Elovl5 regulates the mTORC2-Akt-FOXO1 pathway by controlling hepatic cis-vaccenic acid synthesis in diet-induced obese mice

Abstract

Elevated hepatic expression of fatty acid elongase-5 (Elovl5) induces FoxO1 phosphorylation, lowers FoxO1 nuclear content, and suppresses expression of genes involved in gluconeogenesis (GNG). In this report, we define the molecular and metabolic basis of Elovl5 control of FoxO1 phosphorylation. Adenoviral-mediated (Ad-Elovl5) induction of hepatic Elovl5 in diet-induced obese, glucose-intolerant mice and HepG2 cells increased the phosphorylation of Akt2-S⁴⁷³ [mammalian target of rapamycin complex-2 (mTORC2) site], but not Akt2-T³⁰⁸ (PDK1 site). The Akt2 inhibitor Akti1/2 blocked Elovl5 induction of FoxO1-S²⁵⁶ phosphorylation in HepG2 cells. Elevated Elovl5 activity in liver and HepG2 cells induced rictor mRNA, rictor protein, and rictor-mTOR interaction, whereas rictor knockdown (siRNA) attenuated Elovl5 induction of Akt2-S⁴⁷³ and FoxO1-S²⁵⁶ phosphorylation in HepG2 cells. FA analysis revealed that the abundance of cis-vaccenic acid (18:1,n-7) was increased in livers of obese mice and HepG2 cells following Ad-Elovl5 infection. Treating HepG2 cells with Elovl5 substrates established that palmitoleic acid (16:1,n-7), but not γ-linolenic acid (18:3,n-6), induced rictor protein, Akt-S⁴⁷³, and FoxO1-S²⁵⁶ phosphorylation. Inhibition of FA elongation blocked 16:1,n-7 but not 18:1,n-7 induction of rictor protein and Akt-S⁴⁷³ and FoxO1-S²⁵⁶ phosphorylation. These results establish a novel link between Elovl5-mediated synthesis of 18:1,n-7 and GNG through the control of the mTORC2-Akt-FoxO1 pathway.

Recent studies suggest that fatty acid elongase-5 (Elovl5) plays a key role in regulating hepatic lipid and carbohydrate metabolism (1–3). Elovl5 elongates γ-linolenic acid (18:3,n-6) to form dihomo-γ-linolenic acid (20:3,n-6); this FA is converted to arachidonic acid (20:4,n-6) by FA desaturase 1 (FADS1). Elovl5 also elongates certain monounsaturated FAs, like palmitoleic acid (16:1,n-7), to form cis-vaccenic acid (18:1, n-7). Elovl5 does not elongate saturated FAs (4–6).

Hepatic expression of Elovl5 is regulated during postnatal development and by diet. High-fat, low-carbohydrate diets and diets enriched in C_20–22 n-3 PUFA suppress hepatic Elovl5 expression and activity (2, 4). In a mouse model of diet-induced obesity and glucose intolerance, low hepatic Elovl5 activity correlated with low hepatic and plasma levels of n-7 MUFA and arachidonic acid (2). The physiological significance of this change in hepatic Elovl5 activity and unsaturated FA content was revealed when a recombinant adenoviral approach was used to restore hepatic Elovl5 activity in livers of diet-induced obese, glucose-intolerant mice. This treatment increased hepatic and plasma content of 18:1,n-7 and several C_20–22 PUFAs. This treatment also reduced diet-induced insulin resistance, improved glucose tolerance, and lowered fasting blood glucose to euglycemic levels (2). This apparent insulin-mimetic effect of Elovl5 on hepatic glucose metabolism was linked to increased phosphorylation of Akt-S⁴⁷³, FoxO1-S²⁵⁶, and PP2Acat-Y³⁰⁷, decreased nuclear content of FoxO1, and decreased expression of phosphoenolpyruvate carboxykinase (Pck1) and glucose 6-phosphatase (G6Pc) (2). Pck1 and G6Pc are important enzymes involved in gluconeogenesis (GNG) and hepatic glucose production.

Phosphorylated FoxO1 is excluded from nuclei, ubiquitinated, and degraded in the proteasome. Loss of nuclear FoxO1 lowers the expression of key genes involved in GNG, i.e., Pck1 and G6Pc (2, 7–10). Akt2 is the most-abundant Akt isoform in rodent and human liver and other insulin-sensitive cells. Akt2 is a key regulator of hepatic FoxO1 (11–14) and plays an important role in type 2 diabetes mellitus and insulin resistance (11, 15). Akt is phosphorylated at two sites, T³⁰⁸ and S⁴⁷³ (16, 17). The Akt2-T³⁰⁸ site is phosphorylated by the insulin-regulated PI3 kinase-PDK1 pathway, whereas the Akt2-S⁴⁷³ site is phosphorylated by several kinases, including mammalian target of rapamycin complex 2 (mTORC2), integrin-linked kinase, MAP kinase-activated protein kinase-2, p38 MAP kinase, protein kinase C, NIMA-related kinase-6, double-stranded DNA-dependent protein kinase, and ataxia telangiectasia-mutated gene products (18–24). Recently, mTORC2 was identified as a key regulator of Akt-S⁴⁷³ and FoxO1 phosphorylation, establishing a link between the mTOR pathway and GNG (25–27). In addition to phosphorylation and ubiquitination, acetylation and covalent attachment of β-N-acetyl-glucosamine regulate FoxO1 function (7, 28, 29).

Although our earlier studies suggested a possible role of Elovl5 in the control of Akt, FoxO1, and GNG, those studies did not establish the metabolic or molecular mechanisms for this Elovl5-mediated regulatory scheme (2). In this report, we extend our previous study by establishing the requirement for Akt and FoxO1 phosphorylation in the Elovl5 control of FoxO1 and its target genes. We also identify mTORC2 as a major target of Elovl5 control and establish that cis-vaccenic acid (18:1,n-7), a product of Elovl5 activity, is a mediator of the mTORC2-Akt-FoxO1 pathway.

MATERIALS AND METHODS

Materials

DMEM with high glucose (25 mM) and antibiotics for cell culture was obtained from Invitrogen (Grand Island, NY). Hyclone fetal calf serum was purchased from Thermo-Fisher Scientific. Akti1/2, PP242, and rapamycin were purchased from EMD Calbiochem (Philadelphia, PA). Human rictor siRNA and control siRNA were obtained from Cell Signaling (Danvers, MA). X-tremeGENE siRNA transfection reagent was purchased from Roche Applied Science (Indianapolis, IN). Antibodies against rictor, phospho-rictor T¹¹³⁵, raptor, GβL, p70S6-kinase, phospho-p70S6 kinase T³⁸⁹, mTOR, phospho-mTOR S²⁴⁴⁸, FoxO1, phospho-FoxO1S²⁵⁶, GSK3β, phospho-GSK3α/β S²¹/S⁹, rictor sepharose bead conjugate, raptor sepharose bead conjugate, and IgG control sepharose bead conjugate were obtained from Cell Signaling (Danvers, MA). Antibodies against Akt2, phospho-Akt1/2/3 T³⁰⁸, phospho-Akt1/2/3-S⁴⁷³, phospho-GSK3β Y²¹⁶, and Na,K-ATPase were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). The antibody against TATA-binding protein (TBP) was obtained from Abcam (Cambridge, MA). The mSIN1 antibody was purchased from Millipore (Billerica, MA). The secondary antibodies, IRDye 680 and IRDye 800 (anti-mouse, anti-rabbit, and anti-goat) were obtained from LiCor, Inc., Lincoln, NE.

Recombinant adenovirus

The source, construction, purification, titration, and use of the recombinant adenovirus expressing luciferase (Ad-Luc) and Elovl5 (Ad-Elovl5) were described previously (2, 4). Adenovirus expressing a form of FoxO1 that is resistant to phosphorylation control (Ad-ADA-FoxO1) was a generous gift from Dr. D. Accili (Columbia University Medical center, NY) (29).

Mouse liver extracts

The mouse hepatic protein extracts from whole liver, nuclei, or cytosol used in this study were obtained from the lean and obese-glucose intolerant C57BL/6J mice described previously (2). Briefly, male C57BL/6J mice were fed a low-fat diet (10% calories as fat; Research Diets, D12450B) or a high-fat diet (60% calories as fat; Research Diets, D12492) for 12 weeks. After 12 weeks on these diets, mice fed the low-fat diet were lean and euglycemic, whereas mice fed the high-fat diet were obese, hyperglycemic, and insulin resistant. Five days prior to termination of the experiment, mice were infected with Ad-Luc or Ad-Elovl5. Five days later, mice were fasted overnight; half of the fasted mice were refed their diets for 4 h. Fasted and refed mice were euthanized at 8 AM and 12 noon for the recovery of blood and liver. Methods for liver recovery and preparation of protein extracts were described in our earlier report (2).

HepG2 Cells

Human hepatoma (HepG2) cells were obtained from American Type Culture Collection (Manassas, VA) and grown in DMEM with 25 mM glucose; media was supplemented with 10% fetal calf serum. All experiments were carried out in cells grown on 6-well or 12-well plates (Corning Life Sciences; Corning, NY) in a humidified incubator at 37°C and 5% CO₂. HepG2 cells were infected with recombinant adenovirus expressing either a control virus (Ad-Luc) or test viruses (Ad-Elovl5, Ad-ADA-FoxO1) at 20 infectious units (IU) per cell. In all HepG2 cell experiments, proteins were extracted as whole-cell extract.

Immunoblotting

Proteins were extracted from mouse liver and HepG2 cells as described previously (1, 2) in the presence of protease (Roche Applied Science) and phosphatase inhibitors (1 mM β-glycerol phosphate, 2.5 mM Na-pyrophosphate, 1 mM Na₃VO4). Cytosolic (post-nuclear), nuclear protein fractions and whole-cell protein extracts were separated electrophoretically by SDS-PAGE (NuPAGE, 4–12% polyacrylamide Bis-Tris; Invitrogen) and transferred to nitrocellulose (BA83) membranes. Blots were incubated with primary antibodies against various proteins overnight at 4°C. The following day, blots were washed and incubated with secondary antibody for 1 h at room temperature. Antigen-antibody reactions were detected and quantified using LiCor Odyssey scanner and software (1, 2).

RNA extraction and quantitative real time polymerase chain reaction

Total RNA was extracted from mouse liver of our earlier study (2) and HepG2 cells using Triazol (Invitrogen). Transcript levels were measured by qRT-PCR. Gene-specific primers are listed in Table 1. Primer design and qRT-PCR methods were described previously (2). Cyclophilin was used as a control gene. Levels of target gene mRNA abundance were normalized to the abundance of cyclophilin mRNA.

TABLE 1.

Primers for qRT-PCR

	Accession number	Forward	Backward	Species
Elovl5	NM_134382.1	TACCACCATGCCACTATGCT	GACGTGGATGAAGCTGTTGA	Rat
Pck1	NM_002591.3	GGTTCCCAGGGTGCATGAAA	CACGTAGGGTGAATCCGTCAG	Human
G6Pc	NM_138387.3	ATGAGTCTGGTTACTACAGCCA	AAGACAGGGCCGTCATTATGG	Human
mTOR	NM_004958.3	TCTACCACGACAGCCCGGCA	TGGGGGCCCCGTTCCATCAT	Human
Rictor	NM_152756.3	GTCCCGCTGGATCTGACCCGA	GAAGCGCTCGTAGCCCTGCTG	Human
Raptor	NM_020761.2	CGCTTCTGCTGACGGCCACA	TCGCGTCGTTGGCAGCATGT	Human
mTOR	NM_020009.2	CGGGCCTCATTGGCTGGGTG	AACGGCCAGGGAGCGGGTAT	Mouse
Rictor	NM_030168.3	ACCCGGCAGTATGTGCGAGC	ACCTGCCCACGAGCGGAATG	Mouse
Raptor	NM_028898.2	CTGGGCCTTGGCAATATGGCGT	ACTCGCCTGAGGGGCTGCAA	Mouse
Cyclophilin	NM_008907.1	CTTCTTGCTGGTCTTGCCATTCCT	GGATGGCAAGCATGTGGTCTTTG	Mouse
Cyclophilin	NM_021130.3	AAGACTGAGTGGTTGGATGG	CGAGAGCACAAAGATTCTAGG	Human

Rictor knockdown

Knockdown of rictor protein in HepG2 cells used an siRNA approach. HepG2 cells were grown in 12-well plates to ∼30–50% confluence; cells were transfected with either siRNA rictor or control siRNA (scrambled RNA) at 100 pmol/well plus 2 μl/well of the X-tremeGENE siRNA transfection reagent according to the manufacturer's recommendations. Cells were also infected with either Ad-Luc or Ad-Elovl5 (20 IU/cell). Cells were maintained in DMEM + FBS for 72 h before harvest for protein analysis.

Immunoprecipitation

Mouse liver extracts (1 mg protein/ml) were incubated with 10 μl of antibody-conjugated sepharose beads. The antibodies conjugated to sepharose beads were against rictor or raptor; IgG served as a control. Extracts were incubated with antibody sepharose beads overnight at 4°C. The following day, the beads were centrifuged at 14,000 g for 30 s at 4°C. The immunoprecipitates were collected and washed with cell lysis buffer five times. The beads were resuspended with protein denaturing buffer containing SDS, boiled, and centrifuged; the supernatants were applied to SDS-PAGE gels for electrophoresis. Specific proteins were detected by immunoblotting as described above.

Lipid extraction and FA analysis

Total lipids from liver and HepG2 cells were extracted, saponified, methylated, and quantified by gas chromatography as described previously (2, 30).

Statistical analysis

The statistical analyses performed in this study included ANOVA plus post hoc Tukey test and Student's t-test by using the statistical software StatView. P < 0.05 was considered statistically different. Data are expressed as mean ± SD.

RESULTS

Elovl5 regulates Akt2 and FoxO1 phosphorylation in mouse liver and human hepatoma (HepG2) cells

Hepatic Elovl5 activity in obese glucose-intolerant mice is ∼60–75% below levels in livers of lean glucose-tolerant mice. Infection of obese mice with Ad-Elovl5 increases Elovl5 activity ∼3-fold; to a level ∼50% above the level expressed in livers of lean mice. Increased hepatic Elovl5 activity correlated with increased Akt2 and FoxO1 phosphorylation, decreased hepatic Pck1 expression, and restoration of euglycemia (2). When compared with Ad-Luc-infected mice, elevated Elovl5 activity (Ad-Elovl5 infection) significantly increased Akt2-S⁴⁷³ and FoxO1-S²⁵⁶ phosphorylation, but not Akt-T³⁰⁸ phosphorylation, in livers of fasted obese-glucose intolerant mice (Fig. 1A, B). Infection of HepG2 cells with Ad-Elovl5 increased Elovl5 protein ∼2-fold (30), and increased Akt2-S⁴⁷³ and FoxO1-S²⁵⁶, but not Akt2-T³⁰⁸, phosphorylation (Fig. 1C, D). Thus, Elovl5 regulates Akt activity by selectively phosphorylating Akt-S⁴⁷³ in mouse liver and HepG2 cells.

Fig. 1.

Elovl5 regulates the phosphorylation of Akt and FoxO1 in mouse liver and HepG2 cells. A, B : Mouse liver extracts from fasted obese glucose-intolerant mice infected with either Ad-Luc or Ad-Elovl5 were prepared and examined for total and phosphoprotein abundance as described previously (2). A: Representative immunoblots, n = three mice per treatment. B: Quantified levels of protein phosphorylation for Akt2-S⁴⁷³, Akt2-T³⁰⁸, and FoxO1-S²⁵⁶. Results are from two separate studies and are expressed as mean ± SD, n = 6. * P ≤ 0.05 versus Ad-Luc. Phosphorylation status is based on the ratio of phosphoprotein divided by total protein as quantified by immunoblot and Licor Odyssey software. C, D: HepG2 cells infected with Ad-Luc or Ad-Elovl5 for 48 h were serum starved overnight. The next day, cells were harvested to prepare total cell extracts and quantify levels of total and phospho-Akt and FoxO1. C: Representative immunoblots for total and phospho-Akt2-S⁴⁷³, Akt2-T³⁰⁸, and FoxO1-S²⁵⁶. D: Phosphorylation status was quantified as above. Results are representative of three separate studies; results are expressed as mean ± SD, n = 3. * P ≤ 0.05 versus Ad-Luc.

ADA-FoxO1 overrides Elovl5 suppression of GNG genes in HepG2 cells

To determine whether Elovl5 effects on the expression of gluconeogenic enzymes (i.e., Pck1 and G6Pc) required FoxO1 phosphorylation, HepG2 cells were infected with Ad-Luc or Ad-Elovl5 in the absence and presence of Ad-ADA-FoxO1. Ad-ADA-FoxO1 expresses a form of FoxO1 that is insensitive to phosphorylation control (29). Infection of HepG2 cells with Ad-Elovl5 significantly decreased Pck1 and G6Pc mRNA abundance by >70% and ∼50% (P < 0.05), respectively (Fig. 2). Including Ad-ADA-FoxO1 in the infection scheme induced Pck1 and G6Pc mRNA and completely abolished Elovl5 regulation of Pck1 and G6Pc mRNA abundance. Thus, Elovl5 control of Pck1 and G6Pc expression in HepG2 cells requires increased FoxO1 phosphorylation.

Fig. 2.

Overexpressed ADA-FoxO1 abrogates Elovl5 suppression of Pck1 and G6Pc in HepG2 cells. HepG2 cells were infected with Ad-Luc (control virus) and Ad-Elovl5 in the absence and presence of Ad-ADA-FoxO1 for 48 h. ADA-FoxO1 is insensitive to phosphorylation control (29). As in Fig. 1, cells were serum starved overnight and harvested the following day for RNA extraction and quantitation of Pck1 (A), G6Pc (B), and cyclophilin mRNA by qRT-PCR. Results are representative of three separate studies; results are expressed as mean ± SD, n = 3. * P ≤ 0.05 versus Ad-Luc; # P ≤ 0.05 versus no Ad-ADA-FoxO1 (None).

Elovl5 control of FoxO1-S²⁵⁶ phosphorylation requires Akt2

To determine whether active Akt2 was required for Elovl5 control of FoxO1-S²⁵⁶ phosphorylation, HepG2 cells were first infected with Ad-Luc or Ad-Elovl5 and then treated with vehicle or the Akt1/2 inhibitor (Akti1/2, at 3 μM) (31). Infection of HepG2 cells with Ad-Elovl5 significantly increased (≥50%, P < 0.05) the phosphorylation of Akt2-S⁴⁷³ and FoxO1-S²⁵⁶. Akti1/2 essentially blocked the Elovl5-mediated increase in Akt2-S⁴⁷³ and FoxO1-S²⁵⁶ phosphorylation (Fig. 3A–C). Thus, active Akt2 is required for Elovl5 control of FoxO1-S²⁵⁶ phosphorylation. Akti1/2 did not affect the phosphorylation of Akt2-T³⁰⁸.

Fig. 3.

Akt activity is required for Elovl5 control of FoxO1-S²⁵⁶ phosphorylation in HepG2 cells. HepG2 cells were infected with Ad-Luc or Ad-Elovl5 for 48 h and starved overnight as described above in Figs. 1 and 2. Cells were treated with vehicle (DMSO) or the Akt1/2 inhibitor (Akti1/2, 3 μM) for 30 min. Proteins were extracted, and protein abundance of Akt2, phospho-Akt1/2/3-S⁴⁷³, FoxO1, and phospho-FoxO1-S²⁵⁶ was measured. A: Representative immunoblots, n = 3 per treatment. B: Phosphorylation status of Akt2-S⁴⁷³. C: Phosphorylation status of FoxO1-S²⁵⁶. Results are representative of three separate studies and are expressed as mean ± SD, n = 3. * P ≤ 0.05 versus Ad-Luc; # P ≤ 0.05 versus vehicle.

The mTORC2 pathway is required for Elovl5 control of Akt2-S⁴⁷³ and FoxO1-S²⁵⁶ phosphorylation in mouse liver and HepG2 cells

Whereas Akt2-S⁴⁷³ is phosphorylated by mTORC2, the Akt2-T³⁰⁸ site is phosphorylated by PI3-kinase-PDK1 (23, 32–34). We assessed the role that mTORC2 played in Elovl5-mediated control of Akt2-S⁴⁷³ phosphorylation. We first examined the impact of diet and Elovl5 activity on the mammalian target of rapamycin complex-1 (mTORC1) and the mammalian target of rapamycin complex-2 (mTORC2) components, namely raptor, rictor, and mTOR (Fig. 4). Elevated Elovl5 activity increased rictor and mTOR mRNA in both lean and obese mice ≥2-fold (P < 0.05). Interestingly, raptor mRNA abundance was suppressed by ∼70% in livers of obese mice; elevated Elovl5 activity further decreased raptor mRNA. Similar effects were seen in HepG2 cells (Fig. 4B); increased Elovl5 expression induced rictor and mTOR, but suppressed raptor mRNA abundance.

Fig. 4.

Elovl5 regulates rictor and mTOR mRNA abundance in mouse liver and HepG2 cells. A: RNA was extracted from livers of lean and obese mice (Materials and Methods; Fig. 1A) and HepG2 cells (B). mRNA abundance was measured by qRT-PCR using the primers for rictor, raptor, mTOR, and cyclophilin (Table 1). Cyclophilin was used as a housekeeping gene. A: mRNA abundance in livers of lean and obese mice infected with either Ad-Luc or Ad-Elovl5. Results are expressed as fold change, relative to the abundance of the mRNA in liver of lean Ad-Luc-infected mice. Results are from two separate studies and are expressed as the mean ± SD, n = 6. B: mRNA abundance in HepG2 cells infected with either Ad-Luc or Ad-Elovl5. Results are expressed as fold change, relative to the abundance of the mRNA in cells infected with Ad-Luc. Results are representative of three separate studies; results are expressed as mean ± SD, n = 3. * P ≤ 0.05 versus Ad-Luc.

To determine whether these changes in mRNA correlated with changes in protein and mTOR phosphorylation, hepatic extracts from lean and obese mice infected with either Ad-Luc or Ad-Elovl5 (2) were quantified by immunoblotting (Fig. 5). Elevated hepatic Elovl5 activity did not significantly increase hepatic mTOR protein abundance (Fig. 5A), an effect that did not correlate with the changes in mTOR mRNA (Fig. 4). Instead, elevated Elovl5 expression significantly increased phosphorylation of mTOR-S²⁴⁴⁸ in obese but not in lean mice (Fig. 5A, B). Phosphorylated mTOR-S²⁴⁴⁸ is an active kinase (23, 35). The mTORC2-associated regulatory protein, rictor, was significantly induced by increased Elovl5 activity in both lean and obese mice (Fig. 5C), an effect that correlated with Ad-Elovl5-mediated increase in rictor mRNA (Fig. 4). Whereas the high-fat diet significantly suppressed hepatic raptor protein abundance, elevated Elovl5 activity had no further effect on hepatic raptor content (Fig. 5A, D). Neither diet nor changes in Elovl5 activity significantly affected hepatic abundance of other mTOR-associated proteins, mSIN1 and GβL (Fig. 5A).

Fig. 5.

Diet and Elovl5 regulate mTOR, rictor, and raptor protein abundance in mouse liver. C57BL/6J mice were fed a low-fat diet (10% calories as fat; lean) or a high-fat diet (60% calories as fat; obese) for 12 weeks. Mice were infected with Ad-Luc or Ad-Elovl5 5 days prior to termination of the experiment. Five days after infection, mice were fasted overnight and euthanized the following day (Materials and Methods) (2). Hepatic protein extracts were assayed for protein levels of mTOR, mTOR-S²⁴⁴⁸ phosphorylation, rictor, raptor, mSin1, GβL, and Na,K-ATPase. A: Representative immunoblots (n = 3) separate mouse liver extracts per treatment. B: Phosphorylation status of mTOR-S²⁴⁴⁸; hepatic protein abundance of rictor (C) and raptor (D). Results are from two separate studies and are expressed as mean ± SD, n = 6. * P ≤ 0.05 versus lean Ad-Luc; # P ≤ 0.05 versus obese Ad-Luc.

mTOR is the catalytic (kinase) subunit for both mTORC1 and mTORC2 (36, 37). Raptor and rictor play key roles in complex assembly and substrate selection for mTOR kinase (23, 33). The observed increase in rictor protein abundance with Elovl5 overexpression may facilitate rictor-mTOR interaction. To test this possibility, immunoprecipitation and immunoblotting were used to examine the impact of Elovl5 on mTOR interaction with rictor and raptor (Fig. 6). Extracts from diet-induced obese mice infected with Ad-Luc or Ad-Elovl5 were treated with antibodies against rictor (rictor-IP) or raptor (raptor-IP); IgG served as a control for nonspecific immunoprecipitation. The immunoprecipitates were collected, denatured, electrophoresed, immunoblotted, and assayed for the presence of rictor, raptor, and mTOR. The rictor sepharose bead-conjugated antibody pulled down both rictor and mTOR. Elevated Elovl5 activity increased the immunoprecipitation of both mTOR and rictor. Elovl5 not only increased hepatic levels of rictor protein, Elovl5 promoted the physical interaction of rictor with mTOR. In contrast, raptor sepharose bead-conjugated antibody did not pull down raptor or mTOR. The low level of raptor in these hepatic extracts probably explains this result.

Fig. 6.

Elovl5 induces rictor-mTOR interaction in livers of obese mice. Hepatic extracts from obese C57BL/6J mice infected with Ad-Luc or Ad-Elovl5 were treated with antibodies against rictor and raptor (Materials and Methods). IgG was used as a control for nonspecific immunoprecipitation. Immunoprecipitates (IP) were collected and proteins separated for immunoblotting (IB) with antibodies against mTOR, rictor, and raptor. The immunoblot data are from hepatic extracts from three separate mice infected with either Ad-Luc or Ad-Elovl5 and are representative of two separate studies.

Rictor knockdown (siRNA) attenuates Elovl5-mediated induction of Akt2-S⁴⁷³ and FoxO1-S²⁵⁶ phosphorylation

To verify the role of rictor in Elovl5 control of Akt2 and FoxO1, siRNA was used to knock down rictor. Transfection of HepG2 cells with rictor siRNA significantly decreased rictor protein abundance and mTOR-S²⁴⁴⁸ phosphorylation (∼50%; P < 0.05) (Fig. 7A–C). Increased Elovl5 expression in HepG2 cells significantly induced Akt2-S⁴⁷³ and FoxO1-S²⁵⁶ phosphorylation by 6- and 3-fold (P < 0.05), respectively (Fig. 7D, E). Rictor knockdown, however, attenuated this response by ∼50% (Fig. 7D, E). Rictor knockdown had no impact on Akt2-T³⁰⁸ phosphorylation (data not shown). Thus, Elovl5 regulation of rictor protein abundance is required for Elovl5 to induce Akt2-S⁴⁷³ and FoxO1-S²⁵⁶ phosphorylation.

Fig. 7.

siRNA knockdown of rictor attenuates Elovl5 control of Akt2-S⁴⁷³ and FoxO1-S²⁵⁶ phosphorylation in HepG2 cells. HepG2 cells were infected with either Ad-Luc or Ad-Elovl5. Both groups of cells received no siRNA (None), scrambled siRNA, or siRNA-Rictor. After 72 h, cells were serum starved overnight and harvested the following day for protein extraction and immunoblotting. Levels of rictor, Akt2, phospho-Akt1/2/3-S⁴⁷³, FoxO1, phospho-FoxO1-S²⁵⁶, mTOR, and phospho-mTOR-S²⁴⁴⁸ and TBP (loading control) were measured as described above. A: Representative immunoblots, two extracts per treatment. B: Rictor protein abundance. C–E: Phosphorylation status of mTOR-S²⁴⁴⁸, Akt2-S⁴⁷³, and FoxO1-S²⁵⁶. Results are representative of three separate studies and are expressed as mean ± SD, n = 3. * P ≤ 0.05 versus Ad-Luc; # P ≤ 0.05 versus Ad-Luc + scrambled siRNA.

Further verification of the involvement of rictor in mTORC2 in this regulatory scheme evaluated the impact of rapamycin (a selective chemical inhibitor for mTORC1) and PP242 (a dual chemical inhibitor for mTORC1 and mTORC2). Treatment of HepG2 with rapamycin lowered the phosphorylation of mTOR and p70S6K, a target of mTOR, but did not block the Ad-Elovl5-mediated increase in Akt2-S⁴⁷³ or FoxO1-S²⁵⁶ phosphorylation (see supplementary Fig. IA–D). In contrast, PP242 suppressed mTOR and p70S6K phosphorylation and blocked the Elovl5-stimulated increase in Akt2-S⁴⁷³ and FoxO1-S²⁵⁶ phosphorylation (see supplementary Fig. IIA–D). Taken together with the siRNA studies (Fig. 7), these studies support the notion that increasing hepatic (or HepG2) Elovl5 activity induces rictor protein, mTOR-rictor interaction, and the phosphorylation of both Akt-S⁴⁷³ and FoxO1-S²⁵⁶. The consequence of this pathway is the suppression of expression of genes involved in GNG.

Changes in rictor phosphorylation regulate rictor activity (38–41). Gsk3β, a downstream target of Akt, is one kinase that phosphorylates rictor. Gsk3β activity is regulated by phosphorylation; and phosphorylation of Gsk3β-S⁹ (an Akt site) inhibits Gsk3β activity (1), whereas phosphorylation of Gsk3β-Y²¹⁶ induces Gsk3β activity (38). Active Gsk3β (phospho-Gsk3β-Y²¹⁶) phosphorylates rictor-S¹²³⁵, a modification that interferes with rictor binding to Akt and ultimately reduces mTORC2-mediated Akt-S⁴⁷³ phosphorylation (38). Although no antibody against phospho-rictor-S¹²³⁵ is currently commercially available, we show that Elovl5 induces Gsk3β-S⁹ but not Gsk3β-Y²¹⁶ phosphorylation or rictor-T¹¹³⁵ phosphorylation (see supplementary Fig. IIIA–D). These results suggest that Elovl5 activity regulates mTORC2 by inducing rictor protein and not by regulating rictor phosphorylation through Gsk3β.

Elovl5 effects on FA composition in livers of obese glucose-intolerant mice and HepG2 cells

Elovl5 elongates specific C_16–20 MUFAs and PUFAs (1, 4, 5), including palmitoleic acid (16:1,n-7), linoleic acid (18:2,n-6), γ-linolenic acid (18:3,n-6), arachidonic acid (20:4,n-6) and n-3 PUFA, stearidonic acid (18:4,n-3) and eicosapentaenoic acid (20:5,n-3). The corresponding Elovl5 elongation products are 18:1,n-7 (cis-vaccenic acid), 11, 14-eicosadienoic acid (20:2,n-6) and dihomo-γ-linolenic acid (20:3,n-6), adrenic acid (22:4,n-6), 8, 11, 14, 17-eicosatetraenoic acid (20:4,n-3) and docosapentaenoic acid (22:5,n-3), respectively (2, 4, 5). The hepatic FA composition in lean and obese mice was previously reported (2). Herein, we focus on the relative abundance of major Elovl5 substrates (16:1,n-7, 18:2,n-6, and 18:3,n-6) and products (18:1,n-7, 20:2,n-6, and 20:3,n-6) in liver and HepG2 cells.

The mol% of two n-7 MUFAs, i.e., 16:1,n-7 and 18:1n-7, decreased significantly (>50%, P ≤ 0.05) in livers of Ad-Luc-infected obese mice, when compared with Ad-Luc-infected lean mice (Fig. 8A). The mol% of 18:2,n-6 was 15.3 ± 2.9, 11.9 ± 1.3, 20.9 ± 1.9, and 19.7 ± 0.6 in lean, Ad-Luc; lean, Ad-Elovl5; obese, Ad-Luc; and obese Ad-Elovl5 mice, respectively. Thus, hepatic 18:2,n-6 content increases with obesity. Ad-Elovl5 infection resulted in a ≥50% (P ≤ 0.05) increase in 20:2,n-6 and 20:3,n-6 in lean and obese mice. (Fig. 8B).

Fig. 8.

Elovl5 regulates FA composition in livers of obese glucose-intolerant mice and HepG2 cells. Lipids were extracted and FA analysis was performed on livers of lean and obese mice (Materials and Methods) and HepG2 cells. A: n-7 MUFAs from livers of lean and obese mice infected with either Ad-Luc or Ad-Elovl5 are expressed as FA mol%. B: n-6 PUFAs from livers of lean and obese mice infected with either Ad-Luc or Ad-Elovl5 are expressed as FA mol%. C: The mole ratio of 18:1,n-7/16:1,n-7 and 20:3,n6/18:3,n6 in livers of lean and obese mice infected with either Ad-Luc or Ad-Elovl5. D: Ratio of FA pairs in HepG2 cells infected with Ad-Luc or Ad-Elovl5. Results are expressed as mean ± SD, n = 3. * P ≤ 0.05 versus Ad-Luc.

The ratio of 18:1,n-7 to 16:1,n-7 was significantly increased (2.5-fold, P < 0.05) in obese mice infected with Elovl5, whereas the ratio of 20:3,n-6 to 18:3,n-6 was significantly increased (≥2-fold, P ≤ 0.05) in both lean and obese mice infected with Ad-Elovl5 (Fig. 8C). Elevated Elovl5 activity increased hepatic levels of both 18:1,n-7 and 20:3,n-6. The hepatic ratio of 20:2,n-6 to 18:2,n-6 was very low (<0.1); elevated Elovl5 activity increased this ratio ∼2-fold (not shown). Thus, changes in Elovl5 activity regulate hepatic abundance of both n-7 and n-6 PUFAs.

To determine whether similar changes occur in HepG2 cells infected with Ad-Elovl5, we examined the FA profile of HepG2 cells infected with Ad-Luc or Ad-Elovl5. The FA profiles of HepG2 cells and the medium used to grow cells are shown in supplementary Fig. IV. Although these cells contain 16:1,n-7 and 18:2,n-6, cellular levels of 18:3,n-6 are very low because of low 18:2,n-6 and low FADS2 expression (30). Elevated Elovl5 activity significantly increased (∼40%, P < 0.05) the 18:1,n-7/16:1,n-7 ratio, but had no effect on other FA ratios (Fig. 8D). This effect of Ad-Elovl5 infection of HepG2 cells correlated with the increase in 18:1,n-7 production in liver of Ad-Elovl5-infected mice (Fig. 8C).

Effects of Elovl5 mediated MUFA and PUFA elongation on Akt-S⁴⁷³ and FoxO1-S²⁵⁶ phosphorylation in HepG2 cells

To determine whether changes in MUFA or PUFA content were required for Elovl5 induction of rictor in HepG2 cells, cells were infected with Ad-Luc or Ad-Elovl5 and treated with either no FA, 16:1,n-7, or 18:3,n-6 at 50 μM for 48 h (Fig. 9). Rictor protein was increased ≥30% (P < 0.05) in all cells infected with Ad-Elovl5. Addition of 16:1,n-7 but not 18:3,n-6 to the media augmented this response to ∼50% (P < 0.05). Although Elovl5 induced Akt-S⁴⁷³ and FoxO1-S²⁵⁶ in all treatments, only 16:1,n-7 treatment induced the phosphorylation of Akt and FoxO1 in the absence of elevated Elovl5 activity.

Fig. 9.

Effects of Elovl5-mediated 16:1,n-7 and 18:3,n-6 elongation on Akt-S⁴⁷³ and FoxO1-S²⁵⁶ phosphorylation in HepG2 cells. HepG2 cells were infected with either Ad-Luc or Ad-Elovl5. Both groups of cells received vehicle (ethanol), 16:1,n-7, or 18:3,n-6 at 50 μM for 48 h. After treatment, cells were harvested for protein extraction, and immunoblotting analysis was performed. Levels of rictor, Na,K-ATPase (loading control), Akt2, phospho-Akt1/2/3-S⁴⁷³, FoxO1, and phospho-FoxO1-S²⁵⁶ were measured as described above. A: Representative immunoblots, 1 extract per treatment. B: Rictor protein abundance. C, D: phosphorylation status of Akt2-S⁴⁷³ and FoxO1-S²⁵⁶. Results are representative of three separate studies. Results are expressed as mean ± SD, n = 3. * P ≤ 0.05 versus Ad-Luc + vehicle.

We next examined other MUFAs for their control of Akt and FoxO1 phosphorylation. HepG2 cells were not infected with either Ad-Luc or Ad-Elovl5, but instead were treated with 14:1,n-5, 16:1,n-7, 18:1,n-7, or 18:1,n-9 at 50 μM for 48 h. Of these, only 16:1,n-7 and 18:1,n-7 induced Akt-S⁴⁷³ and FoxO1-S²⁵⁶ phosphorylation (Fig. 10). We also examined several C_18–22 n-3 and n-6 PUFAs and found no effect of these FAs on Akt or FoxO1 phosphorylation (data not shown).

Fig. 10.

Effects of various MUFAs on Akt-S⁴⁷³ and FoxO1-S²⁵⁶ phosphorylation in HepG2 cells. HepG2 cells were treated with vehicle (ethanol), 14:1,n-5, 16:1,n-7, 18:1,n-7, or 18:1,n-9 at 50 μM for 48 h. After treatment, cells were harvested for protein extraction and immunoblotting analysis as described above. Levels of Akt2, phospho-Akt1/2/3-S⁴⁷³, FoxO1, and phospho-FoxO1-S²⁵⁶ were measured. A: Representative immunoblots, 1 extract per treatment. B, C: Phosphorylation status of Akt2-S⁴⁷³ and FoxO1-S²⁵⁶. Results are representative of three separate studies and are expressed as mean ± SD, n = 3. * P ≤ 0.05 versus vehicle.

The time course for the 16:1,n-7 and 18:1,n-7 effects on rictor protein, Akt, and FoxO1 phosphorylation showed (Fig. 11) that rictor protein was induced 2-fold (P ≤ 0.05) within 24 h of initiating treatment and 4-fold after 48 h of FA treatment. The induction of Akt-S⁴⁷³ and FoxO1-S²⁵⁶ phosphorylation required a minimum of 24 h to reach a significant difference from untreated cells. FoxO1-S²⁵⁶ phosphorylation appears more responsive to 18:1,n-7 than 16:1,n-7 (Fig. 11A–D).

Fig. 11.

Time course of 16:1,n-7 and 18:1,n-7 effects on rictor protein abundance and Akt-S⁴⁷³ and FoxO1-S²⁵⁶ phosphorylation in HepG2 cells. HepG2 cells were treated with 16:1,n-7 or 18:1,n-7 at 50 μM for the times indicated in the figure, and cells were harvested for protein extraction and immunoblotting. Levels of rictor, TBP (loading control), Akt2, phospho-Akt1/2/3-S⁴⁷³, FoxO1, and phospho-FoxO1-S²⁵⁶ were measured as described above. A, B: Representative immunoblots for 16,n-7 and 18:1,n-7 treated cells, respectively, two extracts per treatment. C–E: Rictor protein abundance, phosphorylation status of Akt2-S⁴⁷³, and FoxO1-S²⁵⁶. Results are representative of three separate studies and are expressed as mean ± SD, n = 3. * P ≤ 0.05 versus no FA treatment (zero-time).

Soraphen A inhibits Elovl5 and 16:1,n-7 regulation of Rictor, Akt, and FoxO1

To assess the requirement for FA elongation in the MUFA and Elovl5 control of rictor, Akt, and FoxO1, cells were treated with soraphen A. Soraphen A inhibits acetyl CoA carboxylase-1 and -2 activity, lowers cellular malonyl CoA, and increases FA oxidation in HepG2 cells (30). Because malonyl CoA is a substrate for FA elongation, soraphen A also inhibits FA elongation.

HepG2 cells were infected with Ad-Luc or Ad-Elovl5 and also treated with 16:1,n-7 in the absence (DMSO) or presence of soraphen A (Sor A, 200 nM). Elevated Elovl5 activity increased rictor protein abundance and Akt and FoxO1 phosphorylation. Furthermore, adding 16:1,n-7 to the media augmented this response (Fig. 12A–D). Cells treated with soraphen A, however, blocked 16:1,n-7 and Elovl5-mediated induction of rictor protein. Changes in Akt-S⁴⁷³ and FoxO1-S²⁵⁶ phosphorylation paralleled changes in rictor protein (Fig. 12A–D).

Fig. 12.

Soraphen A inhibits Elovl5 regulation of rictor protein, Akt-S⁴⁷³, and FoxO1-S²⁵⁶ phosphorylation in HepG2 cells. HepG2 cells were infected with either Ad-Luc or Ad-Elovl5. A–D: Both groups of cells received vehicle (DMSO), soraphen A, DMSO + 16:1,n-7, or soraphen A + 16:1,n-7, 48 h; 16:1,n-7 was used at 50 μM, and soraphen A was used at 200 nM. After treatment, cells were harvested for protein extraction, and immunoblotting analysis was performed. Levels of rictor, TBP (loading control), Akt2, phospho-Akt1/2/3-S⁴⁷³, FoxO1, and phospho-FoxO1-S²⁵⁶ were measured as described above. A: Representative immunoblots, 1 extract per treatment. B: Rictor protein abundance. C, D: Phosphorylation status of Akt2-S⁴⁷³ and FoxO1-S²⁵⁶. E, F: The same protocol as described for A–D was used for E, F except that 18:1,n-7 was the FA used in this analysis. E: Representative immunoblots, 1 extract per treatment. F: Rictor protein abundance. G, H: Phosphorylation status of Akt2-S⁴⁷³ and FoxO1-S²⁵⁶. Results are representative of three separate studies and are expressed as mean ± SD, n = 3. For A–D, * P ≤ 0.05 versus Ad-Luc + DMSO; # P ≤ 0.05 versus 16:1,n-7 + DMSO. For E–H, * P ≤ 0.05 versus Ad-Luc + DMSO; # P ≤ 0.05 versus Elovl5 + DMSO.

To determine whether this effect was due to FA elongation and not to other actions of soraphen A, we repeated the study by replacing 16:1,n-7 with 18:1,n-7 (Fig. 12E–H). Soraphen A blocks 16:1,n-7 but not 18:1,n-7 regulation of rictor, Akt, and FoxO1. Accordingly, FA elongation of 16:1,n-7 to 18:1,n-7 is required for Elovl5 and 16:1,n-7 regulation of rictor and the phosphorylation of Akt2-S⁴⁷³ and FoxO1-S²⁵⁶.

DISCUSSION

Our previous study established that a high-fat lard diet (60% energy as fat) lowered hepatic Elovl5 expression and activity and also lowered hepatic content of several MUFA and PUFA products of Elovl5. This diet also increased hepatic nuclear abundance of FoxO1 and elevated expression of genes (Pck1 and G6Pc) involved in GNG. These changes in FoxO1 nuclear abundance and gene expression were associated with hyperglycemia, glucose intolerance, and insulin resistance. Adenoviral-mediated induction of hepatic Elovl5 activity in obese glucose-intolerant mice reversed these diet-induced effects on hepatic metabolism (2).

The findings in this report extend our previous study by establishing that Elovl5 regulated 18:1,n-7 synthesis controls the mTORC2-Akt-FoxO1 pathway and the expression of genes (Pck1 and G6Pc) involved in GNG. We established that increasing hepatic Elovl5 activity increases hepatic rictor through a pretranslational mechanism. Increased rictor protein promotes rictor-mTOR interaction to form mTORC2 and the stimulation of Akt-S⁴⁷³ but not Akt-T³⁰⁸ phosphorylation in liver and HepG2 cells (Figs. 1, 4–6). Based on studies that examined rictor-T¹¹³⁵ and Gsk3β phosphorylation, Elovl5 controls rictor protein abundance but may not control its phosphorylation status (see supplementary Fig. III). However, more studies are required to verify this mechanism. The selective effect of Elovl5 on Akt-S⁴⁷³ phosphorylation, the requirement for active Akt for Elovl5 control of FoxO1, coupled with the knockdown of rictor (Fig. 7) and inhibition of mTORC2 activity (see supplementary Figs. I, II) support the role of rictor as a key mediator of Elovl5 regulation of FoxO1 and gluconeogenic gene expression. As far as we are aware, this represents the first documented linkage between FA elongation and the mTORC2 pathway (Fig. 13).

Fig. 13.

Molecular mechanism for Elovl5 control of mTORC2, FoxO1-S²⁵⁶ phosphorylation, and hepatic GNG. See the text for details. Green arrow indicates increased response, and red arrow indicates decreased response.

We also established the metabolic basis for Elovl5 regulation of rictor, Akt, and FoxO1. As an FA elongase, Elovl5 elongates MUFAs and PUFAs, but not saturated FAs. This effect, however, is substrate specific; 16:1,n-7, 18:2,n-6, 18:3,n-6, 20:4,n-6, 18:4,n-3,and 20:5,n-3 are Elovl5 substrates (4, 5). Livers of obese mice contain low levels of 16:1,n-7 and 18:1,n-7 when compared with lean mice; they also have reduced levels of 20:4,n-6 (Fig. 8) (2). Although 16:1,n-7 and 18:1,n-7 are found in HepG2 cells, 18:3,n-6, 18:4,n-3, and 20:5,n-3 are below detection (see supplementary Fig. IV). Elevated Elovl5 activity in HepG2 cells increases the formation of 18:1,n-7 relative to 16:1,n-7 (Fig. 8D). The low level of 18:3,n-6 (see supplementary Fig. IV) and FADS2 expression in HepG2 cells (30) impairs 20:4,n-6 synthesis; 20:4,n-6 found in these cells is probably derived from the media. Addition of C_18–22 n-3 or n-6 PUFA to HepG2 cells failed to induce rictor, or regulate Akt-S⁴⁷³ or FoxO1-S²⁵⁶ phosphorylation (data not shown). Thus, neither C_18–22 n-6 or n-3 PUFA regulates rictor or FoxO1. This finding is consistent with the lack of effect of C_20–22 ω3 PUFA on fasting blood glucose in diet-induced obese Ldlr^−/− mice (42). In contrast, exogenously supplied 16:1,n-7 or 18:1,n-7, but not other MUFAs, induced Akt and FoxO1 phosphorylation in the absence of elevated Elovl5 activity (Fig. 10). A minimum of ∼24 h of MUFA treatment was required to see significant induction of rictor protein, Akt-S⁴⁷³, and FoxO1-S²⁵⁶ phosphorylation. Inhibition of FA elongation using soraphen A essentially blocked the 16:1,n-7 but not the 18:1,n-7 induction of rictor protein, Akt-S⁴⁷³, and FoxO1-S²⁵⁶ phosphorylation (Fig. 12). Accordingly, 18:1,n-7 and not 16:1,n-7 is the mediator of Elovl5 regulation of the mTORC2-Akt-FoxO1 pathway (Fig. 13). These studies clarify how changes in hepatic Elovl5 activity regulate the mTORC2-Akt-FoxO1 pathway.

Previous studies showed that changes in hepatic Elovl5 activity also affect SREBP1 nuclear abundance; SREBP-1 is a key regulator of lipogenic gene expression (2, 3). The control of hepatic SREBP-1 nuclear abundance by C_20–22 n-3 and n-6 PUFA is well established (43–45). Elovl5 plays a dual role in hepatic metabolism; Elovl5 controls both hepatic FA and glucose synthesis, albeit through different pathways (Fig. 13).

Factors regulating cellular 18:1,n-7 content are important determinants in the control of rictor abundance and the mTORC2-Akt-FoxO1 pathway (Fig. 12). Enzymes that synthesize 18:1,n-7 include stearoyl CoA desaturases (SCDs), Elovl5, and Elovl6. Hepatic expression of SCD1, Elovl5, and Elovl6 is low in livers of C57BL/6J mice fed the high-fat lard diet (60% energy as fat) (2, 4). This diet contains high levels of 16:0 (22.5 mol%) and 18:1,n-9 (34.4 mol%) and low levels of 16:1,n-7 (1.8 mol%) and 18:1,n-7 (2.1 mol%). Thus, low dietary n-7 MUFAs and low expression of SCD1, Elovl5, and Elovl6 account for the low hepatic content of 16:1,n-7 and 18:1,n-7 in livers of obese glucose-intolerant mice.

In contrast, hepatic expression of SCD1 and Elovl6 is elevated in mouse models of carbohydrate-induced obesity and leptin deficiency (4, 46, 47). Ablation of these enzymes protects mice from diet-induced obesity and insulin resistance (46, 47). Hepatic expression of SCD1, Elovl5, and Elovl6 is increased in response to elevated hepatic SREBP1 nuclear abundance and leptin deficiency. Hepatic expression of SCD1 and Elovl6, but not Elovl5, is induced by high-carbohydrate diets and elevated ChREBP/MLX nuclear content (4). Expression of SCD1 and Elovl6 directs saturated FAs originating from de novo lipogenesis to the formation of stearic (18:0) and oleic acid (18:1,n-9). In contrast, SCD1 and Elovl5 will direct palmitate to the formation of 18:1,n-7 (4–6). Based on the studies reported here, the relative abundance of hepatic SCD1, Elovl5, and Elovl6 and their n-7 and n-9 MUFA products are important determinants in the control of the mTORC2 pathway and GNG.

The notion that n-7 MUFAs play a role in metabolic regulation is not new; adipose tissue-derived palmitoleic acid (16:1,n-7) was reported to act as a lipokine and to improve hepatic insulin action (48). A recent report examined the effects of adipose tissue 16:1,n-7 and SCD1 activity on the prevalence of obesity in 1,926 adults in Costa Rica. The authors found no evidence to support a lipokine role for adipose tissue 16:1,n-7 in the reduction of obesity occurrence (49). Others have reported that 16:1,n-7 promoted fatty liver but suppressed hepatic inflammation (50). Still another study suggests that 18:1,n-7 inhibits hepatosteatosis (51, 52). Although our previous reports described effects of elevated Elovl5 activity on hepatosteatosis (2), we suspect that this effect is linked to the capacity of Elovl5 to regulate hepatic content of C_20–22 PUFA and hepatic SREBP1 nuclear abundance (Fig. 13) (42–45). In fact, addition of 18:3,n-6, but not 16:1,n-7, to the Elovl5-infected HepG2 cells significantly suppressed nuclear SREBP1 content (data not shown). As noted earlier, C_18–22 n-3 and n-6 PUFAs regulate hepatic SREBP1 abundance, and dietary C_20–22 n-3 attenuates hepatosteatosis in a mouse model of diet-induced fatty liver disease (42–45, 53). More recently, Wu et al. (54) reported that increased human plasma content of FAs derived from de novo lipogenesis, MUFA synthesis, and limited β-oxidation, i.e., 16:1,n-7, 18:1,n-7, 16:1,n-9, was associated with increased risk of sudden cardiac arrest. These FAs are in low abundance or absent in rodent and human diets, but are generated by elongation and desaturation reaction in cells. These reports, coupled with the data presented in this study, make clear that more study is required to establish the benefit, or lack of benefit, of 16:1,n-7 and 18:1,n-7 on human health.

In summary, we have identified cis-vaccenic acid (18:1,n-7) as a regulator of the mTORC2-Akt-FoxO1 pathway and a mediator of Elovl5 suppression of hepatic gluconeogenic gene expression. Decreased hepatic abundance of 18:1,n-7 is associated with increased expression of enzymes involved in GNG, glucose intolerance, and hyperglycemia. Increased hepatic production of 18:1,n-7 by elevated Elovl5 activity has the opposite effects on hepatic glucose metabolism and systemic control of blood glucose. These outcomes raise two key questions: 1) how does 18:1,n-7 regulate rictor expression, and 2) is dietary 18:1,n-7 alone sufficient to regulate hepatic glucose production in mouse models of obesity and diabetes. If so, dietary 18:1,n-7 might be useful in the management of blood glucose in humans with hyperglycemia.