Skip to main content
Molecular Medicine logoLink to Molecular Medicine
. 2012 Sep 20;18(1):1338–1345. doi: 10.2119/molmed.2012.00284

TH2-like Chemokine Patterns Correlate with Disease Severity in Patients with Recurrent Respiratory Papillomatosis

David W Rosenthal 1,2,3, James A DeVoti 2, Bettie M Steinberg 1,2,5,6, Allan L Abramson 2,6, Vincent R Bonagura 1,2,3,4,6,✉
PMCID: PMC3521785  PMID: 23019074

Abstract

Recurrent respiratory papillomatosis (RRP), characterized by the recurrent growth of benign tumors of the respiratory tract, is caused by infection with human papillomavirus (HPV), predominantly types 6 and 11. Surgical removal of these lesions can be required as frequently as every 3 to 4 wks to maintain a patent airway. There is no approved medical treatment for this disease. In this study, we have characterized the TH2-like chemokine profile (CCL17, CCL18, CCL20, CCL22) in patients with RRP and asked whether it was modulated in patients who had achieved significant clinical improvement. CCL17, CCL18 and CCL22 messenger RNAs (mRNAs) were increased in papillomas compared with clinically normal laryngeal epithelium of the RRP patients. Overall, CCL20 mRNA expression was not increased, but there was intense, selective CCL20 protein expression in the basal layer of the papillomas. Patients with RRP expressed more CCL17 (p = 0.003), CCL18 (p = 0.0003), and CCL22 (p = 0.007) in their plasma than controls. Plasma CCL18 decreased over time in three patients enrolled in a pilot clinical trial of celecoxib, and the decrease occurred in conjunction with clinical improvement. There was a significant correlation between sustained clinical remission in additional patients with RRP and reduced levels of CCL17 (p = 0.01), CCL22 (p = 0.002) and CCL18 (p = 0.05). Thus, the change in expression of these three plasma TH2-like chemokines may, with future studies, prove to serve as a useful biomarker for predicting disease prognosis.

INTRODUCTION

Recurrent respiratory papillomatosis (RRP), characterized by the recurrent growth of premalignant tumors of the upper respiratory tract, is caused by infection with human papillomavirus (HPV), predominantly types 6 and 11. Extension into the lower airway occurs in approximately 17% of patients (1,2). Malignant conversion occurs in approximately 3% of patients with RRP (3,4), and is much more likely in those with pulmonary involvement. Recurrence frequency is variable between patients, but relatively constant within most patients (5). In severe disease, surgical removal of the lesions can be required as frequently as every 3 to 4 wks, leading to a lifetime requirement of greater than 150 surgical procedures to maintain a patent airway. There is no approved medical treatment for this disease.

We reported previously that RRP is characterized by a biased adaptive immune response, with a TH2-like predominance (6–8). Both IL-10 and IL-4 are upregulated in papillomas and in peripheral blood mononuclear cells exposed to HPV-11 E6 protein, and the tissues and cells express a concomitant decrease in IFN-γ, IL-12 and IL-18 (7). However, the immunologic mechanism(s) that governs the variation in disease severity and the TH2-like bias to HPVs remains unresolved. Of note, 6.9% of men and women aged 14 to 69 have oral or airway HPV infection (9) yet the vast majority of these individuals never develop RRP. The incidence in the United States among children (under age 14) is estimated to be 4.3/100,000 (10) and among adults, 1.8/100,000 (11). This suggests that the HPV-specific, TH2-like bias may be unique to these patients.

Toward understanding the immune mechanism(s) that prevents patients with RRP from clearing or controlling their HPV infection, we previously performed a paired messenger RNA (mRNA) microarray study that characterized the repertoires of genes expressed in papillomas versus those expressed by autologous clinically normal laryngeal tissues (6). Among the results was evidence that there was differential chemokine mRNA expression by the papilloma tissues, which suggested that the virus might be able to polarize the patients’ innate immune responses. Chemokines elicit and guide leukocyte movement, support angiogenesis (12) and participate in the balance of TH1-like versus TH2-like responses maintained by macrophages (13,14). We had also previously identified a robust expression of cyclooxygenase-2 (COX2) and its downstream product prostaglandin E2 (PGE2) throughout the airway tissues of patients with RRP compared with controls, mediated by constitutive activation of the EGFR/Rac1 path-way (15). PGE2 can bias the adaptive immune response away from an effective TH1-like pattern (16), and can enhance expression of TH2-like chemokines by innate immunocytes (16,17). Therefore, both viral and host factors could modulate the innate response in these patients.

In this study, we have characterized the TH2-like chemokine profile in patients with RRP, asked whether the profile correlated with disease severity, and asked whether that profile changed when severity changed. We found an elevated TH2/TH1-like chemokine balance in patients with RRP that correlated with disease severity. The inducible TH2-like chemokine CCL20 was expressed selectively in the basal keratinocyte layer of papillomas, where infiltrating immunocytes would first gain access to HPV antigen-expressing cells. We also found that plasma levels of the TH2-like chemokines CCL17, CCL18 and CCL22 were reduced in concert with sustained clinical remission.

MATERIALS AND METHODS

Patients

Studies were approved by the North Shore-LIJ Health System Institutional Review Board. Biopsies were collected of papilloma and autologous clinically normal airway epithelium (adjacent tissue) from patients with RRP and from control airway tissues from patients without RRP undergoing surgery at Long Island Jewish Medical Center. Blood was drawn prior to induction of anesthesia. Disease severity scores were calculated as described previously (5,18) and classified as either mild/moderate (score <0.06), or severe (score ≥0.06 or tracheal involvement). Severity has been associated previously with altered immunologic responses in RRP, while age of disease onset, gender, or infection with HPV6 versus HPV11 has not correlated (7,8).

Celecoxib Studies

Design of the double-blinded placebo-controlled celecoxib studies for treatment of RRP has been described previously (15). Briefly, patients are randomized to either drug or placebo for 1 year and then switched to the other drug for a second year. The pilot study has been completed, and the blind broken. The Phase IIb trial (ClinicalTrials.gov identifier NCT00571701) (19) is ongoing and the blind has not been broken. At the time of this study, 38 patients were enrolled, 23 patients had sufficient clinical data to assess changes in disease status, and seven were free of disease for at least two 3-month intervals. Multiple plasma samples, at irregular intervals, were obtained from the three patients enrolled in the pilot study. Plasma samples were obtained at regular 3-month intervals in the Phase IIb study. All samples were stored at −80°C. TH2-like chemokine levels in plasma samples were measured as described below.

Quantitative PCR

Expression of the TH2-like chemokines CCL17 (TARC) (20), CCL18 (DC-CK-1, PARC, AMAC-1, MIP-4) (21,22), CCL20 (LARC, MIP-3a) (23–27), and CCL22 (MDC, STCP1, ABCD-1) (17,28–32) and the TH1-like chemokines CCL19 (MIP-3b, exodus-3) and CCL21 (6Ckine) (33–36) were measured by quantitative reverse transcriptase PCR (qPCR) with gene specific primers and an 8-mer oligonucleotide probe from the Universal Probe Library Set (Roche, Mannheim, Germany) (37) as shown in Table 1. Samples were amplified according to the manufacturer’s directions with the BioRad for Probes PCR kit (Bio-Rad Laboratories, Hercules, CA, USA), using ROX as a normalization standard. Real-time PCR was performed using an Applied Biosystems 7900 HT thermocycler (Life Technologies, Carlsbad, CA, USA) with SDS 2.4 software, and results were analyzed using the Δ-ΔCt method (38). Six to 19 samples of each type of tissue, derived from different patients, were analyzed for each chemokine.

Table 1.

Real-time PCR primers and probes.

Gene Sense primer (5′→ 3′) Antisense primer (5′→ 3′) UPL probe
Cntl GAPDH AGCCACATCGCTCAGACAC GCCCAATACGACCAAATCC 60
TH2 CCL17 GGCTTCTCTGCAGCACATC GGAATGGCTCCCTTGAAGTA 27
CCL18 AGATTCCACAAAAGTTCATAGTTGAC GATCTGCCGGCCTCTCTT 88
CCL20 GTGGCTTTTCTGGAATGGAA CAACCCCAGCAAGGTTCTT 117
CCL22 CGTGGTGAAACACTTCTACTGG CCTTATCCCTGAAGGTTAGCAA 51
TH1 CCL19 AGTGGCACCAATGATGCTG GTACCCAGGGATGGGTTTCT 74
CCL21 AGAAAGGAAAGGGCTCCAAA AGGCTTCAAGCGTTGGTG 01

UPL, Universal Probe Library.

Immunohistochemistry

Eight-μm sections of paraffin blocks of papillomas and “adjacent” normal laryngeal epithelium were obtained from five patients with severe RRP, processed using standard methods and stained to identify the location of CCL18 and CCL20. Briefly, sections were incubated with either anti-CCL18 polyclonal goat-biotin or anti-CCL20 polyclonal goat-biotin antibodies (R&D Systems, Minneapolis, MN, USA; 1:50 dilution), and detected with Streptavidin-Cy3–conjugated secondary anti-biotin antibodies (Jackson ImmunoResearch Laboratories Inc., West Grove, PA, USA; 1:200 dilution). Slides were mounted with UltraCruz Mounting medium (Santa Cruz Biotechnology Inc, Santa Cruz, CA, USA), observed through a Zeiss Axiovert 200M-inverted microscope, images analyzed using the AxioVision V4.7.2 software (Carl Zeiss Microscopy LLC, Thornwood, NY, USA), and pseudocolor images produced with ImageJ 1.46o (NIH, Bethesda, MD, USA; http://rsb.info.nih.gov/ij/) and Photoshop 7.0 (Adobe, San Jose, CA, USA) software.

Enzyme-Linked Immunosorbent Assay (ELISA)

Chemokines were measured in the plasma of RRP patients and controls by DuoSet (CCL18) or Quantikine (CCL17, CCL20, CCL21 or CCL22) ELISA (R&D Systems) according to the manufacturer’s directions.

Multiplex ELISA

Chemokines were measured in plasma from the subset of patients enrolled in the Phase IIb celecoxib trial with a highly sensitive, customizable, multiplex, cytokine/chemokine array (Aushon Biosystems, Billings, MA, USA) (39). All assays were performed by the vendor in duplicate each time, on at least two different runs, to validate this assay.

Statistical Methods

Descriptive statistics and analysis of variance (ANOVA) were performed with InStat 3.01 (GraphPad Software, San Diego, CA, USA). Plasma chemokine levels were compared by a nonparametric ANOVA, Kruskal-Wallis test. Chemokine multiplex ELISA data from those patients in the Phase IIb clinical trial who achieved remission for at least two successive 3-month intervals (n = 7) were analyzed via mixed model repeated measures (MMRM) analyses, using SAS 9.1 (SAS Institute, Cary, NC, USA), where each of the chemokines (CCL17, CCL18 or CCL22) was modeled as a function of time, with the severity score group (mild/moderate versus severe) serving as a time-dependent covariate. Data was assumed to have compound symmetry covariance structure, and was validated with several other covariance structures. Model estimation was performed using restricted maximum likelihood (REML), and balanced design was determined using the Kenward-Roger method (40) to calculate fixed effects and degrees of freedom. The variance–covariance matrix was used to determine the correlation between the relative number of days since clinical remission, the disease score and a given chemokine. To correlate CCL18 plasma levels to sustainability of remission, a 2 × 2 contingency table was constructed containing: a) the number of patients from the two clinical trials that did/did not maintain a downward slope in CCL18 expression after achieving clinical remission, as defined above; and b) the number of patients that did/did not maintain a sustained clinical remission. This contingency table was analyzed by Fisher exact test.

RESULTS

Chemokine Expression by Laryngeal Tissues from RRP Patients and Controls

To further study the possible bias in TH2-like chemokine mRNA expression in papillomas suggested in our earlier mRNA expression array study (6) and ask if it represented an HPV-induced change or also was characteristic of the airway of patients with RRP, we quantitatively compared the TH1/TH2-like chemokine mRNA repertoires expressed by papillomas (papilloma) and clinically-normal laryngeal tissues from RRP patients (adjacent) to laryngeal tissues from controls without RRP (true normal) (Figure 1). Approximately 50% of individual biopsies of clinically normal airway of RRP patients contain latent HPV DNA (41). Therefore we cannot exclude the possibility that latent HPV infection could contribute to altered chemokine expression in adjacent tissue. However, latency is not expected to alter cellular functions since essentially no viral expression is observed (42).

Figure 1.

Figure 1

Chemokine levels are different in papilloma tissues, uninfected laryngeal tissues of RRP patients, and control laryngeal tissues. The TH2-like chemokines CCL17, CCL18, CCL20 and CCL22, and the TH1-like chemokine CCL19 were quantified by reverse transcription real-time PCR in papilloma tissues (black box; n = 9–16) and adjacent tissues from RRP patients (gray box; n = 12–19) and depicted as fold change compared with true normal laryngeal tissue from controls (white box; n = 6–7).

Surprisingly, expression of the TH2-like chemokines CCL17 and CCL18 was markedly reduced in “adjacent” tissue of patients compared with control “true normal” tissues, while CCL20 and CCL22 levels were essentially comparable (Figure 1). This suggests that laryngeal tissues of RRP patients may be polarized away from expressing at least some TH2-like chemokines, and also that the constitutive expression of PGE2 does not induce chemokine expression by laryngeal keratinocytes. In contrast, active HPV infection in the papillomas increased the levels of CCL17 and CCL22 markedly and possibly increased the level of CCL18, counteracting the anti-TH2 bias. CCL20 mRNA levels were not increased. The expression of the TH1 chemokine CCL19 was reduced markedly in papillomas compared with adjacent tissues from RRP patients and normal tissues from controls. Expression of CCL21, another TH1-like chemokine, was not detectable in any of the tissues (data not shown). The net effect of these results suggests that active HPV infection shifts the local TH1/TH2-like chemokine balance toward a TH2-like state in RRP patients.

Localization of TH2-like Chemokine Expression in Papillomas

CCL18 and CCL20 were the only TH2-like chemokines we studied whose mRNAs were not expressed at markedly higher levels in the papillomas than in the adjacent normal tissues from patients with RRP. We therefore asked whether active virus infection altered CCL18 and CCL20 distribution within the tissues. The CCL18 staining pattern in papillomas showed scattered positive cells in the upper spinous layer (Figure 2A; thin arrow). The frequency of these cells varied within different areas of a given papilloma and between patients. CCL18 expression in the adjacent tissues was barely detectable, but was diffuse throughout the epithelium (Figure 2B). By contrast, there was intense and selective CCL20 expression in the basal layer of the papillomas that extended more weakly into the lower spinous layers (Figure 2C). This pattern of staining was consistent in papillomas from multiple patients with severe RRP. CCL20 in adjacent tissues was diffusely uniform throughout the epithelial layers (Figure 2D). The high spinous cell/basal cell ratio in papillomas compared with normal laryngeal epithelium would explain the reduction in overall level of CCL20 mRNA in the papilloma tissue. Interestingly, we have shown previously that HPV 6/11 viral RNA is expressed strongly in the suprabasal layers (1) (Figures 2E,F), the converse to the CCL20 expression pattern. We were unable to detect the other TH2-like chemokines by immunohistochemistry, which could reflect their immediate release from the cells.

Figure 2.

Figure 2

CCL18 localizes to scattered cells in the spinous layer of papilloma tissues and CCL20 localizes to the basal layer. CCL18 and CCL20 were detected by immunohistochemistry in papillomas and clinically normal adjacent epithelium of patients with severe RRP. (A) CCL18 stained scattered cells in the papillomas (thin arrow), but (B) showed only faint diffuse staining in normal adjacent tissues. (C) CCL20 was localized predominately to the basal layer of papillomas, adjacent to the basement membrane, while (D) normal adjacent tissue had uniform staining throughout the epithelium. (E,F) In situ hybridization, reprinted by permission from Steinberg, et al., 1988 (1), shows HPV-6/11 viral expression in the suprabasal layer. A–D scale bar = 20 μm; E and F scale bar = 100 μm; large arrows point to the basement membrane.

TH2-like Chemokines Are Enriched in the Plasma of RRP Patients, and Levels Correlate with Disease Severity

We then asked whether the TH2-like chemokine expression bias present locally in airway tissues of RRP patients was also seen systemically. We measured chemokines in the plasma of 16 patients with mild/moderate disease and 10 patients with severe disease compared with 10 controls without the disease. Patients with RRP expressed more CCL17 (p = 0.003). CCL18 (p = 0.0003) and CCL22 (p = 0.007) than patients without RRP (Figure 3). Neither CCL20, which is not constitutively expressed, nor the TH1-like chemokine CCL21, was expressed differentially in plasma of RRP patients and controls (data not shown). The assays were repeated in five subjects (three RRP patients with stable ongoing disease and two controls) over six time points spread out over 2 years, with less than 4% variability in the results for each individual when repeated measures were obtained over time. This supports our findings that intrapatient immunologic parameters do not vary significantly over time independently of disease status (8), but we have seen a change in immune parameter when a therapeutic intervention changed the course of disease (43).

Figure 3.

Figure 3

TH2-like chemokines are overexpressed in the plasma of patients with RRP and correlate with disease severity. (A) CCL17, (B) CCL18 and (C) CCL22 were measured in plasma of patients with RRP and controls. The concentration (mean ± SEM) of each chemokine is shown. Concentrations of all three chemokines are higher in patients with RRP: CCL17 pg/mL (severe 317.9 ± 84.0, mild/mod 169.7 ± 22.2, control 98.0 ± 14.3, p = 0.003); CCL18 ng/mL (severe 81.9 ± 12.8, mild/mod 72.7 ± 6.7, control 36.2 ± 8.8, p = 0.0003); and CCL22 pg/mL (severe 686.5 ± 105.1, mild/mod 512.8 ± 31.7, control 411.4 ± 34.0, p = 0.007). Levels are significantly different among patients with severe RRP (n = 10), patients with mild/moderate RRP (n = 16) and controls (n = 14), as determined by ANOVA, Kruskal-Wallis test.

Change in Disease Severity Modulates Systemic TH2-like Chemokine Expression

We used plasma samples from the three patients who had been enrolled in a pilot clinical trial of celecoxib as a novel medical treatment for RRP (15) to ask if treatment with the selective COX-2 inhibitor celecoxib would modulate CCL18 levels and whether changes would correlate with clinical improvement. A marked decrease in plasma CCL18 was noted in all three patients (Figure 4). The decrease occurred in conjunction with clinical improvement, but patients B and C were both disease free well before the CCL18 levels reached their lowest levels, suggesting that the chemokine reduction reflected, but did not drive, clinical response.

Figure 4.

Figure 4

Plasma CCL18 levels decrease in concert with improved clinical status in patients treated with celecoxib, a COX-2 inhibitor. Three patients (A,B,C) in the pilot clinical trial had CCL18 levels (solid line) measured by a single-plex ELISA in plasma samples collected at varying times during the study. Clinical improvement, denoted by reduction in severity score (gray bars), correlated with decreasing CCL18 concentrations.

To further investigate the correlation between change in disease severity and change in chemokine levels, we analyzed the plasma from the seven patients enrolled our current Phase IIb celecoxib trial who were in complete remission (absence of disease) for at least two consecutive 3-month time intervals. Since the ongoing clinical trial remains blinded, we could not correlate chemokine levels with inception of therapy or even know if the patients were receiving celecoxib at the time their disease changed. However, we did know that their disease status had changed. We measured levels of three TH2-like chemokines, CCL18 and also CCL17 and CCL22, at multiple sequential time points surrounding the time at which remission occurred. We correlated the chemokine levels with the number of months since onset of remission, using a test of repeated measures with severity group at the time of each sample as a covariant. Data were depicted graphically and linear regression lines of best fit were determined for each patient (Figure 5). Reduction in CCL17 (p = 0.01) and CCL22 (p = 0.002) plasma levels strongly correlated in this model with months since clinical remission, while changes in CCL18 levels (p = 0.8) did not.

Figure 5.

Figure 5

Plasma CCL17 and CCL22 levels decrease over time in patients who achieve remission of disease. Plasma samples collected every 3 months from seven patients (separate colors) enrolled in an ongoing celecoxib clinical trial who became disease-free for at least 6 months were analyzed for (A) CCL17, (B) CCL22, and (C) CCL18 concentrations via multiplex ELISA. Data is shown relative to time (months) after complete clinical remission. Linear regression was performed for each patient, and a test of repeated measures using severity group as a covariant was employed. CCL17 (p = 0.01) and CCL22 (p = 0.002) strongly correlated with the number of months since remission, CCL18 did not.

We noted that patients followed one of two patterns of chemokine change. In pattern I, patients had downward slopes for all three chemokines (patients #2, #3 and #5). In contrast, those with pattern II (patients #1, #4, #6 and #7) had no decline in CCL18 despite clinical improvement, coupled with a shallow downward or level slope for one or more of the other two chemokines. These patterns associated with sustainability of response (Table 2). All three patients with pattern I had sustained remission, while three of the four patients with pattern II had recurrence of disease by the last time point analyzed. The correlation between sustained clinical remission and CCL18 pattern was significant (p = .05). Thus, analyzing the change in expression of these three TH2-like chemokines may be able to predict sustained improvement.

Table 2.

Relationship between chemokine pattern and sustained clinical response.

Chemokine pattern Patient numbera Slope of CCL17b Slope of CCL22b Slope of CCL18b Sustained clinical response
I
Pt # 3 + + + + + + + + + Yes
Pt # 5 + + + + + + + + + Yes
Pt # 2 + + + Yes
II
Pt # 6 + + − Yes
Pt # 1 + + − No
Pt # 7 + + +/− No
Pt # 4 +/− − − No
a

Patient number refers to the patient identifier numbers in Figure 5.

b

+++, Steep downward slope; +, moderate downward slope; +/−, flat slope; −, inverse slope upward).

DISCUSSION

Chemokines have multiple functions. They attract leukocytes to sites of inflammation, regulate leukocyte homing, and have a role in angiogenesis and tumor growth (44). RRP is a virally induced disease characterized by growth of premalignant tumors, with an apparent failure of the host immune system to control the infection. We have found that the pattern of expression of TH1-like and TH2-like chemokines in patients with RRP paralleled the increased TH2-like cytokine milieu that we have shown previously (7,8,45). We also found that changes in chemokine expression correlated with change in disease severity, consistent with the hypothesis that chemokines play a role in the HPV-specific immune dysregulation of this disease.

Comparison of papilloma tissues to autologous clinically normal airway tissues as well as to tissues from controls with no history of RRP enabled us to ask which chemokine differences were driven by the papillomavirus infection and which were a reflection of the patient’s local or systemic immune status that might impact on susceptibility to HPV-induced disease. One caveat to this approach is the fact that latent HPV infection is widespread in the airway of patients with RRP, and we cannot exclude the possibility that the latent infection affects chemokine expression, even though viral expression is essentially undetectable in latency (42).

Keratinocytes are known to express many of the same cytokines and chemokines as immunocytes (46), although the regulation of expression has not been studied as extensively in keratinocytes. Expression of the TH2-like chemokines CCL17 and CCL22 was increased significantly in papilloma tissues compared to autologous clinically normal tissues (Figure 1). The TH2-like cytokines IL-4 and IL-13, which we reported previously are increased in papillomas (7,47), are potent stimulators of CCL22 expression by monocytes (48–50) while the TH1-like cytokine IFN-γ (absent in papillomas) suppresses CCL22 expression by monocytes, macrophages and dendritic cells (DCs) (49). CCL17 is expressed by alternatively activated macrophages (AAMφs) and DCs, and the same TH2-like cytokines that induce CCL22 expression promote generation of AAMφs (51). Others have suggested that elevated COX-2 expression leads to an overexpression of CCL20 through a PLCP1/PKCα/MEK1/2/ERK1/2-dependent pathway (52) and that alterations in the COX2/PGES/PGE2 pathway affect TH2-like chemokine expression (53,54). However, PGE2 does not appear to have the same effect on laryngeal keratinocytes, since concentrations of PGE2 in papilloma and clinically normal airway tissues of RRP patients are quite comparable (data not shown).

CCL18, a highly abundant and constitutively expressed chemokine in normal plasma (22,55–58), is expressed by many innate immunocytes including DCs (13,59), AAMφs (13) and eosinophils (60). CCL18 is expressed prominently in asthma and other TH2 disorders (54,60). Thus, it was surprising that we did not see a marked increase in CCL18 in the papilloma tissues. The vast majority of mRNA analyzed from the tissues is derived from the epithelial cells, not innate or adaptive immune system cells. Thus, even though we saw some cells in some papillomas that were strongly positive by immunohistochemistry (Figure 2A), the CCL18 mRNA would be diluted by the large amount of mRNA extracted from negative papilloma cells. It appears that the virus, the microenvironment in the tissues, or both acting together, stimulate papilloma cells to upregulate expression of CCL17 and CCL22, but not CCL18.

TH2-like chemokines are important chemoattractants that guide TH2-like cells and regulatory T cells (Tregs) to sites of inflammation (61) through their interaction with CCR4 (48,62). Increased expression of CCL17 and CCL22 could be the mechanism for our previous finding that Tregs are enriched in papillomas (61). CCL22 is also a potent chemoattractant for DCs and natural killer (NK) cells (63–65), which are more abundant in papillomas (47,66). CCL20 mRNA levels did not appear to be upregulated in papillomas when analyzing total biopsy extracts, but the protein was clearly upregulated differentially in the basal layer of this stratified squamous epithelium (Figure 2C). CCL20 is an inducible chemokine that acts as a chemoattractant for NK cells (67) and immature DCs (24), and plays an important role in recruitment and activation of TH2-like T cells. Basal cells are immediately adjacent to the basement membrane, thus CCL20 expression in these cells would form a strategic barrier to selectively admit TH2-like, but not TH1-like, T cells into the tissue. This would restrict access to the more suprabasal and spinous layer of keratinocytes where high-level HPV expression occurs in papillomas (Figures 2E,F) (1).

Plasma chemokine levels reflect a more systemic immune state of the RRP patients than analysis of laryngeal biopsy tissues. Plasma levels of CCL17 and CCL22 were clearly elevated in the RRP patients, in keeping with the papilloma tissue levels, but so was CCL18 (Figure 3). This disconnect suggests that the highly elevated plasma CCL18 levels in these patients are derived from another site, possibly lymphoid tissues. While the role of CCL18 has been debated, strong evidence supports CCL18 as an antiinflammatory chemokine (22,54,60,68). Thus, we conclude that RRP is indeed a TH2-like chemokine disease with a strong bias away from effective control of HPV infection, and that the bias correlates with disease severity.

The systemic TH2-like chemokine bias in these patients is not “hard wired,” since plasma levels changed when disease severity improved.

CONCLUSION

On the basis of the first clinical study (15), we would conclude that celecoxib therapy induces both clinical response and reduction in CCL18 plasma levels and that CCL18 levels reflect clinical state rather than regulation by PGE2 since initiation of treatment and clinical improvement clearly preceded the decline in chemokine expression to baseline for two of the three patients (Figure 4). Expansion of this research using seven patients from our current celecoxib study provided additional insights (Figure 5). There was a highly significant correlation between achievement of clinical remission and decline in plasma CCL17 and CCL22 levels, but not CCL18 levels. Rather, a sustained decline in CCL18 levels appeared to predict continued remission (Table 2). We postulate that immunologic events that contribute to clinical improvement involve modulation of the expression of CCL17 and CCL22, and that changes in CCL18 reflect the likelihood of sustaining the improvement. Monitoring plasma levels of the three TH2-like cytokines (CCL17, CCL22 and CCL18) may, with further study, prove to be a useful tool for predicting disease prognosis in RRP.

ACKNOWLEDGMENTS

This work was supported by grants R01DE017227 from the National Institute of Dental and Craniofacial Research (VRB) and U01DC007946 from the National Institute on Deafness and Other Communication Disorders (BMS and ALA), National Institutes of Health. The authors thank Nick Agostino for assistance with some of the ELISA assays, and Helena Schmidtmayerova for her assistance in the initial CCL18 ELISAs. We thank Virginia Mullooly for coordinating the collection of patient samples, the residents from the Department of Otolaryngology and the attendings and residents from the Department of Anesthesiology for their assistance. Assistance with statistical analysis was provided by Martin Lesser and Jonathan Levine.

Figures 2E and F were reprinted with the permission of the publisher from Steinberg BM, Gallagher T, Stoler M, Abramson AL. (1988) Persistence and expression of human papillomavirus during interferon therapy. Arch Otolaryngol. Head Neck Surg. 114:27–32.

Footnotes

Online address: http://www.molmed.org

DISCLOSURE

BM Steinberg has a research grant of celecoxib and matching placebo from Pfizer for the clinical studies.

REFERENCES

  • 1.Steinberg BM, Gallagher T, Stoler M, Abramson AL. Persistence and expression of human papillomavirus during interferon therapy. Arch Otolaryngol Head Neck Surg. 1988;114:27–32. doi: 10.1001/archotol.1988.01860130031010. [DOI] [PubMed] [Google Scholar]
  • 2.Weiss MD, Kashima HK. Tracheal involvement in laryngeal papillomatosis. Laryngoscope. 1983;93:45–8. doi: 10.1288/00005537-198301000-00008. [DOI] [PubMed] [Google Scholar]
  • 3.Lin HW, et al. Malignant transformation of a highly aggressive human papillomavirus type 11-associated recurrent respiratory papillomatosis. Am J Otolaryngol. 2010;31:291–6. doi: 10.1016/j.amjoto.2009.02.019. [DOI] [PubMed] [Google Scholar]
  • 4.Blumin JH, Handler EB, Simpson CB, Osipov V, Merati AL. Dysplasia in adults with recurrent respiratory papillomatosis: incidence and risk factors. Ann Otol Rhinol Laryngol. 2009;118:481–5. doi: 10.1177/000348940911800704. [DOI] [PubMed] [Google Scholar]
  • 5.Abramson AL, Steinberg BM, Winkler B. Laryngeal papillomatosis: clinical, histopathologic and molecular studies. Laryngoscope. 1987;97:678–85. doi: 10.1288/00005537-198706000-00005. [DOI] [PubMed] [Google Scholar]
  • 6.DeVoti JA, et al. Immune dysregulation and tumor-associated gene changes in recurrent respiratory papillomatosis: a paired microarray analysis. Mol Med. 2008;14:608–17. doi: 10.2119/2008-00060.DeVoti. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.DeVoti JA, et al. Failure of gamma interferon but not interleukin-10 expression in response to human papillomavirus type 11 E6 protein in respiratory papillomatosis. Clin Diagn Lab Immunol. 2004;11:538–47. doi: 10.1128/CDLI.11.3.538-547.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Bonagura VR, Hatam L, DeVoti J, Zeng FF, Steinberg BM. Recurrent respiratory papillomatosis: Altered CD8(+) T-cell subsets and T(H)1/T(H)2 cytokine imbalance. Clin Immun. 1999;93:302–11. doi: 10.1006/clim.1999.4784. [DOI] [PubMed] [Google Scholar]
  • 9.Gillison ML, et al. Prevalence of oral HPV infection in the United States, 2009–2010. JAMA. 2012;307:693–703. doi: 10.1001/jama.2012.101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Derkay CS. Task force on recurrent respiratory papillomas. A preliminary report. Arch Otolaryngol Head Neck Surg. 1995;121:1386–91. doi: 10.1001/archotol.1995.01890120044008. [DOI] [PubMed] [Google Scholar]
  • 11.Derkay CS, Wiatrak B. Recurrent respiratory papillomatosis: a review. Laryngoscope. 2008;118:1236–47. doi: 10.1097/MLG.0b013e31816a7135. [DOI] [PubMed] [Google Scholar]
  • 12.Taub DD, Longo DL, Murphy WJ. Human interferon-inducible protein-10 induces mononuclear cell infiltration in mice and promotes the migration of human T lymphocytes into the peripheral tissues and human peripheral blood lymphocytes-SCID mice. Blood. 1996;87:1423–31. [PubMed] [Google Scholar]
  • 13.Mantovani A, Sozzani S, Locati M, Allavena P, Sica A. Macrophage polarization: tumor-associated macrophages as a paradigm for polarized M2 mononuclear phagocytes. Trends Immunol. 2002;23:549–55. doi: 10.1016/s1471-4906(02)02302-5. [DOI] [PubMed] [Google Scholar]
  • 14.Mantovani A. Chemokines. Introduction and overview. Chem Immunol. 1999;72:1–6. [PubMed] [Google Scholar]
  • 15.Lucs AV, Wu R, Mullooly V, Abramson AL, Steinberg BM. Constitutive overexpression of the oncogene Rac1 in the airway of recurrent respiratory papillomatosis patients is a targetable host-susceptibility factor. Mol Med. 2012;18:244–9. doi: 10.2119/molmed.2011.00447. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Kalinski P. Regulation of immune responses by prostaglandin E2. J Immunol. 2012;188:21–8. doi: 10.4049/jimmunol.1101029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.McIlroy A, et al. Histamine and prostaglandin E up-regulate the production of Th2-attracting chemokines (CCL17 and CCL22) and down-regulate IFN-gamma-induced CXCL10 production by immature human dendritic cells. Immunology. 2006;117:507–16. doi: 10.1111/j.1365-2567.2006.02326.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Abramson AL, et al. Clinical effects of photodynamic therapy on recurrent laryngeal papillomas. Arch Otolaryngol Head Neck Surg. 1992;118:25–9. doi: 10.1001/archotol.1992.01880010029011. [DOI] [PubMed] [Google Scholar]
  • 19.Study of Celebrex (Celecoxib) in Patients With Recurrent Respiratory Papillomatosis [Internet]2007 Dec 10 – [study dates] Bethesda (MD): National Library of Medicine, ClinicalTrials.gov; [cited 2012 Nov 16]. Available from: http://clinicaltrials.gov/ct2/show/record/NCT00571701. North Shore Long Island Jewish Health System (sponsor). Study last updated 2012 Jan 4. [Google Scholar]
  • 20.Katakura T, Miyazaki M, Kobayashi M, Herndon DN, Suzuki F. CCL17 and IL-10 as effectors that enable alternatively activated macrophages to inhibit the generation of classically activated macrophages. J Immunol. 2004;172:1407–13. doi: 10.4049/jimmunol.172.3.1407. [DOI] [PubMed] [Google Scholar]
  • 21.Nibbs RJ, et al. C-C chemokine receptor 3 antagonism by the beta-chemokine macrophage inflammatory protein 4, a property strongly enhanced by an amino-terminal alanine-methionine swap. J Immunol. 2000;164:1488–97. doi: 10.4049/jimmunol.164.3.1488. [DOI] [PubMed] [Google Scholar]
  • 22.Vulcano M, et al. Unique regulation of CCL18 production by maturing dendritic cells. J Immunol. 2003;170:3843–9. doi: 10.4049/jimmunol.170.7.3843. [DOI] [PubMed] [Google Scholar]
  • 23.He S, Wang L, Wu Y, Li D, Zhang Y. CCL3 and CCL20-recruited dendritic cells modified by melanoma antigen gene-1 induce anti-tumor immunity against gastric cancer ex vivo and in vivo. J Exp Clin Cancer Res. 2010;29:37. doi: 10.1186/1756-9966-29-37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.He C, Zhang SL, Hu CJ, Tong DW, Li YZ. Higher levels of CCL20 expression on peripheral blood mononuclear cells of Chinese patients with inflammatory bowel disease. Immunol Invest. 2010;39:16–26. doi: 10.3109/08820130903380732. [DOI] [PubMed] [Google Scholar]
  • 25.Kao CY, et al. Up-regulation of CC chemokine ligand 20 expression in human airway epithelium by IL-17 through a JAK-independent but MEK/NF-kappaB-dependent signaling pathway. J Immunol. 2005;175:6676–85. doi: 10.4049/jimmunol.175.10.6676. [DOI] [PubMed] [Google Scholar]
  • 26.Reibman J, Hsu Y, Chen LC, Bleck B, Gordon T. Airway epithelial cells release MIP-3alpha/CCL20 in response to cytokines and ambient particulate matter. Am J Respir Cell Mol Biol. 2003;28:648–54. doi: 10.1165/rcmb.2002-0095OC. [DOI] [PubMed] [Google Scholar]
  • 27.Homey B, et al. Up-regulation of macrophage inflammatory protein-3 alpha/CCL20 and CC chemokine receptor 6 in psoriasis. J Immunol. 2000;164:6621–32. doi: 10.4049/jimmunol.164.12.6621. [DOI] [PubMed] [Google Scholar]
  • 28.Gobert M, et al. Regulatory T cells recruited through CCL22/CCR4 are selectively activated in lymphoid infiltrates surrounding primary breast tumors and lead to an adverse clinical outcome. Cancer Res. 2009;69:2000–9. doi: 10.1158/0008-5472.CAN-08-2360. [DOI] [PubMed] [Google Scholar]
  • 29.Mariani M, Lang R, Binda E, Panina-Bordignon P, D’Ambrosio D. Dominance of CCL22 over CCL17 in induction of chemokine receptor CCR4 desensitization and internalization on human Th2 cells. Eur J Immunol. 2004;34:231–40. doi: 10.1002/eji.200324429. [DOI] [PubMed] [Google Scholar]
  • 30.Ritter M, et al. Elevated expression of TARC (CCL17) and MDC (CCL22) in models of cigarette smoke-induced pulmonary inflammation. Biochem Biophys Res Commun. 2005;334:254–62. doi: 10.1016/j.bbrc.2005.06.084. [DOI] [PubMed] [Google Scholar]
  • 31.Shimada Y, Takehara K, Sato S. Both Th2 and Th1 chemokines (TARC/CCL17, MDC/CCL22, and Mig/CXCL9) are elevated in sera from patients with atopic dermatitis. J Dermatol Sci. 2004;34:201–8. doi: 10.1016/j.jdermsci.2004.01.001. [DOI] [PubMed] [Google Scholar]
  • 32.Yanai M, et al. The role of CCL22/macrophage-derived chemokine in allergic rhinitis. Clin Immunol. 2007;125:291–8. doi: 10.1016/j.clim.2007.08.002. [DOI] [PubMed] [Google Scholar]
  • 33.Debes GF, Hopken UE, Hamann A. In vivo differentiated cytokine-producing CD4(+) T cells express functional CCR7. J Immunol. 2002;168:5441–7. doi: 10.4049/jimmunol.168.11.5441. [DOI] [PubMed] [Google Scholar]
  • 34.Flanagan K, Moroziewicz D, Kwak H, Horig H, Kaufman HL. The lymphoid chemokine CCL21 costimulates naive T cell expansion and Th1 polarization of non-regulatory CD4+ T cells. Cell. Immunol. 2004;231:75–84. doi: 10.1016/j.cellimm.2004.12.006. [DOI] [PubMed] [Google Scholar]
  • 35.Luther SA, et al. Differing activities of homeostatic chemokines CCL19, CCL21, and CXCL12 in lymphocyte and dendritic cell recruitment and lymphoid neogenesis. J Immunol. 2002;169:424–33. doi: 10.4049/jimmunol.169.1.424. [DOI] [PubMed] [Google Scholar]
  • 36.Marsland BJ, et al. CCL19 and CCL21 induce a potent proinflammatory differentiation program in licensed dendritic cells. Immunity. 2005;22:493–505. doi: 10.1016/j.immuni.2005.02.010. [DOI] [PubMed] [Google Scholar]
  • 37.Bustin SA. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol. 2000;25:169–93. doi: 10.1677/jme.0.0250169. [DOI] [PubMed] [Google Scholar]
  • 38.Fleige S, et al. Comparison of relative mRNA quantification models and the impact of RNA integrity in quantitative real-time RT-PCR. Biotechnol Lett. 2006;28:1601–13. doi: 10.1007/s10529-006-9127-2. [DOI] [PubMed] [Google Scholar]
  • 39.Moody MD, Van Arsdell SW, Murphy KP, Orencole SF, Burns C. Array-based ELISAs for high-throughput analysis of human cytokines. Biotechniques. 2001;31:186–90. 192–4. doi: 10.2144/01311dd03. [DOI] [PubMed] [Google Scholar]
  • 40.Kenward MG, Roger JH. Small sample inference for fixed effects from restricted maximum likelihood. Biometrics. 1997;53:983–97. [PubMed] [Google Scholar]
  • 41.Abramson AL, Nouri M, Mullooly V, Fisch G, Steinberg BM. Latent Human Papillomavirus infection is comparable in the larynx and trachea. J Med Virol. 2004;72:473–7. doi: 10.1002/jmv.20013. [DOI] [PubMed] [Google Scholar]
  • 42.Maran A, et al. Human papillomavirus type 11 transcripts are present at low abundance in latently infected respiratory tissues. Virology. 1995;212:285–94. doi: 10.1006/viro.1995.1486. [DOI] [PubMed] [Google Scholar]
  • 43.Shikowitz MJ, et al. Clinical trial of photo-dynamic therapy with meso-tetra (hydroxyphenyl) chlorin for respiratory papillomatosis. Arch Otolaryngol Head Neck Surg. 2005;131:99–105. doi: 10.1001/archotol.131.2.99. [DOI] [PubMed] [Google Scholar]
  • 44.Olson TS, Ley K. Chemokines and chemokine receptors in leukocyte trafficking. Am J Physiol Regul Integr Comp Physiol. 2002;283:R7–28. doi: 10.1152/ajpregu.00738.2001. [DOI] [PubMed] [Google Scholar]
  • 45.James EA, et al. Papillomavirus-specific CD4(+) T cells exhibit reduced STAT-5 signaling and altered cytokine profiles in patients with recurrent respiratory papillomatosis. J Immunol. 2011;186:6633–40. doi: 10.4049/jimmunol.1004181. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Tuzun Y, Antonov M, Dolar N, Wolf R. Keratinocyte cytokine and chemokine receptors. Dermatol Clin. 2007;25:467–76. vii. doi: 10.1016/j.det.2007.06.003. [DOI] [PubMed] [Google Scholar]
  • 47.Bonagura VR, et al. Recurrent respiratory papillomatosis: a complex defect in immune responsiveness to human papillomavirus-6 and -11. APMIS. 2010;118:455–70. doi: 10.1111/j.1600-0463.2010.02617.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Bonecchi R, et al. Differential expression of chemokine receptors and chemotactic responsiveness of type 1 T helper cells (Th1s) and Th2s. J Exp Med. 1998;187:129–34. doi: 10.1084/jem.187.1.129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Bonecchi R, et al. Divergent effects of interleukin-4 and interferon-gamma on macrophage-derived chemokine production: an amplification circuit of polarized T helper 2 responses. Blood. 1998;92:2668–71. [PubMed] [Google Scholar]
  • 50.Andrew DP, et al. STCP-1 (MDC) CC chemokine acts specifically on chronically activated Th2 lymphocytes and is produced by monocytes on stimulation with Th2 cytokines IL-4 and IL-13. J Immunol. 1998;161:5027–38. [PubMed] [Google Scholar]
  • 51.Semnani RT, Mahapatra L, Moore V, Sanprasert V, Nutman TB. Functional and phenotypic characteristics of alternative activation induced in human monocytes by IL-4 or the parasitic nematode Brugia malayi. Infect Immun. 2011;79:3957–65. doi: 10.1128/IAI.05191-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52.Alaaeddine N, Hilal G, Baddoura R, Antoniou J, Di Battista JA. CCL20 stimulates proinflammatory mediator synthesis in human fibroblast-like synoviocytes through a MAP kinase-dependent process with transcriptional and posttranscriptional control. J Rheumatol. 2011;38:1858–65. doi: 10.3899/jrheum.110049. [DOI] [PubMed] [Google Scholar]
  • 53.Newton R, et al. Superinduction of COX-2 mRNA by cycloheximide and interleukin-1beta involves increased transcription and correlates with increased NF-kappaB and JNK activation. FEBS Lett. 1997;418:135–8. doi: 10.1016/s0014-5793(97)01362-8. [DOI] [PubMed] [Google Scholar]
  • 54.Schutyser E, et al. Identification of biologically active chemokine isoforms from ascitic fluid and elevated levels of CCL18/pulmonary and activation-regulated chemokine in ovarian carcinoma. J Biol Chem. 2002;277:24584–93. doi: 10.1074/jbc.M112275200. [DOI] [PubMed] [Google Scholar]
  • 55.de Nadai P, et al. Involvement of CCL18 in allergic asthma. J Immunol. 2006;176:6286–93. doi: 10.4049/jimmunol.176.10.6286. [DOI] [PubMed] [Google Scholar]
  • 56.Lindhout E, et al. The dendritic cell-specific CC-chemokine DC-CK1 is expressed by germinal center dendritic cells and attracts CD38-negative mantle zone B lymphocytes. J Immunol. 2001;166:3284–9. doi: 10.4049/jimmunol.166.5.3284. [DOI] [PubMed] [Google Scholar]
  • 57.Prasse A, et al. A vicious circle of alveolar macrophages and fibroblasts perpetuates pulmonary fibrosis via CCL18. Am J Respir Crit Care Med. 2006;173:781–92. doi: 10.1164/rccm.200509-1518OC. [DOI] [PubMed] [Google Scholar]
  • 58.Radstake TR, et al. Increased expression of CCL18, CCL19, and CCL17 by dendritic cells from patients with rheumatoid arthritis and regulation by Fc gamma receptors. Ann Rheum Dis. 2004;64:359–67. doi: 10.1136/ard.2003.017566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59.Gunther C, Carballido-Perrig N, Kopp T, Carballido JM, Pfeiffer C. CCL18 is expressed in patients with bullous pemphigoid and parallels disease course. Br J Dermatol. 2009;160:747–55. doi: 10.1111/j.1365-2133.2008.08979.x. [DOI] [PubMed] [Google Scholar]
  • 60.Schraufstatter I, Takamori H, Sikora L, Sriramarao P, DiScipio RG. Eosinophils and monocytes produce pulmonary and activation-regulated chemokine, which activates cultured monocytes/macrophages. Am J Physiol Lung Cell Mol Physiol. 2004;286:L494–501. doi: 10.1152/ajplung.00323.2002. [DOI] [PubMed] [Google Scholar]
  • 61.Hatam LJ, et al. Immune suppression in premalignant respiratory papillomas: enriched functional CD4+Foxp3+ regulatory T-cells and PD-1/PD-L1/L2 expression. Clin Cancer Res. 2012;18:1925–35. doi: 10.1158/1078-0432.CCR-11-2941. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 62.Rivino L, et al. Chemokine receptor expression identifies Pre-T helper (Th)1, Pre-Th2, and nonpolarized cells among human CD4+ central memory T cells. J Exp Med. 2004;200:725–35. doi: 10.1084/jem.20040774. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63.Chantry D, et al. Profile of human macrophage transcripts: insights into macrophage biology and identification of novel chemokines. J Leukoc Biol. 1998;64:49–54. doi: 10.1002/jlb.64.1.49. [DOI] [PubMed] [Google Scholar]
  • 64.Godiska R, et al. Human macrophage-derived chemokine (MDC), a novel chemoattractant for monocytes, monocyte-derived dendritic cells, and natural killer cells. J Exp Med. 1997;185:1595–604. doi: 10.1084/jem.185.9.1595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65.Chang M, et al. Molecular cloning and functional characterization of a novel CC chemokine, stimulated T cell chemotactic protein (STCP-1) that specifically acts on activated T lymphocytes. J Biol Chem. 1997;272:25229–37. doi: 10.1074/jbc.272.40.25229. [DOI] [PubMed] [Google Scholar]
  • 66.Bonagura VR, et al. Activating killer cell immunoglobulin-like receptors 3DS1 and 2DS1 protect against developing the severe form of recurrent respiratory papillomatosis. Hum Immunol. 2010;71:212–9. doi: 10.1016/j.humimm.2009.10.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67.Stolberg VR, et al. Cysteinecysteinyl chemokine receptor 6 mediates invariant natural killer T cell airway recruitment and innate stage resistance during mycobacterial infection. J Innate Immun. 2011;3:99–108. doi: 10.1159/000321156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68.Bruna-Romero O, Schmieg J, Del Val M, Buschle M, Tsuji M. The dendritic cell-specific chemokine, dendritic cell-derived CC chemokine 1, enhances protective cell-mediated immunity to murine malaria. J Immunol. 2003;170:3195–203. doi: 10.4049/jimmunol.170.6.3195. [DOI] [PubMed] [Google Scholar]

Articles from Molecular Medicine are provided here courtesy of The Feinstein Institute for Medical Research at North Shore LIJ

RESOURCES