blotting was performed with primary antibodies directed against FOXM1, CDC25A, CDK2, FLAG, and β-Actin, which were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Antibodies against CDK1, CDK4 and CDK6 were purchased from Cell Signaling Technology (Danvers, MA), Anti-MYC antibody was purchased from Invitrogen (Carlsbad, CA). Anti-CDC25A agarose used for immunoprecipitation was purchased from Abcam (Cambridge, MA).
Plasmids
The primers used to generate these constructs are listed in Table S1. pCMV-XL5-FOXM1B plasmid and pCMV-XL5 control vector were purchased from Origene (Rockville, MD). FOXM1 was amplified with Phusion polymerase (New England Biolabs, MA) and subcloned in the pACT and pBIND vectors at their BamHI and XbaI sites (Promega, Madison, WI) and the p3×FLAG-CMV-14 (Sigma) vector at the HindIII and XbaI. A series of deletion constructs were made by PCR with Phusion polymerase. All FOXM1 deletion constructs were subcloned in pACT and pBIND at the BamHI and XbaI sites. The N-terminal deletion (ΔN) covered amino acids 236–763. The C-terminal fragment covered amino acids 330–763. The C-terminal deletion (ΔC) covered amino acids 1–329. The N-terminal fragment incorporated amino acids 1–235. The WHD deletion (ΔWHD) included a fusion of amino acids 1–235 and 330–736. This was accomplished using a PCR sewing technique previously described [29]. The WHD fragment incorporates amino acids 236–329.
The CDC25A plasmid was purchased from Origene and subcloned in-frame in the pACT expression vector at the BamHI and XbaI restriction sites or the pCMV3Tag9 (Agilent, La Jolla, CA) expression vector at the BamHI and XhoI restriction sites. The site-directed, phosphatase-dead mutant C431S was created using the QuikChange II site-directed mutagenesis kit according to the manufacturer's recommendations. The FOXM1 binding site reporter plasmid, 6×FOXM1-luc, was generated by annealing two primers containing TACGTTGTTATTTGTTTTTTTCG repeated six times and ligating into the pGL3-basic vector. A 2210 bp fragment of the CDC25A promoter and 5′UTR (−1962 through +248) was amplified by PCR from genomic DNA derived from U2OS cells using Phusion polymerase and subcloned in pGL3-Basic (Promega) at the BglII and HindIII restriction sites. Deletion constructs were subcloned in pGL-3 Basic at the BglII and HindIII restriction sites using Phusion polymerase: a 1413 bp fragment (−1962 through −549) and a 224 bp fragment containing three putative FOXM1 binding sites (−1302 through −1078). A 583 bp CDC25A promoter fragment (−548 through +34) was a generous gift from Dr. Daniel DiMaio (Yale University Cancer Center, New Haven, CT). QuikChange II site-directed mutagenesis (Agilent) was performed to alter the three putative FOXM1 binding sites and the two E2F binding sites, according to the manufacturer's instructions (Agilent).
Cell cycle
U2OS cells were seeded at 1×106 cells per 100 mm dish in DMEM+10% FBS. The following day, the cell culture media was replaced with DMEM+10% FBS+100 ng • ml−1 nocodazole (Sigma, St. Louis, MO), and the cells were exposed for 16 h to synchronize their cell cycle in G2/M. At 16 h, cells were washed with 1× phosphate-buffered saline (PBS) and returned to DMEM+10% FBS. At 1, 3, 6, 12, and 18 hours following the re-introduction of DMEM+10% FBS, cells were trypsinized and collected for DNA content analysis by FACS and western blotting.
For FACS, trypsinized cells were collected in 1× PBS and resuspended in 70% ethanol to fix overnight at −20°C. Cells were pelleted, washed twice in 3% BSA in 1× PBS, and pelleted. Cells were resuspended and incubated for 30 minutes at room temperature in propidium iodide staining buffer containing 3% BSA, 40 µg • ml−1 propidium iodide, and 0.2 mg• ml−1 RNase in 1× PBS. DNA content analyses were carried out using the Accuri C6 flow cytometer (Ann Arbor, MI). Data were analyzed with ModFit (Verity Software House, Topsham, ME).
For western blotting, trypsinized cells were washed in 1× PBS, pelleted, and lysed in MPER+protease and phosphatase inhibitors (Thermo Fisher Scientific, Rockford, IL). Soluble fractions were separated by gel electrophoresis on 4–20% polyacrylamide gels (Bio-Rad, Hercules, CA), transferred to PVDF membranes, and subjected to western blotting with antibodies against FOXM1, CDC25A, CDK2, CDK1, and β-Actin.
ChIP-PCR
ChIP was performed using Chromatrap Pro-A Spin Columns from the Porvair Filtration Group Ltd. (Ashland, VA). Cells were fixed in 1% formaldehyde for 10 minutes. Fixation reactions were quenched with 0.67 M glycine. U2OS and CWR22rv1 cells were lysed and subjected to sonication to achieve 100–500 bp fragments. For immunoprecipitation of formaldehyde cross-linked chromatin-protein complexes, antibodies against FOXM1 or rabbit IgG (Santa Cruz Biotechnology) were used, and the same amount of chromatin without antibody incubation was used as an input control. The samples were incubated with end-over-end rotation for 3 hours at 4°C. DNA was eluted in the Chromatrap Pro-A spin columns according to the manufacturer's recommendations. DNA was analyzed via semi-quantitative PCR and quantitative RT-PCR. Primers were designed to span the FOXM1 binding sequence of the CDC25A promoter, along with appropriate controls. The binding activity of FOXM1 to CDC25A promoter was evaluated by the fold enrichment method. (http://www.invitrogen.com/site/us/en/home/Products-and-Services/Applications/epigenetics-noncoding-rna-research/Chromatin-Remodeling/Chromatin-Immunoprecipitation-ChIP/chip-analysis.html)
FOXM1 overexpression and FOXM1 siRNA knockdown
U2OS cells were plated at 1×106 cells per 60 mm dish. For overexpression, the next day, cells were transfected with pCMV-XL6-FOXM1 or pCMV-XL-6 using Lipofectamine 2000 according to the manufacturer's recommendations. For siRNA knockdown, cells were transfected with ON-TARGET Plus siRNA pools targeting FOXM1 (Dharmacon, Lafayette, CO) using the DharmaFECT reagent, according to the manufacturer's recommendations (Dharmacon). At 48 h, cells were washed with 1× PBS and lysed in MPER+1× protease and phosphatase inhibitors (Thermo Fisher Scientific). Soluble fractions were separated by PAGE on 4–20% gels, transferred to PVDF membranes, and subjected to western blotting with antibodies against FOXM1, CDC25A, and β-Actin.
Dual luciferase reporter assays and western blot
U2OS cells were plated in 24 well dishes at 1×105 cells per well. The next day, cells were co-transfected with indicated plasmids (total amount of 800 ng) using Lipofectamine 2000 transfection reagents, according to the manufacturer's recommendations. Ten nanograms of the pRL-SV40 plasmid were used for normalization. After incubation for 48 h, cells were washed with 1× PBS and lysed with 1× Passive Lysis Buffer (Promega) and subjected to luciferase reporter assays. Luciferase reporter assays were performed using the Dual Luciferase Assay kit (Promega). Data were collected using a GloMax single tube luminometer (Promega). All firefly luciferase outputs were normalized to Renilla luciferase activities.
To identify the CDK substrates involved in CDC25A-activated FOXM1 transcriptional activity, ON-TARGET siRNA targeting CDK1, CDK2, CDK4 or CDK6 (Dharmacon) were co-transfected with the indicated plasmids. After incubation for 48 h, cells were washed with 1× PBS and lysed in MPER+protease and phosphatase inhibitors (Thermo Fisher Scientific). The FOXM1 transcriptional activity was tested by dual luciferase assay. Soluble fractions were separated by PAGE on 4–20% gels, transferred to PVDF membranes, and subjected to western blotting with antibodies against CDK1, CDK2, CDK4 and CDK6, and β-Actin was used as loading control.
Mammalian two-hybrid system
Mammalian two-hybrid experiments were performed using the Checkmate system, according to the manufacturer's recommendations (Promega). Briefly, U2OS cells were co-transfected with 300 ng of the bait plasmid pBIND-FOXM1, which contains the yeast GAL4 DNA-binding domain fused in-frame with sequence encoding FOXM1 (or the indicated deletion construct), 300 ng of the prey plasmid pACT-CDC25A, which contains the HSV VP16 activation domain fused in-frame with sequence encoding CDC25A (WT or C431S), and 200 ng of the reporter plasmid pG5-luc, which contains five GAL4 binding sites upstream of a minimal TATA box and the firefly luciferase reporter gene. The pBIND plasmid and its derivatives, also express Renilla luciferase, which was used for normalization. After incubation for 2 days, cells were washed with 1× PBS, lysed with 1× Passive Lysis Buffer (Promega) and subjected to luciferase reporter assays. Luciferase reporter assays were performed using the Dual Luciferase Assay kit (Promega). Data were collected using the GloMax single tube luminometer (Promega). All firefly luciferase outputs were normalized to Renilla luciferase activities.
Co-immunoprecipitation
Approximately 1×106 293T cells were plated in 60 mm dishes so that they were ∼90% confluent on the day of transfection. 293T cells were co-transfected with 4 µg of p3×FLAG-CMV-14-FOXM1 (or control p3×FLAG-CMV-14) and 4 µg of pCMV-3Tag9-CDC25A (or control pCMV-3Tag9) using Lipofectamine 2000 transfection reagent, according to the manufacturer's recommendations. After 48 hours, cells were washed in 1× PBS and lysed in M-PER containing protease and phosphatase inhibitors. Soluble fractions were incubated with anti-FLAG M2 antibody resin (Sigma) overnight at 4°C with end-over-end mixing. The resin was washed three times in BupH TBS, pH 7.2 (Thermo Fisher Scientific) containing 0.1% Tween 20 and eluted with 3× FLAG peptide (Sigma). The eluted protein complex was then analyzed by Western blotting.
For the detection of the natural protein interactions of FOXM1 and CDC25A, 6×106 U2OS cells were lysed in MPER buffer containing 1× protease/phosphatase inhibitors (Thermo Fisher Scientific). Whole cell lysates were pre-cleared with protein G sepharose (Sigma Aldrich) and normal rabbit IgG overnight at 4°C with end-over-end mixing. Cell lysates were then incubated with anti-CDC25A antibody (Santa Cruz) overnight at 4°C and then with protein G sepharose for 1 h at 4°C. The resin was washed three times, and the eluted protein complex was analyzed by Western blotting using the anti-FOXM1 antibody (Santa Cruz).
Approximately 1×106 U2OS cells were plated in 60 mm dishes so that they were ∼90% confluent on the day of transfection. U2OS cells were transfected with 8 µg of p3×FLAG-CMV-14-FOXM1 (wild-type), FOXM1(T600A), FOXM1(T620A) and FOXM1(L656A), using Lipofectamine 2000 transfection reagent, according to the manufacturer's recommendations. After 48 hours, cell lysates were coimmunoprecipitated with anti-CDC25A antibody agarose, followed by Western blot with monoclonal antibody against FLAG tag.
Statistics
All statistics were performed with GraphPad Prism 5.01. The asterisks in each figure indicate statistically significant changes with P values calculated by the indicated test: *, P<0.05; **, P≤0.01; and ***, P≤0.001. *, P<0.05 was considered statistically significant. Δ, P>0.05 represented no significant difference.
Results
FOXM1 and CDC25A exhibit coordinated protein expression with cell cycle progression
FOXM1 and CDC25A are known as critical regulators of the G1/S and G2/M transitions during the cell cycle [1], [10], [11], [30]. CDC25A phosphatase activates CDK/cyclin complexes, which then phosphorylate downstream targets and promotes cell cycle progression [31]. CDC25A primarily activates CDK2/cyclin E and CDK2/cyclin A complexes during the G1/S transition [23], [24], and CDK1/cyclin B complex during the G2/M transition and mitosis [25], [26]. We sought to detect the expression of FOXM1, CDC25A, CDK1 and CDK2 during cell cycle progression in the U2OS cell model. U2OS cells were synchronized by treatment with nocodazole (100 ng • ml−1) for 16 h. They were then released into growth media containing 10% FBS so that cells were stimulated to re-enter the cell cycle. After treatment with nocodazole for 16 h, most cells were synchronized in both S phase (31.1%) and G2/M phase (65.3%), and very few cells were at G0/G1 phase (3.6%). At 1 h post-release, cells were exiting M phase, and entering into early G1 phase (∼21.5%). By 3 h post release, approximately 48.6% of the cells were entering G1 phase. At 6 h post release, most cells were at the G0/G1 phase (76.4%). By 12 h post-release, cells were entering S phase (64.8%), and by 18 h post-release, cells were in late S (∼53.9% in S phase) or G2/M phase (25.6% in G2/M) (Fig. 1A).
The analyses indicated that most cells at early, middle and late G1 phase are detected at 1, 3 and 6 h post-release respectively. S phase is maximal at 12 h. Released cells entered G2/M at 18 h (Fig. 1B). We collected cells at each of these time points to ascertain if there was a coordinated expression pattern which might indicate co-regulation during cell cycle progression. Western blotting revealed coordinated protein expression in FOXM1 and CDC25A upon release of cells from nocodazole treatment (Fig. 1C). FOXM1 protein expression increased as cells progressed from G0/G1 (1 h) through S (12 h) and into G2/M phase (18 h), and degraded when cells exited to M phase (1 h). CDC25A exhibited an expression profile over time that was similar to FOXM1. CDK1 expression levels increased at the late G1 or early G2 phases, and CDK2 expression levels were relatively constant throughout the cell cycle. These findings suggested that FOXM1 regulates G1/S and G2/M cell cycle transition through its interactions with CDC25A, a protein that has long been suspected of being regulated by FOXM1 [6], [10], [12].
FOXM1 transcription factor regulates CDC25A gene expression
CDC25A transcription is regulated by E2F and c-MYC transcription factors in a cell cycle-dependent manner (15, 40). Previous reports indicated that FOXM1 regulates CDC25A gene expression, but the mechanism by which this occurred was not established [6], [10], [12]. We wanted to directly characterize the role of FOXM1 in activating the CDC25A promoter. We used a CDC25A promoter-driven luciferase construct containing the promoter and 5′UTR (−1896 through +123) to measure the effect of FOXM1 on CDC25A promoter activity. In a co-transfection study initiated in U2OS cells, we observed that increasing levels of FOXM1 protein triggered a dose-dependent increase in CDC25A promoter activity (Fig. 2A). Confirming this regulation, western blotting revealed that siRNA-mediated knockdown of FOXM1 protein expression led to a corresponding decline in CDC25A protein levels (Fig. 2B and 2C). Siomycin A, a small molecule FOXM1 inhibitor, decreased the gene transcription of CDC25A in U2OS cells (See Fig. S1). These data establish a direct role for FOXM1 in the regulation of CDC25A gene expression.
FOXM1 regulates CDC25A gene transcription through direct binding and through an indirect mechanism involving the E2F pathway
By using the Transcription Elements Search System (TESS) (http://www.cbil.upenn.edu/cgi-bin/tess/tess), we identified three putative FOXM1 consensus sites in the CDC25A promoter and 5′UTR (−1896 through +123). The identified FOXM1 putative sites are located at positions −1019 through −1012 (GTAAATAT), −891 through −884 (TTATTTGC), and −875 through −868 (TGTTTGCT). Two E2F binding sites were identified at positions −156 through −149 (TTTGGCGC) and −97 through −90 (CCGCGAAA) at the 3′ end of the CDC25A promoter (See Fig. S2) [30], [32].
To investigate the roles of individual FOXM1 and E2F binding sites in FOXM1-induced transactivation of CDC25A promoter, we generated targeted deletions of the CDC25A promoter to identify regions of enhanced FOXM1 responsiveness (Fig. 3A). The 3′ end CDC25A promoter construct contains two E2F binding sites, and the 5′ end CDC25A promoter construct contains the three putative FOXM1 binding sites, and excludes the E2F binding sites. We also created a construct that contained sequence solely in the region of the three putative FOXM1 binding sites. The data from the co-transfection experiment showed that the deletion containing the 5′ end only (with FOXM1 binding sites) exhibited a 4-fold FOXM1-dependent activation. FOXM1 strongly activated the promoter construct containing the FOXM1 binding site region alone by 29-fold, confirming the biological function of FOXM1 binding sites (Fig. 3B).
To clarify how the promoter containing only the three putative FOXM1 binding sites is able to drive gene transcription in the absence of the minimum promoter, we tested if the co-activators p300, CBP, and pCAF coordinated with FOXM1 activated the transcriptional activity of the 5′ end CDC25A promoter. Co-activators may directly activate basal transcriptional machinery to recruit RNA Pol II and promote formation of stable transcription pre-initiation complexes. Co-activators may also alter DNA directly by acetylating and activating transcription factors and chromatin associated proteins. Histone function can be modified by co-activators via acetylation of nucleosomal histones to modify the functioning of promoters of activated genes. Co-activators are themselves part of an active proteomic network as, once activated, they may link to other transcriptional co-activators to expand the diversity of genes activated [33]. The 5′ end CDC25A promoter construct was co-transfected with plasmids containing FOXM1, with or without p300, CBP and pCAF. In contrast to the control vector plus FOXM1, p300, but not CBP and pCAF, significantly increased FOXM1-induced CDC25A transcriptional activity (Fig. 3C).
The 3′ end of the CDC25A promoter, which is devoid of FOXM1 binding sites, still exhibited luciferase activity upon FOXM1 overexpression (3.8-fold, Fig. 3B), suggesting an additional mechanism. CDC25A is known to be transcriptionally regulated by the E2F pathway, possessing two E2F binding sites within the 3′ end of the CDC25A promoter [30], [32]. It is not known if FOXM1 regulates CDC25A transcription through an E2F-dependent mechanism. We found that knockdown of FOXM1 significantly decreased the levels of E2F1 and E2F2 transcripts, but not E2F3 in U2OS cells (E2F3 data not shown, See Fig. S3). We performed site-directed mutagenesis of the CDC25A promoter to alter both E2F binding sites (Fig. 3D). In U2OS cells, mutation of both E2F sites led to a significant reduction of CDC25A promoter-luciferase activity upon ectopic FOXM1 expression (Fig. 3E). Taken together, the data indicate that FOXM1-induced CDC25A gene transcription is induced both by direct binding and by an indirect mechanism involving the E2F pathway.
FOXM1 protein physically interacts with the CDC25A promoter
The potential protein-DNA binding of FOXM1 at CDC25A promoter was tested by the chromatin immunoprecipitation (ChIP)- quantitative PCR assay. Anti-FOXM1 antibody was used to immunoprecipitate regions of chromatin bound by FOXM1 in U2OS osteosarcoma cells and CWR22rv prostate cancer cells. The immunoprecipitated chromatin was used in semi-quantitative PCR and real time quantitative PCR to test for direct binding of FOXM1 to CDC25A promoter. Primers were designed to amplify the region of the CDC25A promoter that contained the three putative FOXM1 binding sites (primer set A) or the region lacking the three binding sites (primer set B). In both U2OS and CWR22rv cells, there was robust expression of the FOXM1 amplicon which incorporated the FOXM1 binding sites. There was no amplification of a downstream region of the CDC25A promoter that lacked FOXM1 binding sites, and no amplification was observed in IgG controls (Fig. 4A). These findings confirm that FOXM1 directly binds to the three FOMX1 binding sites found in the CDC25A promoter.
The FOXM1 binding sites in the CDC25A promoter are functionally redundant
As shown in Fig. 3B, the CDC25A promoter deletion containing three FOXM1 binding sites (224 bp FOXM1 portion) exhibited the most robust activation, supporting the idea that FOXM1 directly binds these three sites. The ChIP-qPCR and reporter studies support a direct FOXM1 binding to the CDC25A promoter, regulating its transcriptional activity. These three FOXM1 binding sites lie in close proximity to one another in the CDC25A promoter. It is unknown if all three binding sites are required for FOXM1-induced CDC25A transcription. We performed site-directed mutagenesis to change one, two or three of the FOXM1 binding sites in the 224 bp FOXM1 portion of the CDC25A promoter, as shown in Fig. 4B. We compared the transactivation of promoter containing the mutated FOXM1 binding sites with the wild-type FOXM1 binding sites when exposed to ectopic FOXM1 expression. In comparison to the truncated promoter containing wild-type FOXM1 binding sites, the mutation of one of the three FOXM1 binding sites did not significantly decrease the transactivation (Fig. 4C), indicating a degree of functional redundancy. When sites 1 and 2, sites 2 and 3, or sites 1, 2, and 3 were mutated, we observed a significant decrease in FOXM1-dependent luciferase activity.
CDC25A bolsters FOXM1 transcriptional activity through CDK1 pathway
FOXM1 activation requires interactions with, and phosphorylation by, CDK/cyclin complexes [34]. CDC25B and CDC25C protein activate CDK1/cyclin B complexes by dephosphorylation, allowing the CDK1/cyclin B complex to maintain the phosphorylation of FOXM1 (33). We wanted to test if CDC25A participates in this mechanism. We observed that co-expression of CDC25A and FOXM1 had a synergistic effect on the transcriptional activity of FOXM1 (Fig. 5A). This finding suggests that CDC25A activates FOXM1 transcription.
Because CDC25 phosphatases have been implicated in the control of cell cycle transition by regulating the activities of CDK1 and CDK2, we tested which CDK(s) might play a more critical role in the mechanism of CDC25A-FOXM1 signal transduction. We first used small molecular inhibitors of CDK1 (3-(2-Chloro-3-indolylmethylene)-1,3-dihydroindol-2-one) and CDK2 (inhibitor II) after DNA co-transfection. The IC50 of the CDK1 inhibitor is 5.8 µM and of the CDK2 inhibitor is 60 nM. A 10 µM dose of CDK1 inhibitor is required to significantly block CDC25A-induced FOXM1 transcription activity. This concentration is ∼1.7-fold higher than the IC50 of the CDK1 inhibitor. A 0.4 µM dose of CDK2 inhibitor is required to significantly block CDC25A-enhanced FOXM1 transcription activity. The concentration is ∼6.7-fold higher than the IC50 (See Fig. S4). These data indicate that CDC25A probably enhances FOXM1 transcriptional activity via the CDK1, but not by the CDK2 pathway. The results were validated using siRNA. Consistent with Fig. 5A, co-expression of CDC25A with FOXM1 significantly increased FOXM1 transcriptional activity. This synergistic activation was significantly inhibited when CDK1 expression was knocked down by siRNA. Knockdown of CDK2, CDK4 or CDK6 had no significant effect on the FOXM1-CDC25A activation of a FOXMI-binding site reporter (Fig. 5B). The efficacy of siRNA knockdown was confirmed by western blot (See Fig. S5). These results support a CDC25A-CDK1-FOXM1 signaling pathway.
CDC25B activates the FOXM1 transcriptional activity through the CDK1 phosphorylation of FOXM1 protein, and CDK/cyclin proteins phosphorylate either Ser or Thr residues with a consensus phosphorylation sequence X-S/T-P-X-R/K [7]. We searched for potential CDK phosphorylation sites on the FOXM1 protein using the NetPhos 2.0 server (http://www.cbs.dtu.dk/services/NetPhos/) and identified a series of CDK phosphorylation sites. After screening these phosphorylation sites by site-directed mutagenesis, we identified three phosphorylation sites (T600, T611 and T620) and a second Leu residue within a LXL sequence (L656) involved in the CDC25A-enhanced FOXM1 transcriptional activity. We observed that mutations of these phosphorylation sites and the LXL sequence reduced CDC25A-enhanced FOXM1 transcriptional activity (Fig. 5C). These results support a model in which CDK1/cyclin protein complexes mediate CDC25A-enhanced FOXM1 transcriptional activity via phosphorylation of T600, T611 and T620 residues and the LXL docking motif. [7].
The C terminus of FOXM1 interacts with CDC25A, and the interaction was enhanced by phosphorylation of T600 and T611 residues
CDC25A regulates cell cycle through interaction with CDK/cyclin complexes [35], including CDK1/cyclin B [36]. Both CDC25A and FOXM1 are thought to interact with CDK1, but a direct protein interaction between CDC25A and FOXM1 has not been characterized previously. We wanted to determine if such a direct protein-protein interaction occurs between FOXM1 and CDC25A. HEK293T cells were co-transfected with plasmids encoding a FOXM1-3× FLAG fusion gene and/or a CDC25A-3×MYC fusion gene. FOXM1-3× FLAG protein was immunoprecipitated from the soluble fraction with an anti-FLAG resin. CDC25A-3×MYC protein was co-immunoprecipitated, supporting a protein-protein interaction with FOXM1-3×FLAG (Fig. 6A).
An endogenous protein-protein interaction of FOXM1 and CDC25A was detectable also in U2OS cells. Following cell lysis, the CDC25A protein complex was captured by protein G sepharose and anti-CDC25A antibody, and FOXM1 protein expression was identified using anti-FOXM1 antibody by western blot. 10% of protein was used as the input (positive control), and IgG was used as negative control. As shown in Fig. 6B, CDC25A and FOXM1 protein expression were high in the CDC25A antibody-captured protein complex, but undetectable in the IgG-captured protein complex. The result indicates that endogenous FOXM1 interacts with CDC25A protein (Fig. 6B).
A mammalian two hybrid assay was performed in U2OS cells to confirm this interaction and determine which FOXM1 domain mediated this interaction (Fig. 6C). GAL4-FOXM1 and VP16-CDC25A exhibited significant interaction relative to control, as measured by normalized luciferase activity, indicating a robust interaction occurs between FOXM1 and CDC25A. FOXM1 proteins, each containing a different domain, were generated by a PCR deletion strategy and expressed as GAL4-FOXM1 deletion mutant proteins. Mammalian two hybrid data collected from these studies support a critical role for the C-terminus of FOXM1 in mediating the FOXM1-CDC25A protein interaction. Neither the N-terminal domain nor the winged helix domain (WHD) of FOXM1 exhibited interactions with CDC25A. In the presence of C-terminal FOXM1, the interaction was >60,000 fold above background. When the C-terminus was deleted, the resultant FOXM1 protein, containing the N-terminus and the WHD, failed to interact with CDC25A (Fig. 6D).
Our findings led us to test the hypothesis that the C-terminal FOXM1 interaction with CDC25A relied upon phosphorylation of residues, which were identified as critical to CDC25A-increased FOXM1 transcriptional activity in Fig. 5C. We further tested if the phosphorylation sites T600, T611 and T620 and the LXL docking motif (L656) enhanced the protein-protein interaction. The mutations of the T600A and T611A, but not the T620A and L656A at the C-terminus, significantly impaired the protein interaction of FOXM1 and CDC25A. The triple mutant T600A/T611A/T620A further impaired the protein interaction of FOXM1 and CDC25A (Fig. 6E). These results were confirmed by co-immunoprecipitation experiments with protein extracts prepared from U2OS transfected with either wild-type FOXM1 or FOXM1 with mutations of phosphorylation sites or the LXL docking motif. These results support the idea that intact phosphorylation of T600 and T611 residues of FOXM1 protein enhanced the protein's interaction with CDC25A (Fig. 6F).
CDC25A phosphatase activity is required for the CDC25A-activated FOXM1 transcriptional activity, CDC25A and FOXM1 protein interaction and CDK phosphorylation of the FOXM1 protein
The biological effect of CDC25A phosphatase is potentially dependent on both its abundance and its catalytic activity [37]. CDC25A phosphatase activity is required for dephosphorylation, as well as activation of CDK [38] and the interaction with CDK/cyclin complexes [39]. We investigated if the interaction of FOXM1 and CDC25A is dependent on CDC25A phosphatase activity. Phosphatase activity was destroyed by site-directed mutagenesis of the cysteine at amino acid 431 to serine (C431S) [38]. A mammalian two hybrid assay was used to analyze the interaction when either wild-type CDC25A or mutant CDC25A C431S was co-expressed with FOXM1. We observed that wild type CDC25A had a significantly higher affinity for FOXM1 than the C431S mutant. The data showed that FOXM1-CDC25A protein-protein interaction is dependent upon CDC25A phosphatase activity, as inactivation of CDC25A phosphatase activity significantly decreased the protein-protein interaction (Fig. 7A).
We also investigated if inactivation of CDC25A phosphatase affects FOXM1 transcriptional activity. Wild-type CDC25A or mutant CDC25A C431S was used to test the effect of CDC25A phosphatase activity on FOXM1 transcriptional activity. Consistent with data in Fig. 7A, wild-type CDC25A significantly increased FOXM1 transcriptional activity. However, CDC25A-increased FOXM1 transcriptional activity significantly decreased when CDC25A phosphatase was inactivated by the C431S mutation (Fig. 7 B). CDC25A dephosphorylates and activates CDK/cyclin complexes. The data do not support the idea that FOXM1 is a novel substrate of CDC25A-mediated dephosphorylation. Addition of CDC25A did not decrease, but rather increased the FOXM1 transcriptional activity. The biological effects of the protein interaction of FOXM1 and CDC25A need further investigation. Previous studies reported protein interactions of CDC25A and CDK1 [40] and of FOXM1 and CDK1 [7]. FOXM1 transcriptional activity is dependent on a CDC25A-CDK1-FOXM1 signal transduction pathway, i.e., CDC25A phosphatase activates CDK1, thereby allows the phosphorylation of FOXM1 and transcriptional activation of FOXM1.
Discussion
It is well known that FOXM1 participates in the G1/S and G2/M cell cycle transition phases, as well as in the assembly of the mitotic spindle [41]. CDC25A is a known G1/S cell cycle regulatory gene [24], [34] that exhibits an expression profile similar to FOXM1, with protein levels steadily increasing through S phase entry and mitosis (Fig. 1C). Transcriptional regulation of CDC25A has been shown to be directed by c-MYC in a fibroblast cell line through direct binding of MYC/MAX binding sites [42] and by E2F/Rb pathways [30]. In previous reports, FOXM1 was implicated, although not directly shown, to transcriptionally regulate CDC25A transcription [6], [10], [12]. In this study, we identified two novel mechanisms by which FOXM1 regulates CDC25A transcription: directly, through interactions with consensus FOXM1 binding sites, and indirectly, through an E2F-dependent mechanism.
We show that with increased FOXM1 protein, there is a concomitant increase in CDC25A promoter activity in U2OS cells (Fig. 2A). These findings were supported by data showing that, when FOXM1 was knocked down by siRNA, U2OS cells, exhibited a similar decrease in CDC25A protein expression (Fig. 2B). These data support the hypothesis that CDC25A is a direct target gene of the FOXM1 transcription factor. Through promoter deletion analysis, we identified a 224 bp fragment containing three putative FOXM1 binding sites that exhibited the most robust activation of the reporter (29-fold) (Fig. 3A,and B). These three putative FOXM1 binding sites lie in close proximity to one another on the CDC25A promoter. Their capacity to bind FOXM1 was verified by ChIP-PCR assays (Fig. 4A). Site-directed mutagenesis of FOXM1 binding sites 1 and 2, sites 2 and 3, and sites 1, 2, and 3 each resulted in a significant loss of promoter activity (Fig. 4B, and C). Mutation of a single binding site did not disrupt FOXM1 regulation of the CDC25A promoter. This indicates a level of functional redundancy among the three FOXM1 binding sites. We report for the first time evidence that FOXM1 directly binds to three consensus sites on the CDC25A promoter and provide a good example where, when multiple binding sites for one transcription factor lie in close proximity to one another on a gene promoter, any of the functional binding sites may promote gene transcription [43]. Interestingly, we did not see a complete loss of FOXM1-stimulated promoter activity when all three FOXM1 binding sites in the CDC25A promoter were mutated. We speculate that FOXM1 may indirectly activate the reporter construct by triggering pathways that result in translocation of other transcription factors capable of binding the promoter. Because mutations to the FOXM1 binding sites were made to single nucleotides and not the entire consensus sequence, we speculate that FOXM1, when ectopically expressed, still retains the capacity to bind the mutated consensus sequences, although only in a sub-optimal way.
Intriguingly, we observed significant activation of a CDC25A promoter reporter lacking these FOXM1 binding sites. This CDC25A promoter reporter contained two E2F binding sites that are known to be critical for CDC25A transcriptional activity [30], [32] (Fig. 3D). E2F1, E2F2, and E2F3 transcriptionally activate targets essential to the G1/S transition and bind the CDC25A promoter [44]. We show that FOXM1 appears to indirectly activate CDC25A through these E2F sites (Fig. 3E). When both E2F binding sites in the CDC25A promoter were mutated, there was a significant decline in FOXM1-mediated activation. FOXM1 regulates the transcription of E2F genes such as E2F1, E2F2 but not E2F3, as evidenced by the fact that the transcription levels of E2F genes significantly decreased with the knockdown of FOXM1 (See Fig. S3). These data strongly support a model in which FOXM1 regulates CDC25A transcription and G1/S cell cycle transition through direct binding of FOXM1 consensus sites and through indirect activation of E2F pathways.
FOXM1 transcriptional activity, and its subsequent effect on the cell cycle, is closely tied to its phosphorylation status [45]. FOXM1 proteins are present in cells at the G1/S boundary, and, while transcriptionally active, are hypophosphorylated. The phosphorylation status of FOXM1 increases through S phase and the G2/M transition, reaching its peak hyperphosphorylated form at mitosis [3]. With the increase in phosphorylation, there is an increase in transcriptional activity. Upon exit from mitosis, cells are dephosphorylated and transcriptional activity wanes [45]. FOXM1 phosphorylation is activated by numerous kinases and kinase pathways throughout cell cycle, including Raf/MEK/MAPK pathways [8], PLK1 [13], and cyclin-dependent kinases like CDK1 and CDK2 [7], [45]–[47]. CDKs form complexes with specific cyclins at different phases of cell cycle in order to promote cell cycle progression [34]. FOXM1 preferentially associates with CDK2/cyclin E complexes during G1 and S phases of the cell cycle [48], [49] and preferentially associates with CDK1/cyclin B complexes in the G2 phase [7]. CDK-cyclin complexes associate with FOXM1 proteins at specific cyclin-docking LXL motifs and promote the phosphorylation of FOXM1 [7]. Under certain circumstances, CDK1 can substitute for CDK2 function during the G1/S transition [50]. It was reported that CDC25B protein activates CDK1/cyclin B complexes by dephosphorylation, allowing the CDK1/cyclin B complex to maintain phosphorylation of FOXM1, while activated FOXM1 allows transcription regulation of genes required to mediate the cell cycle transition (33). It is well known that CDC25A directly binds, dephosphorylates and activates CDK/cyclin through the removal of the inhibitory phosphates [34]. In the current study, CDK1, but not CDK2 mediated the CDC25A-enhanced FOXM1 transcriptional activity.
CDC25A protein directly interacts with FOXM1 protein, and phosphorylation of Thr 600 and Thr 611 residues enhanced this interaction (Fig. 6). The protein interaction of FOXM1 and CDC25A is dependent upon the phosphatase activity of CDC25A. Inactivation of CDC25A phosphatase significantly decreased the interaction of the FOXM1 and CDC25A proteins. This suggests that the CDK1/cyclin complex activated by CDC25A phosphatase is required for the protein interaction. Furthermore, inactivation of CDC25A phosphatase significantly decreased CDC25A-enhanced FOXM1 transcriptional activity (Fig. 7). The direct protein-protein interaction of CDC25A and FOXM1 indicates that FOXM1 may be a novel substrate of CDC25A phosphatase. However, we found no evidence that FOXM1 is a substrate of CDC25A-mediated dephosphorylation. Addition of CDC25A increased FOXM1 transcriptional activity. A more complicated signal transduction network likely exists between CDC25A, CDK1 and FOXM1, because FOXM1 protein interacts with many other cell cycle regulatory proteins, including CDK1, cyclin B1, CDK2, cyclin E, CDC25B, and RB [7]. The present report reveals a novel signal transduction feedback loop between CDC25A and FOXM1. CDC25A and CDK1 proteins interact, and CDK1 phosphorylates Thr 600 and Thr 611 of FOXM1. Because phosphorylation of Thr 600 and Thr 611 is required for relief of the inhibitory function of the N-terminal repressor domain during G2 phase [9], our results infer a novel mechanism by which CDC25A activates FOXM1 by relieving autorepression by the N-terminal domain.
In summary, our data provide evidence that FOXM1 directly regulates CDC25A gene transcription through protein-DNA binding to the promoter and indirectly through E2F-dependent mechanism. Conversely, FOXM1 transcriptional activity is synergistically enhanced when co-expressed with CDC25A. This increase is dependent upon CDK1 phosphorylation of FOXM1 protein at T600 and T611 residues. FOXM1 and CDC25A protein interact via the C-terminus of FOXM1. The phosphorylation of Thr 600 and Thr 611 residues enhanced the interaction, and the interaction is dependent upon CDC25A phosphatase activity. The evidence provided in this work sheds important new insights into the underlying mechanisms by which FOXM1, through its associations with CDC25A, regulates cell cycle progression.
Supporting Information
Acknowledgments
We thank Dr. Chinghai Kao in Department of Urology, Indiana University School of Medicine for providing us with CWR22rv prostate cancer cells and Dr. Daniel DiMaio in Yale University Cancer Center for providing us with plasmid containing CDC25A promoter.
Funding Statement
This work was supported by United States Army Medical Research and Materiel Command (USAMRMC 617 0704400), the Maine Institute for Human Genetics and Health, United States of America, and the “Shenghua Scholar Professorship”, Central South University, People's Republic of China. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Malumbres M, Barbacid M (2009) Cell cycle, CDKs and cancer: a changing paradigm. Nat Rev Cancer 9: 153–166. [DOI] [PubMed] [Google Scholar]
- 2. Yao KM, Sha M, Lu Z, Wong GG (1997) Molecular analysis of a novel winged helix protein, WIN. Expression pattern, DNA binding property, and alternative splicing within the DNA binding domain. J Biol Chem 272: 19827–19836. [DOI] [PubMed] [Google Scholar]
- 3. Costa RH (2005) FoxM1 dances with mitosis. Nat Cell Biol 7: 108–110. [DOI] [PubMed] [Google Scholar]
- 4. Costa RH, Kalinichenko VV, Major ML, Raychaudhuri P (2005) New and unexpected: forkhead meets ARF. Curr Opin Genet Dev 15: 42–48. [DOI] [PubMed] [Google Scholar]
- 5. Krupczak-Hollis K, Wang X, Kalinichenko VV, Gusarova GA, Wang IC, et al. (2004) The mouse Forkhead Box m1 transcription factor is essential for hepatoblast mitosis and development of intrahepatic bile ducts and vessels during liver morphogenesis. Dev Biol 276: 74–88. [DOI] [PubMed] [Google Scholar]
- 6. Wang X, Kiyokawa H, Dennewitz MB, Costa RH (2002) The Forkhead Box m1b transcription factor is essential for hepatocyte DNA replication and mitosis during mouse liver regeneration. Proc Natl Acad Sci U S A 99: 16881–16886. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Major ML, Lepe R, Costa RH (2004) Forkhead box M1B transcriptional activity requires binding of Cdk-cyclin complexes for phosphorylation-dependent recruitment of p300/CBP coactivators. Mol Cell Biol 24: 2649–2661. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Ma RY, Tong TH, Cheung AM, Tsang AC, Leung WY, et al. (2005) Raf/MEK/MAPK signaling stimulates the nuclear translocation and transactivating activity of FOXM1c. J Cell Sci 118: 795–806. [DOI] [PubMed] [Google Scholar]
- 9. Laoukili J, Alvarez M, Meijer LA, Stahl M, Mohammed S, et al. (2008) Activation of FoxM1 during G2 requires cyclin A/Cdk-dependent relief of autorepression by the FoxM1 N-terminal domain. Mol Cell Biol 28: 3076–3087. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Wang IC, Chen YJ, Hughes D, Petrovic V, Major ML, et al. (2005) Forkhead box M1 regulates the transcriptional network of genes essential for mitotic progression and genes encoding the SCF (Skp2-Cks1) ubiquitin ligase. Mol Cell Biol 25: 10875–10894. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Wang IC, Chen YJ, Hughes DE, Ackerson T, Major ML, et al. (2008) FoxM1 regulates transcription of JNK1 to promote the G1/S transition and tumor cell invasiveness. J Biol Chem 283: 20770–20778. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Wang Z, Ahmad A, Banerjee S, Azmi A, Kong D, et al. (2010) FoxM1 is a novel target of a natural agent in pancreatic cancer. Pharm Res 27: 1159–1168. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Fu Z, Malureanu L, Huang J, Wang W, Li H, et al. (2008) Plk1-dependent phosphorylation of FoxM1 regulates a transcriptional programme required for mitotic progression. Nat Cell Biol 10: 1076–1082. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Laoukili J, Kooistra MR, Bras A, Kauw J, Kerkhoven RM, et al. (2005) FoxM1 is required for execution of the mitotic programme and chromosome stability. Nat Cell Biol 7: 126–136. [DOI] [PubMed] [Google Scholar]
- 15. Kalin TV, Wang IC, Ackerson TJ, Major ML, Detrisac CJ, et al. (2006) Increased levels of the FoxM1 transcription factor accelerate development and progression of prostate carcinomas in both TRAMP and LADY transgenic mice. Cancer Res 66: 1712–1720. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Leung TW, Lin SS, Tsang AC, Tong CS, Ching JC, et al. (2001) Over-expression of FoxM1 stimulates cyclin B1 expression. FEBS Lett 507: 59–66. [DOI] [PubMed] [Google Scholar]
- 17. Kalinichenko VV, Gusarova GA, Tan Y, Wang IC, Major ML, et al. (2003) Ubiquitous expression of the forkhead box M1B transgene accelerates proliferation of distinct pulmonary cell types following lung injury. J Biol Chem 278: 37888–37894. [DOI] [PubMed] [Google Scholar]
- 18. Wonsey DR, Follettie MT (2005) Loss of the forkhead transcription factor FoxM1 causes centrosome amplification and mitotic catastrophe. Cancer Res 65: 5181–5189. [DOI] [PubMed] [Google Scholar]
- 19. Myatt SS, Lam EW (2007) The emerging roles of forkhead box (Fox) proteins in cancer. Nat Rev Cancer 7: 847–859. [DOI] [PubMed] [Google Scholar]
- 20. Gautier J, Solomon MJ, Booher RN, Bazan JF, Kirschner MW (1991) cdc25 is a specific tyrosine phosphatase that directly activates p34cdc2. Cell 67: 197–211. [DOI] [PubMed] [Google Scholar]
- 21. Millar JB, McGowan CH, Lenaers G, Jones R, Russell P (1991) p80cdc25 mitotic inducer is the tyrosine phosphatase that activates p34cdc2 kinase in fission yeast. EMBO J 10: 4301–4309. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Lee MS, Ogg S, Xu M, Parker LL, Donoghue DJ, et al. (1992) cdc25+ encodes a protein phosphatase that dephosphorylates p34cdc2. Mol Biol Cell 3: 73–84. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Blomberg I, Hoffmann I (1999) Ectopic expression of Cdc25A accelerates the G(1)/S transition and leads to premature activation of cyclin E- and cyclin A-dependent kinases. Mol Cell Biol 19: 6183–6194. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Hoffmann I, Draetta G, Karsenti E (1994) Activation of the phosphatase activity of human cdc25A by a cdk2-cyclin E dependent phosphorylation at the G1/S transition. EMBO J 13: 4302–4310. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Lindqvist A, Kallstrom H, Lundgren A, Barsoum E, Rosenthal CK (2005) Cdc25B cooperates with Cdc25A to induce mitosis but has a unique role in activating cyclin B1-Cdk1 at the centrosome. J Cell Biol 171: 35–45. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Boutros R, Dozier C, Ducommun B (2006) The when and wheres of CDC25 phosphatases. Curr Opin Cell Biol 18: 185–191. [DOI] [PubMed] [Google Scholar]
- 27. Liu Y, Hock JM, Sullivan C, Fang G, Cox AJ, et al. (2010) Activation of the p38 MAPK/Akt/ERK1/2 signal pathways is required for the protein stabilization of CDC6 and cyclin D1 in low-dose arsenite-induced cell proliferation. J Cell Biochem 111: 1546–1555. [DOI] [PubMed] [Google Scholar]
- 28. Li X, Zhang YP, Kim HS, Bae KH, Stantz KM, et al. (2005) Gene therapy for prostate cancer by controlling adenovirus E1a and E4 gene expression with PSES enhancer. Cancer Res 65: 1941–1951. [DOI] [PubMed] [Google Scholar]
- 29. Sullivan C, Postlethwait JH, Lage CR, Millard PJ, Kim CH (2007) Evidence for evolving Toll-IL-1 receptor-containing adaptor molecule function in vertebrates. J Immunol 178: 4517–4527. [DOI] [PubMed] [Google Scholar]
- 30. Vigo E, Muller H, Prosperini E, Hateboer G, Cartwright P, et al. (1999) CDC25A phosphatase is a target of E2F and is required for efficient E2F-induced S phase. Mol Cell Biol 19: 6379–6395. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Boutros R, Lobjois V, Ducommun B (2007) CDC25 phosphatases in cancer cells: key players? Good targets? Nat Rev Cancer 7: 495–507. [DOI] [PubMed] [Google Scholar]
- 32. Chen X, Prywes R (1999) Serum-induced expression of the cdc25A gene by relief of E2F-mediated repression. Mol Cell Biol 19: 4695–4702. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Manning ET, Ikehara T, Ito T, Kadonaga JT, Kraus WL (2001) p300 forms a stable, template-committed complex with chromatin: role for the bromodomain. Mol Cell Biol 21: 3876–3887. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Jinno S, Suto K, Nagata A, Igarashi M, Kanaoka Y, et al. (1994) Cdc25A is a novel phosphatase functioning early in the cell cycle. EMBO J 13: 1549–1556. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. Rudolph J (2007) Inhibiting transient protein-protein interactions: lessons from the Cdc25 protein tyrosine phosphatases. Nat Rev Cancer 7: 202–211. [DOI] [PubMed] [Google Scholar]
- 36. Chen MS, Ryan CE, Piwnica-Worms H (2003) Chk1 kinase negatively regulates mitotic function of Cdc25A phosphatase through 14-3-3 binding. Mol Cell Biol 23: 7488–7497. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Loffler H, Syljuasen RG, Bartkova J, Worm J, Lukas J, et al. (2003) Distinct modes of deregulation of the proto-oncogenic Cdc25A phosphatase in human breast cancer cell lines. Oncogene 22: 8063–8071. [DOI] [PubMed] [Google Scholar]
- 38. McCain DF, Catrina IE, Hengge AC, Zhang ZY (2002) The catalytic mechanism of Cdc25A phosphatase. J Biol Chem 277: 11190–11200. [DOI] [PubMed] [Google Scholar]
- 39. Xu X, Burke SP (1996) Roles of active site residues and the NH2-terminal domain in the catalysis and substrate binding of human Cdc25. J Biol Chem 271: 5118–5124.8617791 [Google Scholar]
- 40. Kristjansdottir K, Rudolph J (2004) Cdc25 phosphatases and cancer. Chem Biol 11: 1043–1051. [DOI] [PubMed] [Google Scholar]
- 41. Laoukili J, Stahl M, Medema RH (2007) FoxM1: at the crossroads of ageing and cancer. Biochim Biophys Acta 1775: 92–102. [DOI] [PubMed] [Google Scholar]
- 42. Galaktionov K, Chen X, Beach D (1996) Cdc25 cell-cycle phosphatase as a target of c-myc. Nature 382: 511–517. [DOI] [PubMed] [Google Scholar]
- 43. Georges AB, Benayoun BA, Caburet S, Veitia RA (2010) Generic binding sites, generic DNA-binding domains: where does specific promoter recognition come from? FASEB J 24: 346–356. [DOI] [PubMed] [Google Scholar]
- 44. DeGregori J, Leone G, Miron A, Jakoi L, Nevins JR (1997) Distinct roles for E2F proteins in cell growth control and apoptosis. Proc Natl Acad Sci U S A 94: 7245–7250. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Chen YJ, Dominguez-Brauer C, Wang Z, Asara JM, Costa RH, et al. (2009) A conserved phosphorylation site within the forkhead domain of FoxM1B is required for its activation by cyclin-CDK1. J Biol Chem 284: 30695–30707. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Wierstra I, Alves J (2006) FOXM1c is activated by cyclin E/Cdk2, cyclin A/Cdk2, and cyclin A/Cdk1, but repressed by GSK-3alpha. Biochem Biophys Res Commun 348: 99–108. [DOI] [PubMed] [Google Scholar]
- 47. Wierstra I, Alves J (2006) Transcription factor FOXM1c is repressed by RB and activated by cyclin D1/Cdk4. Biol Chem 387: 949–962. [DOI] [PubMed] [Google Scholar]
- 48. Koff A, Cross F, Fisher A, Schumacher J, Leguellec K, et al. (1991) Human cyclin E, a new cyclin that interacts with two members of the CDC2 gene family. Cell 66: 1217–1228. [DOI] [PubMed] [Google Scholar]
- 49. Sheaff RJ, Groudine M, Gordon M, Roberts JM, Clurman BE (1997) Cyclin E-CDK2 is a regulator of p27Kip1. Genes Dev 11: 1464–1478. [DOI] [PubMed] [Google Scholar]
- 50. Bashir T, Pagano M (2005) Cdk1: the dominant sibling of Cdk2. Nat Cell Biol 7: 779–781. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.