A meta-analysis of single base-pair substitutions in translational termination codons ('nonstop' mutations) that cause human inherited disease

Abstract

'Nonstop' mutations are single base-pair substitutions that occur within translational termination (stop) codons and which can lead to the continued and inappropriate translation of the mRNA into the 3'-untranslated region. We have performed a meta-analysis of the 119 nonstop mutations (in 87 different genes) known to cause human inherited disease, examining the sequence context of the mutated stop codons and the average distance to the next alternative in-frame stop codon downstream, in comparison with their counterparts from control (non-mutated) gene sequences. A paucity of alternative in-frame stop codons was noted in the immediate vicinity (0-49 nucleotides downstream) of the mutated stop codons as compared with their control counterparts (p = 7.81 × 10^-4). This implies that at least some nonstop mutations with alternative stop codons in close proximity will not have come to clinical attention, possibly because they will have given rise to stable mRNAs (not subject to nonstop mRNA decay) that are translatable into proteins of near-normal length and biological function. A significant excess of downstream in-frame stop codons was, however, noted in the range 150-199 nucleotides from the mutated stop codon (p = 8.55 × 10^-4). We speculate that recruitment of an alternative stop codon at greater distance from the mutated stop codon may trigger nonstop mRNA decay, thereby decreasing the amount of protein product and yielding a readily discernible clinical phenotype. Confirmation or otherwise of this postulate must await the emergence of a clearer understanding of the mechanism of nonstop mRNA decay in mammalian cells.

Introduction

There are currently in excess of 60,000 missense and nonsense mutations (in nearly 4,000 different genes) listed in the Human Gene Mutation Database (HGMD) that are known to cause, or to be associated with, human inherited disease [1]. In addition, there are 119 examples of mutations (in 87 different genes) that occur within stop codons, a category of mutation which therefore constitutes ~0.2% per cent of codon-changing mutations [1]. Such lesions have been termed 'nonstop', 'nostop' or 'readthrough' mutations on the basis that the loss of the normal translational termination (stop) codon is likely to lead to continued translation of the mRNA further downstream into the 3'-untranslated region (UTR).

Although many authors tacitly assume that the normal open reading frame will simply be extended until the next in-frame stop codon is encountered, too few human nonstop mutations have so far been characterised to allow any general conclusions to be drawn as to their likely phenotypic consequences at either the mRNA or the protein level. In three reported cases, however (namely, those nonstop mutations in the gene encoding ribosomal protein S19 [RPS19], causing Diamond-Blackfan anaemia,[2] the F10 gene causing factor X deficiency [3] and the foxhead box E3 [FOXE3] gene causing anterior segment dysgenesis [4]), the levels of the mutant mRNA transcripts were found to be dramatically lower than those of their wild-type counterparts. By contrast, the mRNA level associated with a nonstop mutation in the 3-beta-hydroxy-delta-5-steroid dehyrogenase (HSD3B2) gene causing adrenal hyperplasia was found to be near normal, although both HSD3B2 enzymatic activity and antigen (associated with a predicted 467 amino-acid protein, extended by 95 residues beyond the wild-type length) were found to be dramatically reduced [5]. Similarly, in the case of a nonstop mutation in the thymidine phosphorylase (TYMP) gene responsible for mitochondrial neurogastrointestinal encephalomyopathy, the mRNA level was not found to be reduced, even although the thymine phosphorylase protein product it encoded was undetectable [6].

In yeast, nonstop mRNAs generated from mRNAs lacking translational termination codons are recognised, by the protein Ski7, on ribosomes that have become stalled at the 3' ends of the mRNAs; these RNAs are then targeted for exosome-mediated degradation [7-9]. While this process of 'nonstop mRNA decay' is fairly effective at removing nonstop mRNAs, any protein products generated by translation of residual nonstop mRNAs are degraded by the proteasome [10,11] Although few such studies have so far been attempted in mammalian cells, the expression level of nonstop mRNAs generally appears unaltered while ribosome stalling at the 3' end of the elongated nonstop mRNA blocks translation before the completion of synthesis of full-length polypeptides [12-14].

Precisely how nonstop mRNA decay impacts upon naturally occurring human nonstop mutations is unknown but, as is clear from the five disease-associated examples mentioned above, the evidence acquired to date suggests that this may be a gene- and mutation-dependent process [15]. Thus, although not uncommon, remarkably little is as yet known about the nature and consequences of this type of mutation. In this paper, we report a first meta-analysis of naturally occurring nonstop mutations causing human inherited disease. With a view to exploring the various possible factors that could impact upon the likelihood of a given nonstop mutation coming to clinical attention, we have performed an analysis of the sequence context of the mutated stop codons and the average distance to the next in-frame downstream stop codon in comparison with control (non-mutated) gene sequences.

Methods

Mutation and control datasets

A total of 119 naturally occurring nonstop mutations from 87 human genes (Supplementary Table S1 (Table 4)) were identified from the HGMD [1]. The majority of these nonstop mutations were single examples identified in specific genes but 18 genes harboured a total of 50 examples of this type of lesion. Since the multiple inclusion of identical sequences flanking mutated stop codons would have introduced considerable bias into the subsequent analysis, only one mutation per gene was considered in the analysis of the sequence context.

Table S1.

Nonstop mutations recorded in the Human Gene Mutation Database

Entrez Gene ID	Gene	Base change	Amino acid change	Codon	Chromosome	Gene	Ref_Seq mRNA Acc Num (Longest)		CDS	Next STOP codon	polyA signals AATAAA ATTAAA	Flanking nucleotide sequence Terminal amino-acids
							Transcript size	Number of Exons
58	ACTA1	cTAG-CAG	Term-Gln	376	1q42.13	ACTA1	NM_001100.3	1509 bp 7 exons	106-1239 TAG	1378-1380 TAA	1465..1470 ATTAAA	tcgtccaccgcaaatgcttctagcacactccacctccagcacg tgc ttc tag = C F *
58	ACTA1	TAG-TGG	Term-Trp
58	ACTA1	TAGa-TAT	Term-Tyr
326	AIRE	TGAc-TGT	Term-Cys	546	21q22.3	AIRE	NM_000383.2	2257 bp 15 exons	128-1765 TGA	1943-1945 TAA	1941..1946 ATTAAA	cggcggcccccttcccctcctgaccccagatggccgggacatg ccc tcc tga = P S *
336	APOA2	gTGA-AGA	Term-Arg	78	1q21-q23	APOA2	NM_001643.1	473 bp 4 exons	59-361 TGA	422-424 TAA	454..459 AATAAA	gaacacagcctgccacccagtgaagtgtccagaccattgtctt acc cag tga = T Q *
336	APOA2	gTGA-CGA	Term-Arg
336	APOA2	gTGA-GGA	Term-Gly
336	APOA2	TGA-TCA	Term-Ser
353	APRT	TGA-CGA	Term-Arg	181	16q24	APRT	NM_000485.2	807 bp 5 exons	36-578 TGA	790-792 TAA	Not Identified	tctctctcctgcagtatgagtgaccacagggcctcccagccca tat gag tga = Y E *
353	APRT	TGA-TCA	Term-Ser
411	ARSB	gTAG-CAG	Term-Gln	534	5q11-q13	ARSB	NM_000046.2	6076 bp 9 exons	1287-2888 TAG	3036-3038 TAA	3485..3490 AATAAA 4564-4569 AATAAA 5804-5809 AATAAA 6039..6044 AATAAA 6043..6048 AATAAA	gggtgtggggcccttggatgtaggatttcagggaggctagaaa tgg atg tag = W M *
435	ASL	TAGg-TAC	Term-Tyr	465	7cen-q11.2	ASL	NM_000048.3	1937 bp 16 exons	112-1506 TAG	1654-1656 TAA	1528-1533 AATAAA 1752-1757 AATAAA 1913-1918 AATAAA 1921-1926 AATAAA 1932-1937 AATAAA	tactgcaggcacagcaggcctaggtcctcccacacctgccccc cag gcc tag = Q A *
443	ASPA	TAG-TGG	Term-Trp	314	17pter-p13	ASPA	NM_000049.2	1435 bp 6 exons	159-1100 TAG	1233-1235 TAA	1364-1369 AATAAA	gtattcgctgctgtttacattagaaatcacttccagcttacat tta cat tag = L H *
472	ATM	gTGA-GGA	Term-Gly	3057	11q22-q23	ATM	NM_000051.3	13147 bp 63 exons	386-9556 TGA	9641-9643 TAG	10215-10220 ATTAAA 10514-10519 ATTAAA 13129-13134 AATAAA	caggatggaaagcttgggtgtgatcttcagtatatgaattacc tgg gtg tga = W Y *
472	ATM	TGA-TCA	Term-Ser
477	ATP1A2	cTGA-CGA	Term-Arg	1021	1q21-q23	ATP1A2	NM_000702.2	5496 bp 23 exons	133-3195 TGA	3277-3280 TAA	5195-5200 AATAAA 5434..5439 AATAAA	tggagaaggagacatactactgaccccattggaagaagaacca tac tac tga = Y Y *
50617	ATP6V0A4	gTAG-CAG	Term-Gln	841	7q33-q34	ATP6V0A4	NM_020632.2	3152 bp 23 exons	284-2806 TAG	2963-2965 TGA	3039-3044 AATAAA 3116-3121 AATAAA	tggatggcacagccgaggagtaggctgagggctgcacctccca gag gag tag = E E *
540	ATP7B	cTGA-CGA	Term-Arg	1466	13q14.3	ATP7B	NM_000053.2	6644 bp 21 exons	158-4555 TGA	4556-4558 TGA	3788-3793 ATTAAA 4831-4836 ATTAAA 4892-4897 AATAAA	gggatgaggagcagtacatctgatgacttcaggcaggcgggcc tac atc tga = Y I *
166379	BBS12	TAGt-TAC	Term-Tyr	711	4q27	BBS12	NM_152618.2	3260 bp 2 exons	194-2326 TAG	2375-2377 TAA	2379-2384 AATAAA 3220-3225 AATAAA	taacgggctttctatttttgtagtgttactggctaagtctttg ttt ttg tag = T L *
120329	CASP12	gTGA-CGA	Term-Arg	125	11q22.3	CASP12	AY358222.1		3-1057 TAA	1064-1066 TAA	1227..1232 AATAAA	ctatctctttcctgggaattaaactcataagaagcaactca ggg aat taa = G N
846	CASR	aTAA-CAA	Term-Gln	1079	3q13	CASR	NM_000388.2	??bp ? exons	439-3609 TAA	3631-3633 TAG	5831-5836 ATTAAA 6126-6131 AATAAA 6615..6620 AATAAA	agaaaacgtagtgaattcataaaatggaaggagaagactg aat tca taa = N S *
1027	CDKN1B	gTAA-CAA	Term-Gln	199	12p13.1-p12	CDKN1B	NM_004064.2	2422 bp 3 exons	466-1062 TAA	1240-1242 TGA	1836-1841 ATTAAA 1948-1953 ATTAAA 2382-2387 AATAAA	ctcagaagacgtcaaacgtaaacagctcgaattaagaatatg caa acg taa = Q T *
120329	CFTR	TAG-TGG	Term-Trp	1481	7q31.2	CFTR	NM_000492.3	6132 bp 27 exons	133-4575 TAG	4585-4587 TAA	6108..6113 AATAAA	aggtgcaagatacaaggctttagagagcagcataaatgttgac agg ctt tag = R L *
1080	COL1A2	aTAA-CAA	Term-Gln	1277	7q22.1	COL1A2	NM_000089.3	5411 bp 52 exons	472-4572 TAA	4585-4587 TAA	4848-4853 AATAAA 4861-4866 AATAAA 5357-5362 AATAAA 5378..5383 AATAAA	ttggcccagtctgtttcaaataaatgaactcaatctaaattaa ttc aaa taa = F K *
1378	CRYBB1	gTGA-CGA	Term-Arg	253	22q12.1	CRYBB1	NM_001887.3	921 bp 6 exons	71-829 TGA	905..907 TAA	903..908 AATAAA	tggccacagagccccccaagtgagtccacacctcactctgcta ccc aag tga = P K *
1414	CRYM	TAAa-TAT	Term-Tyr	315	16p13.11-p12.3	CRYM	NM_001888.2	1303 bp 9 exons	86-1030 TAA	1043-1045 TGA	1267..1272 AATAAA	attcctggtcatctggtaaataaaacaaaggaacttgatgttg ggt aaa taa = G K *
1428	CTSK	TGAc-TGG	Term-Trp	330	1q21	CTSK	NM_000396.2	1702 bp 8 exons	125-1114 TGA	1169-1171 TAA	1650-1655 AATAAA 1680-1685 AATAAA	tggccagcttccccaagatgtgactccagccagccaaatccat aag atg tga = K M *
1513	CYP2C19	TGAa-TGC	Term-Cys	491	10q24.1-q24.3	CYP2C19	NM_000769.1	1473 bp 9 exons	1-1473 TGA	1549-1551 TGA	1617-1622 ATTAAA 1733-1738 ATTAAA	agctgtgcttcattcctgtctgaagaagcacagatggtctggc cct gtc tga = P V *
1557	DBT	TGA-TTA	Term-Leu	422	1p31	DBT	NM_001918.2	10831 bp 11 exons	34-1482 TGA	1501-1503 TGA	Multiple polyA sites 10794-10799 AATAAA	ttatgctactagatctgaaatgaagactgataagacattcttg ctg aaa tga = L K *
1629	DHCR7	cTAA-CAA	Term-Gln	476	11q13.2-q13.5	DHCR7	NM_001360.2	2665 bp 8 exons	274-1701 TAA	1852-1854 TAA	2099-2105 AATAAA 2642-2648 ATTAAA	gcctgctgcctggaatcttctaagggcacgccctagggagaag atc ttc taa = I F *
1717	DOK7	tTGA-CGA	Term-Arg	505	4p16.2	DOK7	NM_173660.3	2566 bp 7 exons	71-1585 TGA	2130-2132 TGA	2547-2553 AATAAA	tcaaggtaaacccccctccttgagagccgcagatcccgccccg cct cct tga = P P *
285489	EDA	cTAG-CAG	Term-Gln	392	Xq12	EDA	NM_001399.4	5296 bp 10 exons	243-1418 TAG	1503-1505 TGA	5251-5256 AATAAA	tgggtgaagcccctgcatcctagattccccccattttgcctct gca tcc tag = A S *
2110	ETFDH	gTAA-CAA	Term-Gln	618	4q32-q35	ETFDH	NM_004453.2	2349 bp 13 exons	333-2186 TAA	2223-2225 TAA	2307-2312 AATAAA	acctgcttacaatggaatgtaaactgcagctagccagtttct gga atg taa = G M *
1896	EYA1	TAAc-TAC	Term-Tyr	593	8q13.3	EYA1	NM_000503.3	4326 bp 18 exons	641-2419 TAA	2435-2437 TGA	3014-3020 ATTAAA 3585-3591 AATAAA 3849-3855 AATAAA 4299-4304 AATAAA	ccttggaactggagtacctgtaacagcgctcggcactttgaca tac ctg taa = Y L *
2138	F8	cTGA-CGA	Term-Arg	2333	Xq28	F8	NM_000132.2	9030 bp 27 exons	172-7227 TGA	7327-7329 TAG	7637-7643 AATAAA 8004-8010 AATAAA 8048-8054 AATAAA 9010-9015 AATAAA	gcgaggcacaggacctctactgagggtggccactgcagcacct ctc tac tga = L Y *
2157	FGB	aTAG-AAG	Term-Lys	462	4q28	FGB	NM_005141.2	1949 bp 8 exons	26-1501 TAG	1535-1537 TGA	1649-1655 AATAAA 1913-1918 AATAAA	ggcccttcttcccacagcaatagtccccaatacgtagattttt cag caa tag = Q Q *
2244	FGFR3	gTGA-AGA	Term-Arg	807	4p16.3	FGFR3	NM_000142.2	4093 bp 18 exons	40-2460 TGA	2759-2761 TAA	4238-4243 AATAAA	gcagtgggggctcgcggacgtgaagggccactggtccccaaca cgg acg tga = R T *
2261	FGFR3	gTGA-GGA	Term-Gly
2261	FGFR3	TGA-TCA	Term-Ser
2261	FGFR3	TGA-TTA	Term-Leu
2261	FGFR3	TGAa-TGC	Term-Cys
2261	FGFR3	TGAa-TGG	Term-Trp
2261	FGFR3	TGAa-TGT	Term-Cys
2273	FHL1	gTAA-GAA	Term-Glu	281	Xq26	FHL1	NM_001449.3	2398 bp 8 exons	209-1051 TAA	1205-1207 TAA	2360..2365 AATAAA	cactgcaaaaaatgctccgtgaatctggccaacaagcgcttt gct ccg tga = A P *
2261	FKRP	cTGA-AGA	Term-Arg	496	19q13.32	FKRP	NM_024301.3	3349 bp 4 exons	2980-1785 TGA	1846-1848 TGA	2489-2494 AATAAA 2540-2545 AATAAA	tgagtctgacgggaagcggctgaagccctgataacctcgcctt agc ggc tga = S G *
79147	FMO2	tTAG-CAG	Term-Gln	472	1q23-q25	FMO2	NM_001460.2	5181 bp 10 exons	118-1533 TAG	1723-1725 TAG	Multiple polyA sites ?????? AATAAA	tcggaccctgcaactcctattagtatcgcctggttgggcctgg tcc tat tag = S Y *
2301	FOXE3	gTGA-CGA	Term-Arg	320	1p32	FOXE3	NM_012186.2	2000 bp SINGLE Exon	245-1204 TGA	1418-1420 TGA	1939-1944 ATTAAA 1954-1959 ATTAAA	cggggctggagcgctacctgtgagcctgcgccgcgcgggcag tac ctg tga = Y L
2301	FOXE3	TGA-TCA	Term-Ser
2294	FOXF1	gTGA-CGA	Term-Arg	380	16q24	FOXF1	NM_001451.2	2579 bp 3 exons	44-1183 TGA	1400-1402 TAG	3218-3223 AATAAA 3301-3306 AATAAA	acatcaagccttgcgtgatgtgaggctgccgccgcaggccct gtg atg tga = V M *
2327	FOXH1	gTGA-CGA	Term-Arg	366	8q24.3	FOXH1	NM_003923.1	1793 bp 3 exons	580-1677 TGA	1684-1686 TAA	Not found	tgctctcctggtgcagcctgtgaggctcttaagacaggggcca agc ctg tga = S L *
8928	FUCA1	gTAA-AAA	Term-Lys	462	1p34	FUCA1	NM_000147.3	2095 bp 8 exons	46-1446 TAA	1681-1683 TGA	1575-1581 ATTAAA 2044-2049 AATAAA	taaagctgacaggagtgaagtaatcatttgagtgcaagaagaa gtg aag taa = V K *
2517	GALT	cTGA-CGA	Term-Arg	380	9p13	GALT	NM_000155.2	1347 bp 11 exons	68-1207 TGA	1352-1354 TAA	1315-1320 AATAAA	gggagacagcaaccatcgcctgaccacgccgaccacagggcct atc gcc tga = I A *
2592	GALT	TGAc-TGC	Term-Cys
2623	GATA1	aTGA-CGA	Term-Arg	414	Xp11.23	GATA1	NM_002049.2	1522 bp 6 exons	113-1354 TGA	1475-1477 TAA	1478-1484 AATAAA	gtggctccgctcagctcatgagggcacagagcatggcct agc tca tga = S S *
2592	GCDH	TGAg-TGG	Term-Trp	439	19p13.2	GCDH	NM_000159.2	1839 bp 12 exons	78-1394 TGA	1473-1475 TGA	1802..1807 AATAAA	aggcgttcacggccagcaagtgagccgctccatcaggggcccg agc aag tga = S K *
2639	GCH1	cTGA-CGA	Term-Arg	251	14q22.1-q22.2	GCH1	NM_000161.2	2941 bp 6 exons	162-914 TGA	1017-1019 TGA	Multiple polyA sites 2896-2901 ATTAAA	tcctgactctcattaggagctgagcttcattcagtgtgtgtgc agg agc tga = R S *
2645	GCK	gTGA-CGA	Term-Arg	466	7p15.3-p15.1	GCK	NM_000162.2	2759 bp 10 exons	487-1884 TGA	2314-2316 TGA	2724-2729 ATTAAA	aggcctgtatgctgggccagtgagagcagtggccgcaagcgcag ggc cag tga = G Q *
2645	GCK	TGA-TTA	Term-Leu
55806	HR	cTAG-CAG	Term-Gln	35	8p21.2	HR	NM_005144.3	4981 bp 19 exons	131-3700 TAG	4151-4153 TGA	4311-4316 ATTAAA 4952-4957 ATTAAA 4956-4961 AATAAA	caggaggccaaatagagggatgctaggtg gcc aaa tag = A K *
	HR	TAG-TGG	Term-Trp
2643	HBA2	TAAg-TAT	Term-Tyr	142	16p13.3	HBA2	NM_000517.3	575 bp 3 exons	38-466 TAA	557-559 TAA	555-560 AATAAA	tgctgacctccaaataccgttaagctggagcctcggtagccgt tac cgt taa = Y R *
3040	HBA2	tTAA-AAA	Term-Lys
3040	HBA2	tTAA-CAA	Term-Gln
3040	HBA2	tTAA-GAA	Term-Glu
3040	HBA2	tTAA-TCA	Term-Ser
3081	HGD	tTGA-CGA	Term-Arg	446	3q13.33	HGD	NM_000187.2	1920 bp 14 exons	371-1708 TGA	1778-1780 TAG	1892..1898 AATAAA	ccagcagaacctaattgagactggaacattgctaccataa cct aat tga = P N *
3284	HSD3B2	TGAt-TGC	Term-Cys	373	1p13.1	HSD3B2	NM_000198.2	1669 bp 4 exons	143-1261 TGA	1544-1546 TGA	1649..1654 AATAAA	ccctgaagtccaagactcagtgatttaaggatgacagagatgt act cag tga = T Q *
3425	IDUA	aTGA-GGA	Term-Gly	654	4p16.3	IDUA	NM_000203.3	2203 bp 14 exons	89-2050 TGA	2231-2233 TGA	2145-2150 AATATA	ccccatccccgggcaatccatgagcctgtgctgagccccagtg aat cca tga = N P *
3425	IDUA	TGAg-TGT	Term-Cys
8517	IKBKG	TAG-TGG	Term-Trp	420	Xq28	IKBKG	NM_001099856.1	2073 bp 10 exons	225-1483 TAG	1563-1565 TAG	2049-2054 AGTAAA	atgtcatggagtgcattgagtagggccggccagtgcaaggcca att gag tag = I E *
9445	ITM2B	tTGA-AGA	Term-Arg	267	13q14.3	ITM2B	NM_021999.3	1870 bp 6 exons	1874-987 TGA	1018-1020 TAA	1131-1136 ATTAAA 1440-1445 ATTAAA 1664-1669 AATAAA 1785-1790 AATAAA 1834-1839 ATTAAA	tggaaactttaatttgttcttgaacagtcaagaaaaacattat tgt tct tga = C K *
169522	KCNV2	tTAG-TAT	Term-Tyr	546	9p24.2	KCNV2	NM_133497.2	1882 bp 2 exons	215-1852 TAG	2031-2033 TAG	2142-2147 AATAAA	tcaccccaagacaagagaattagtattttataggacatgtggc gag aat tag = E N *
169522	KCNV2	tTAG-CAG	Term-Gln
84634	KISS1R	cTGA-AGA	Term-Arg	399	19p13.3	KISS1R	NM_032551.4	1607 bp 5 exons	146-1342 TGA	1839-1841 TAA	1554-1559 ATTAAA	gggaggacaacgcccctctctgagcggacccggtgggaatccg cct ctc tga = P L *
3914	LAMB3	TGAt-TGG	Term-Trp	1173	1q32	LAMB3	NM_000228.2	4093 bp 23 exons	145-3663 TGA	3829-3831 TGA	4008-4013 AATGAA 4020-4025 AATAAA	tctactatgccacctgcaagtgatgctacagcttccagcccgt tgc aag tga = C K *
9388	LIPG	cTGA-CGA	Term-Arg	501	18q21.1	LIPG	NM_006033.2	4143 bp ? exons	253-1755 TGA	1900-1902 TGA	4094-4099 ATTAAA 4118-4123 AATAAA	actgtggagcttccctgagggtgcccgggcaagtcttg ctt ccc tga = L P *
4143	MAT1A	TAGa-TAT	Term-Tyr	396	10q22	MAT1A	NM_000429.2	3419 bp 9 exons	256-1443 TAG	1645-1647 TAA	3382-3387 AATAAA	ttcccaggaagcttgtattttagagccagggggagctgggcct gta ttt tag = V F *
4159	MC3R	TAG-TCG	Term-Ser	361	20q13.2-q13.3	MC3R	NM_019888.2	1112 bp 1 exon	1-1083 TAG	1102-1104 TGA	Not found	gcaacggcatgaacttgggataggatgcagggccatggaaatg ttg gga tag = L G *
64087	MCCC2	gTAA-CAA	Term-Gln	564	5q12-q13	MCCC2	NM_022132.3	2329 bp 17 exons	100-1791 TAA	17987-1800 TAA	1796-1801 AATAAA	acttcggtatcttcaggatgtaactggaataaaggatgttttc agg atg taa = R M *
5080	MECP2	cTGA-TGG	Term-Trp	487	Xq28	MECP2	NM_004992.2	10241 bp 4 exons	227-1687 TGA	1766-1768 TGA	1790-1795 AATAAA 7191-7196 TATAAA 7300-7305 AATAAA 9490-9495 AATAAA	ccgtgaccgagagagttagctgactttacacggagcggattgc gtt agc tga = V S *
5080	MECP2	cTGA-CGA	Term-Arg
5080	MECP2	cTGA-TTA	Term-Leu
5080	MECP2	cTGA-TGC	Term-Cys
4338	MOCS2	TAAt-TAC	Term-Tyr	189	5q11	MOCS2	NM_004531.3	1347 bp 8 exons	40-793 TAA	845-847 TGA	1238-1243 ATTAAA 1289-1294 ATTAAA 1299-1304 AATAAA	gcttttgggcatccaacagttaatcacttatgtttttagagca aac agt taa = N S *
4524	MTHFR	TGA-TCA	Term-Ser	657	1p36.3	MTHFR	NM_005957.3	7105 bp 12 exons	185-2155 TGA	2303-2305 TGA	3833-3838 ?????? 7086-7091 AATAAA	cgagagaaacggaggctccatgaccctgcgtcctgacgccctg gct cca tga = A P *
55651	NHP2	aTGA-AGA	Term-Arg	154	5q35.3	NHP2	NM_017838.3	867 bp 4 exons	144-605 TGA	756-758 TGA	802-805 ACTAAA 836-841 AGTAAA	agtccctgcccctacccctatgaggggctccggtagcacctgg ccc cta tga = P L *
4878	NPPA	cTGA-CGA	Term-Arg	152	1p36.21	NPPA	NM_006172.2	840 bp 3 exons	95-550 TGA	554-556 TAA	768-773 ATTAAA 819-824 AATAAA	ctgtgttctctttgcagtactgaagataacagccagggaggac cag tac tga = Q Y *
190	NR0B1	aTAA-GAA	Term-Glu	471	Xp21.3-p21.2	NR0B1	NM_000475.3	1555 bp 2 exons	13-1424 TAA	1447-1479 TAA	1475-1480 AA TAAA 1514-1519 AATAAA	aaatgctctgtacaaagatataaagtcatgtgggccacacaag aag ata taa = K I *
4939	OAS2	TAG-TGG	Term-Trp	720	12q24.2	OAS2	NM_016817.2	3539 bp 11 exons	141-2300 TAG	2322-2324 TAA	3015-3020 AATAAA 3340-3345 AATAAA 3513-3518 AATAAA	ataattctaaaagaaacttctagagatcatctggcaatcgctt aac ttc tag = N F *
4976	OPA1	TAAa-TAC	Term-Tyr	961	3q28-q29	OPA1	NM_015560.1	5864 bp 31 exons	56-2938 TGA	2975-29771 TGA	3046-3051 AATAAA	aagctcttcatcaggagaaataaattaagtgagtaaaaattct gag aaa taa = E K *
5009	OTC	TGAt-TGG	Term-Trp	355	Xp21.1	OTC	NM_000531.4	1647 bp 10 exons	215..1279 TGA	1319-1321 TAA	1365-1370 AATAAA 1622-1627 AATAAA	agctccagaagcctaaattttgatgttgtgttacttgtcaaga aaa ttt tga = K F *
5080	PAX6	TAA-TTA	Term-Leu	423	11p13	PAX6	NM_000280.2	2816 bp 15 exons	513-1781 TAA	1821-1823 TAA	2269-2274 ATTAAA 2495-2500 AATAAA	aatactggccaagattacagtaa aaaaaaaaaaaaaaaaaaaaaggaaaggaaa tta cag taa = L Q *
5080	PAX6	TAA-TAT	Term-Tyr
5189	PEX1	aTAA-CAA	Term-Gln	1284	7q21.2	PEX1	NM_000466.2	4390 bp 24 exons	97-3948 TAA	4030-4032 TGA	4261-4266 AATAAA 4356-4361 AATAAA	gacagaaagtaactttagcataaaatatacttctttttgattt tta gca taa = L A *
8929	PHOX2B	TGAt-TGG	Term-Trp	315	4p12	PHOX2B	NM_003924.2	3033 bp 3 exons	361-1305 TGA	1426-1428 TGA	1452-1457 AATAAA 1766-1771 AATAAA 1798-1803 ATTAAA 1861-1866 ATTAAA	tagtgaagagcagtatgttctgatctggaatcctgcggcggcg atg ttc tga = M F *
8929	PHOX2B	TGAt-TGC	Term-Cys
55163	PNPO	tTAA-CAA	Term-Gln	262	17q21.32	PNPO	NM_018129.2	3482 bp 7 exons	154-939 TAA	1021-1023 TAA	1405-1410 ATTAAA 2412-2417 ATTAAA 3438-3443 AATAAA	tctatgagagacttgcaccttaactctgggacctgctggccca gca cct taa = A P *
5627	PROS1	TAAg-TAT	Term-Tyr	636	3q11.2	PROS1	NM_000313.1	3309 bp 15 exons	147-2177 TAA	2217-2219 TAA	2636-2641 ATTAAA 2735-2740 ATTAAA 3289-3294 AATAAA	ggaaaaagacaaagaattcttaaggcatcttttctctgcttat aat tct taa = N A *
10594	PRPF8	cTGA-CGA	Term-Arg	2336	17p13.3	PRPF8	NM_006445.3	7311 bp 43 exons	115-7122 TGA	7243-7245 TGA	7261-7266 AATAAA 7274-7279 AATAAA	atcgggaggacctgtatgcctgaccgtttccctgcctcctgct tat gcc tga = Y A *
5744	PTHLH	TGAa-TGG	Term-Trp	178	12p12.1-p11.2	PTHLH	NM_198965.1	1331 bp 5 exons	323-856 TGA	1013-1015 TGA	1304-1309 AATAAA	ttcacggaggcattgaaattttcagcagagaccttc agg cat tga = R H
10111	RAD50	TAAa-TAT	Term-Tyr	1313	5q31	RAD50	NM_005732.2	5891 bp 25 exons	388-4326 TAA	4522-4524 TGA	5836-5841 AATAAA	tgggattcaatgttcattaaaaatatccaagatttaaatg gtt cat taa = V H *
6066	RHCE	TAAg-TAC	Term-Tyr	418	1p36.11	RHCE	NM_020485.3	1635 bp 9 exons	87-1340 TAA	1416-1418 TGA	1482-1487 ATTAAA 1490-1495 ATTAAA 1536-1541 AATAAA 1596-1601 ATTAAA	atttggctgttggattttaagcaaaagcatccaagaaaaa gga ttt taa = G F *
6010	RHO	cTAA-CAA	Term-Gln	349	3q21-q24	RHO	NM_000539.2	2768 bp 5 exons	96-1142 TAA	1293-1295 TAA	1239-1244 AATGAA 1506-1511 AATAAA 1659-1664 TATAAA 2563-2568 ATTAAA	cgagccaggtggccccggcctaagacctgcctaggactctgtg ccg gcc taa = P A *
6010	RHO	cTAA-GAA	Term-Glu
860	RUNX2	TGA-TCA	Term-Ser	522	6p21	RUNX2	NM_001024630.2	5572 bp 9 exons	7-1776 TGA	1853-1855 TAG	2761-2666 ATTAAA 3073-3078 ATTAAA 3892-3897 AATAAA 4183-4188 ATTAAA 4448-4453 ATTAAA 4591-4596 ATTAAA	aatctgtttggcgaccatattgaaattcctcagcagtggccca cca tat tga = P Y
710	SERPING1	cTGA-AGA	Term-Arg	479	11q12-q13.1	SERPING1	NM_000062.2	1984 bp 8 exons	192-1694 TGA	1830-1832 TGA	1940-1945 AATAAA	gagtatatgaccccagggcctgagacctgcaggatcaggttag agg gcc tga = R A *
4068	SH2D1A	aTGA-AGA	Term-Arg	129	Xq25-q26	SH2D1A	NM_002351.2	2507 bp 4 exons	346-732 TGA	766-768 TAA	738-743 AATAAA 1036-1041 AATAAA	atgtctgcctgaaagccccatgaagaaaaataaaacaccttgt gcc cca tga = A P *
6473	SHOX	cTGA-CGA	Term-Arg	293	Xp22.33	SHOXa	NM_000451.3	3757 bp 6 exons	692-1570 TGA	1712-1715 TAG	2486-2491 ATTAAA	gcggaggccctggggctctgacccgccgcgcagccc ggg ctc tga = G L *
6473	SHOX	aTGA-CGA	Term-Arg	226		SHOXb	NM_006883.2	1951 bp 6 exons	692-1369 TGA	1433-1436 TAG	Not found
5172	SLC26A4	TGAa-TGG	Term-Trp	781	7q31	SLC26A4	NM_000441.1	4930 bp 21 exons	225-2567 TGA	2691-2693 TAA	2719-2724 AATAAA 3014-3019 AATAAA 3038-3043 AATAAA 3066-3071 AATAAA 3229-3234 AATAAA	ctatgcgtacacttgcatcctgaaagtgggttcgggaggtctc gca tcc tga = A S *
54977	SLC25A38	cTGA-CGA	Term-Arg	305	3p22.1	SLC25A38	NM_017875.2	2124 bp 7 exons	402-1316 TGA	1398-1400 TAA	1897-1902 AATAAA 1965-1670 ATTAAA 2092-2097 AATAAA	gggcctgaagtcctgaccaagagaggactgg aag tcc tga = K S *
6663	SOX10	cTAA-TAC	Term-Tyr	467	22q13.1	SOX10	NM_006941.3	2882 bp 4 exons	279-1679 TAA	1935-1937 TGA	2840-2845 AATAAA 2846-2851 ATTAAA	atacgacactgtcccggccctaaagggggccctgtcgccacca cgg ccc taa = R P *
6663	SOX10	cTAA-AAA	Term-Lys
6716	SRD5A2	TAA-TCA	Term-Ser	255	2p23	SRD5A2	NM_000348.3	2446 bp 5 exons	72..836 TAA	918-920 TAA	846-851 ATTAAA 1235-1240 ATTAAA 2426-2431 ATTAAA	cccttattccattcatcttttaaaggaaccaaattaaaaagga atc ttt taa = I F *
7170	TPM3	TAA-TCA	Term-Ser	286	1q21.2	TPM3	NM_152263.2	7116 bp 12 exons	116-973 TAA	1142-1144 TAA	1140-1145 ATTAAA 1414-1419 ATTAAA 1894-1899 ATTAAA	tccttactttttcatacagataattatcaccgtttctgctctg tac aga taa = Y R *
7454	WAS	cTGA-AGA	Term-Arg	503	Xp11.4-p11.21	WAS	NM_000377.1	1806 bp 12 exons	35-1543 TGA	1805-1807 TAA	1777-1782 AATAAA	aagatgatgaatgggatgactgagtggctgagttacttgctgc gat gac tga = D D *
7454	WAS	cTGA-CGA	Term-Arg
7454	WAS	TGA-TCA	Term-Ser
7490	WT1	TGAg-TGG	Term-Trp	450	11p13	WT1	NM_024424.2	3020 bp 10 exons	197-1741 TGA	1805-1807 TGA	2206-2211 AATAAA 3002-3007 ATTAAA	ccaaactccagctggcgctttgaggggtctccctcggggaccg gcg ctt tga = A L *

A control dataset was established which comprised 1,692 genes listed in the HGMD (for which both coding and 3'-UTRs were obtainable from Ensembl [Build 37] but for which no termination codon [nonstop] mutations have so far been recorded). Data from the Transterm database http://uther.otago.ac.nz/Transterm.html, [16] representing a total of 29,210 stop codons associated with annotated human genes, were used as genome-wide controls.

Analysis of nonstop mutations

The relative frequency of each type of stop codon (ie TAG, TAA and TGA) in the mutated (nonstop mutation-bearing) sequences and non-mutated wild-type control gene sequences was assessed. Stop codons harbouring single and multiple mutations were examined separately.

To detect any bias in the pattern of stop codon mutability, the mutability of the dinucleotides within a pentanucleotide spanning the stop codon and including one flanking nucleotide on either side was assessed. The number of mutations occurring in each of the 12 possible dinucleotides (note that four dinucleotides [CC, CA, CG and TC] cannot occur in conjunction with any stop codon-spanning pentanucleotide and were therefore omitted) was counted. In the HGMD control dataset, one nucleotide position within each stop codon was randomly mutated and the numbers of mutations in each possible dinucleotide were then counted. Statistical significance was determined using Fisher's exact test with a Bonferroni correction being applied to allow for multiple testing.

Since the identity of the nucleotides immediately flanking the stop codon may influence the susceptibility of the stop codon to mutation, the frequencies of each DNA base in each of the six positions upstream and downstream of the normally used stop codon were obtained for both the mutated sequences and the controls. The expected frequency E of the DNA bases at each position was calculated based on the probability of observing this nucleotide in the HGMD control sequences:

$$E_{ij}=\frac{F_{ij}{N}_m}{N_c}$$

where E_ij is the expected frequency of the base I = {A, C, G, T} at position j, F_ij is the observed frequency of base i at position j in the HGMD control dataset, N_m is the total number of mutated sequences and N_c is the number of sequences in the HGMD control dataset. Under the assumption that the data follow a binomial distribution, we considered that an increase or decrease in the observed frequency of a particular nucleotide in a specified position was statistically significant if the corresponding p value was < 0.01. In addition, to investigate whether any particular stop codon (ie TGA, TAG or TAA) was associated with any specific flanking nucleotides, we placed both the mutated and control sequences into separate datasets for each of the three stop codons and repeated the above analysis for each of the new datasets.

Determining the distance to the next downstream in-frame stop codon

The distance to the next downstream stop codon in the required reading frame is likely to determine the length of any extended protein product. For each mutated (nonstop mutation-bearing) DNA sequence and each sequence in the HGMD control dataset, we therefore determined the distance to the next in-frame stop codon downstream. Sequences in the HGMD control dataset, for which the next downstream stop codon was beyond the 3'-UTR sequence available from Ensembl, were not used in this analysis. Distances between 0 and 500 base pairs (bp) from the original stop codon were divided into 'bins', each 50 bp long, the final bin containing all sequences where the distance was greater than 500 bp. The number of sequences which fell into each bin was recorded for both the mutated sequences and the HGMD control sequences. The same procedure was repeated for those sequences with single mutations and for those sequences harbouring two or more mutations. To assess the statistical significance of our findings, we employed Fisher's exact test using a Bonferroni correction to allow for multiple testing. p values of < 0.05 were considered to be statistically significant.

Using the same method as for the original stop codons, we also investigated the frequency of occurrence of specific nucleotides surrounding the next in-frame stop codon downstream. It is possible that at least a proportion of these downstream in-frame stop codons are associated with naturally occurring splice isoforms of the gene,[17] and might therefore possess comparable sequence characteristics to the stop codons involved in the mutational events. The flanking sequence may also affect the likelihood of a mutation coming to clinical attention.

Results and discussion

Relative frequency of stop codon involvement in nonstop mutation

We have performed a meta-analysis of the 119 nonstop mutations (in 87 different genes) known to cause human inherited disease (Supplementary Table S1 (Table 4)) and recorded in the HGMD [1]. HGMD is a comprehensive collection of germline mutations causing (or associated with) human inherited disease and is an invaluable source of data for meta-analyses of human gene mutations.

The termination of synthesis of every human protein is effected by one of three stop codons, TAG, TAA and TGA, listed in increasing order of usage in human genes. We posed the question as to whether one of these stop codons might be more susceptible to mutation, or alternatively might be more likely to come to clinical attention once mutated, than the others. We noted that a majority of the nonstop mutations (57 per cent) in our dataset occurred within TGA codons (Table 1). Since 49.4 per cent and 48.6 per cent of stop codons in the HGMD control gene dataset and human genome dataset, respectively, were of this type, however, this finding did not attain statistical significance (Table 1; p values 0.107 and 0.066, respectively).

Table 1.

The proportion of nonstop mutations harboured by each type of stop codon in mutated gene sequences, HGMD control gene sequences and the human genome at large

Stop codon type	Proportion of stop codons harbouring nonstop mutations causing human genetic disease (%)a	Proportion of stop codons in HGMD control gene sequences (%)b	Estimated proportion (number) of stop codons in the human genome (%)c
TAA	26.05	28.60	27.8 (8106)
TAG	16.81	21.99	23.6 (6901)
TGA	57.14	49.40	48.6 (14203)

^aMutations and sequences were taken from the HGMD [1].

^bThe control dataset comprises 1,692 genes listed in the HGMD but for which no nonstop mutations have been recorded to date.

^cBased on a total of 29,210 stop codons associated with annotated human genes. Data from the Transterm database http://uther.otago.ac.nz/Transterm.html[16]

The proportion of mutations in the other two types of stop codon was also not significantly different from the corresponding proportions in the set of HGMD control gene sequences (p values, 0.674 for TAA and 0.201 for TAG) and in the human genome at large (p values, 0.753 for TAA and 0.88 for TAG).

The above notwithstanding, we speculated whether TAA codons flanked on the 3' side by A might be hypermutable, since this would in effect constitute a short polyadenine run. It has been reported that bases adjacent to mononucleotide runs in the human genome are characterised by an increased single nucleotide polymorphism frequency [18]. We therefore assessed whether the nucleotide A following the TAA stop codon might influence the mutability of this codon. In agreement with our postulate, the presence of an A adjacent to a TAA stop codon was indeed found to increase the mutability of this codon by 1.4 fold (p = 0.016).

Genes exhibiting an abundance of missense/ nonsense mutations do not harbour a disproportionate number of nonstop mutations

As we have noted above, a total of 18 human genes are known to harbour multiple nonstop mutations. We therefore sought to determine whether this was simply due to a particularly large number of mutations having been reported from these genes. At the time this analysis was performed (October 2010), the HGMD contained mutation data from a total of 2,249 human genes, for which a total of 55,813 missense or nonsense mutations had been reported. No correlation was found, however, between the probability of finding multiple nonstop mutations in a given gene and the total number of missense and nonsense mutations reported for that gene (Pearson's correlation -0.108; p = 0.67). Thus, for example, the largest number of missense/nonsense mutations was reported from the F8 gene (1,217) but only one nonstop F8 mutation has been reported. Conversely, no missense/nonsense mutations have been recorded for the HR gene, even though two nonstop mutations have been identified. Hence we may conclude that the observation that some genes harbour multiple nonstop mutations is unrelated to the number of reported missense and nonsense mutations for those genes.

Gene ontology analysis for genes harbouring nonstop mutations

The Database for Annotation, Visualization and Integrated Discovery (DAVID; http://david.abcc.ncifcrf.gov/) was used to identify enriched biological themes within the group of 87 genes harbouring either multiple or single nonstop mutations [19]. A total of 13 terms were found to be significantly enriched (p < 0.001, without correction for multiple testing) for single mutations (see Supplementary Table S2 (Table 5)). One of the most significantly enriched terms was 'oxidoreductase' (p = 0.005 after Bonferroni correction), which was associated with 11 of the 67 nonstop mutation-harbouring genes identified in the DAVID database [20]. Six terms were found to be significantly enriched (p < 0.001 without correction for multiple testing) for genes harbouring multiple nonstop mutations (Supplementary Table S3 (Table 6)); however, no significant bias in gene function was noted for these genes after correction for multiple testing. A search using all nonstop mutation-containing genes revealed an association with the protein information resource (PIR) term 'deafness' (p = 0.0248), corresponding to six of 86 sequences, although the biological relevance of this observation remains unclear.

Table S2.

Major enriched (p < 0.001) categories for genes harbouring single mutations in stop codons

Category	Term	Count	%	p value	Genes
SP_PIR_KEYWORDS	Oxidoreductase	11	16.42	2.03E-05	HSD3B2, DBT, GCDH, MTHFR, CYP2C19, DHCR7, FMO2, ETFDH, HGD, PNPO, SRD5A2
GOTERM_BP_FAT	GO:0044271 ~ nitrogen compound biosynthetic process	9	13.43	1.40E-04	MOCS2, OTC, SLC25A38, ATP1A2, ASL, ATP6V0A4, NPPA, ATP7B, GCH1
GOTERM_BP_FAT	GO:0008015 ~ blood circulation	7	10.45	2.41E-04	MTHFR, COL1A2, SERPING1, CFTR, ATP1A2, NPPA, GCH1
GOTERM_BP_FAT	GO:0003013 ~ circulatory system process	7	10.45	2.41E-04	MTHFR, COL1A2, SERPING1, CFTR, ATP1A2, NPPA, GCH1
GOTERM_MF_FAT	GO:0050662 ~ coenzyme binding	7	10.5	2.59E-04	DBT, GCDH, FMO2, ETFDH, PNPO, CRYM, GCH1
SP_PIR_KEYWORDS	Blood coagulation	4	5.97	4.62E-04	FGB, F8, SERPING1, PROS1
SP_PIR_KEYWORDS	Flavoprotein	5	7.46	5.00E-04	GCDH, MTHFR, FMO2, ETFDH, PNPO
GOTERM_CC_FAT	GO:0031093 ~ platelet alpha granule lumen	4	5.97	6.78E-04	FGB, F8, SERPING1, PROS1
GOTERM_BP_FAT	GO:0006694 ~ steroid biosynthetic process	5	7.46	6.92E-04	HSD3B2, DHCR7, CFTR, SRD5A2, NR0B1
GOTERM_BP_FAT	GO:0042592 ~ homeostatic Process	12	17.91	7.17E-04	PTHLH, SLC26A4, CTSK, CASR, OTC, IKBKG, SLC25A38, LIPG, ATP1A2, ATP6V0A4, RAD50, ATP7B
GOTERM_BP_FAT	GO:0055114 ~ oxidation Reduction	11	16.42	7.76E-04	HSD3B2, GCDH, MTHFR, CYP2C19, DHCR7, FMO2, ETFDH, F8, HGD, PNPO, SRD5A2
GOTERM_CC_FAT	GO:0060205 ~ cytoplasmic membrane-bounded vesicle Lumen	4	5.97	8.35E-04	FGB, F8, SERPING1, PROS1
GOTERM_CC_FAT	GO:0031983 ~ vesicle lumen	4	5.97	9.52E-04	FGB, F8, SERPING1, PROS1

Table S3.

Major enriched (p < 0.001) categories for genes harbouring multiple mutations in stop codons

Category	Term	Count	%	p value	Genes
SP_PIR_KEYWORDS	DNA-binding	8	42.11	9.77E-04	SOX10, PHOX2B, MECP2, PAX6, HR, SHOX, ATM, FOXE3
SP_PIR_KEYWORDS	Peters' anomaly	2	10.53	0.0047	PAX6, FOXE3
SP_PIR_KEYWORDS	Transcription regulation	7	36.84	0.0082	SOX10, PHOX2B, MECP2, PAX6, HR, SHOX, FOXE3
GOTERM_MF_FAT	GO:0043565 ~ sequence-specific DNA binding	5	26.32	0.0086	SOX10, PHOX2B, PAX6, SHOX, FOXE3
GOTERM_MF_FAT	GO:0003700 ~ transcription factor activity	6	31.58	0.0089	SOX10, PHOX2B, PAX6, HR, SHOX, FOXE3
SP_PIR_KEYWORDS	Transcription	7	36.84	0.0092	SOX10, PHOX2B, MECP2, PAX6, HR, SHOX, FOXE3

Mutability of the DNA sequence encompassing the mutated stop codons

The dinucleotide mutabilities within the pentanucleotides flanking the naturally mutated stop codons and the randomly mutated HGMD control stop codons were calculated in order to determine whether there was any bias in the mutability of the various dinucleotides that occur within the three types of stop codon, taking the flanking nucleotides into consideration. A strong positive correlation was noted between the distributions of mutation-harbouring dinucleotides and randomly simulated mutations within the stop codons of HGMD control sequences (Pearson's correlation r = 0.975; p = 8.04 × 10^-8) with respect to the frequencies of 12 dinucleotides. No significant differences were found in dinucleotide-wise comparisons (Table 2), however, indicating that there is no evidence for a nearest nucleotide-directed bias in stop codon mutability.

Table 2.

The proportion of mutations found within dinucleotides in the mutated stop codon-flanking pentanucleotides as compared with randomly generated HGMD controls

Dinucleotide	Occurrence of nonstop mutations in mutated sequence dataset (%)	Occurrence of random mutations within HGMD control sequences (%)	p value (after correction for multiple testing)
AA	25 (21.00)	348 (20.57)	0.907
AC	6 (5.04)	71 (4.196)	0.636
AG	18 (15.13)	303 (17.91)	0.534
AT	16 (13.44)	238 (14.066)	1.0
CT	23 (19.33)	318 (18.79)	0.903
GG	1 (0.84)	35 (2.07)	NA*
GA	32 (26.89)	424 (25.06)	0.663
GC	1 (0.84)	25 (1.48)	NA*
GT	21 (17.65)	259 (15.31)	0.511
TT	10 (8.4)	155 (9.16)	1.0
TA	36 (30.25)	606 (35.82)	0.235
TG	49 (41.18)	602 (35.58)	0.236

*Sample size of mutated sequences too small to generate p values. (Note that four dinucleotides (CC, CA, CG and TC) cannot occur in conjunction with any stop codon-spanning pentanucleotide and were therefore omitted from this analysis.)

Sequence context around stop codons that have been subject to nonstop mutations

In eukaryotic cells, the translational efficiency and readthrough potential of the three different stop codons have been reported to vary as a consequence of the influence of the surrounding nucleotide sequence [21-26]. With respect to human gene sequences, Ozawa et al. reported that the first three nucleotide positions after the stop codon are highly conserved, with G and A predominating at the +1 position, and C at the +4 position [24]. Again in the context of human genes, Liu reported a preponderance of C immediately upstream of the stop codon (at position -1) and G or T at position +1 [26]. Our HGMD control dataset exhibits similar sequence characteristics to those stop codon datasets reported by Ozawa et al [24]. and Liu [26]. This sequence bias flanking human stop codons represents, in effect, a consensus sequence for the translational termination signal that extends beyond the confines of the stop codon itself. With this in mind, we next examined the flanking sequences of the mutated stop codons in order to ascertain whether the local DNA sequence context could influence the likelihood that the associated nonstop mutations would come to clinical attention.

We first examined the frequencies of six nucleotides on either side of the stop codon in both 87 mutated and 1,692 control sequences. When considering the entire stop codon dataset (which includes sequences flanking the TAA, TAG and TGA stop codons on the 5' side at positions -1 to -6, and on the 3' side at positions +1 to +6), we observed a significant paucity in G at the -2 position (p = 0.0063) (Supplementary Table S4 (Table 7)). When considering the three types of stop codon separately, there was a significant excess (p = 0.0016) of G and a significant paucity of A (p = 0.0047) two nucleotides downstream of TAA stop codons (Table 3). Similarly, in the regions flanking TGA stop codons, we noted a significant excess of T at the +6 position (p = 0.0094) (Supplementary Table S5 (Table 8)). Although it is conceivable that TAA stop codons with a G at +2 and TGA stop codons with a T at +6 may be more prone to mutate than other sequences, we prefer the alternative explanation, that mutations occurring in TAA and TGA stop codons embedded within these sequence contexts are more likely, for whatever reason, to come to clinical attention. No significant difference was noted between the flanking regions of mutated and control TAG stop codons (data not shown).

Table S4.

Frequency of nucleotides present in regions flanking the 87 mutated stop codons.

Base	-6	-5	-4	-3	-2	-1	1	2	3	4	5	6
A	25	25	12	25	29	16	31	20	19	13	28	20
C	18	20	27	26	24	27	15	26	26	25	22	28
G	24	23	28	14	7	24	28	28	19	21	21	19
T	20	19	20	22	27		20	13	23	28	16	20

Position 0, corresponding to the stop codon, is not shown. Nucleotide frequencies that are significantly higher/lower (p < 0.01) in comparison to the HGMD control dataset are shown underlined

Table 3.

Frequency of nucleotides present in regions flanking the mutated TAA stop codon (N = 40).

Base	-6	-5	-4	-3	-2	-1	1	2	3	4	5	6
A	14	13	7	10	10	5	17	6	11	7	18	11
C	7	9	15	10	13	13	9	10	12	13	9	14
G	8	10	11	5	12	12	11	15	9	9	7	8
T	11	8	7	15	10	10	3	9	8	11	6	7

Position 0, corresponding to the stop codon, is not shown. Nucleotide frequencies that are significantly higher/lower (p < 0.01) in comparison with the HGMD control dataset are shown underlined

Table S5.

Frequency of nucleotides present in regions flanking the mutated TGA stop codon (N = 35).

Base	-6	-5	-4	-3	-2	-1	1	2	3	4	5	6
A	9	9	4	12	12	9	12	9	8	6	10	6
C	7	8	10	13	10	11	4	12	8	9	8	9
G	12	10	11	7	5	9	13	10	9	9	8	8
T	7	8	10	3	8	6	6	4	10	11	9	12

Position 0 corresponding to the stop codon is not shown. Nucleotide frequencies that are significantly higher/lower (p < 0.01) in comparison to the HGMD control dataset are shown in bold

The nucleotide frequencies of the flanking regions of the stop codons that harboured single and multiple mutations were also analysed separately, and compared both with the HGMD control dataset and with each other. Supplementary Table S6 (Table 9) presents the comparison of sequences containing only single mutations with sequences in the HGMD control dataset. These sequences exhibit a significant paucity of G at the -2 (p = 0.0078) and -3 (p = 0.0096) positions relative to the controls. However, no significant difference was apparent between those sequences harbouring multiple mutations and controls (data not shown).

Table S6.

Frequency of nucleotides occurring within regions flanking mutated stop codons harbouring single nonstop mutations.

Base	-6	-5	-4	-3	-2	-1	1	2	3	4	5	6
A	21	19	11	21	21	14	26	15	16	11	23	16
C	14	17	19	19	19	19	11	19	22	21	18	23
G	19	18	22	9	5	17	21	23	13	14	14	14
T	14	14	16	19	23	18	10	11	17	22	13	15

Position 0 corresponding to the stop codon is not shown. Frequencies which are significantly higher/lower (p < 0.01) in comparison with corresponding HGMD controls are shown underlined

Sequence context around the next in-frame stop codon downstream of the stop codons that have been subject to nonstop mutations

The DNA sequences around the next downstream in-frame stop codon were analysed using the same method as described above. The regions flanking the next in-frame stop codons located downstream of the mutated stop codons were compared with their counterparts in the HGMD control sequences. This analysis was performed for each of the three codon types (TAA, TAG and TGA) separately and for all the mutated stop codons combined. When analysing all downstream in-frame stop codons together, a significant excess of T was observed at the +6 position (p = 0.0051; Supplementary Table S7 (Table 10)). When the three types of stop codon were examined separately, the only significant difference noted was in the sequences surrounding the next in-frame TGA stop codons, where an excess of C was found at the +6 position (p = 0.0019; Supplementary Table S8 (Table 11)), as compared with the TGA codons in the control dataset. Taken together, these findings suggest that, in general, there is no obvious difference between the sequences surrounding the next downstream in-frame stop codons and their counterparts in the HGMD control sequences. However, it is possible that the nucleotide occurring at position +6 relative to the downstream alternative in-frame stop codon could influence the likelihood that a given nonstop mutation might come to clinical attention.

Table S7.

Frequencies of nucleotides flanking the next downstream in-frame stop codon in mutated sequences.

Base	-6	-5	-4	-3	-2	-1	1	2	3	4	5	6
A	9	10	14	16	8	9	13	10	17	14	16	15
C	13	11	7	7	12	17	12	17	11	16	9	15
G	8	15	11	9	8	10	12	12	9	9	10	12
T	16	10	14	15	19	11	11	9	10	8	12	5

Position 0, corresponding to the stop codon, is not shown. Frequencies which are significantly higher/lower (p < 0.01) in comparison with the corresponding HGMD controls are shown underlined

Table S8.

Frequencies of nucleotides flanking the next downstream in-frame TGA stop codon.

Base	-6	-5	-4	-3	-2	-1	1	2	3	4	5	6
A	4	6	9	9	3	1	5	6	7	6	9	4
C	7	8	4	3	6	11	7	10	8	10	5	12
G	6	8	6	4	5	7	8	4	4	4	4	6
T	8	3	6	9	11	6	6	6	6	5	7	3

Position 0, corresponding to the stop codon, is not shown. Frequencies which are significantly higher/lower (p < 0.01) in comparison with the corresponding HGMD controls are shown in bold

The distance to the next stop codon is a key determinant of whether a given nonstop mutation will come to clinical attention

We next explored the possibility that the distance from the mutated stop codon to the next in-frame stop codon downstream might influence the likelihood that a given nonstop mutation would come to clinical attention. We reasoned that the greater the distance between the mutated stop codon and the next viable alternative downstream stop codon, the more likely it would be that the mRNA/ protein would be unstable/degraded and hence that the nonstop mutation would give rise to a deleterious and clinically observable phenotype. Conversely, the presence of an alternative in-frame stop codon in the immediate vicinity of the mutated natural stop codon could yield a near-normal or at least ameliorated clinical phenotype. Since such phenotypes would be less likely to come to clinical attention, we might therefore expect there to be a paucity of alternative in-frame stop codons in the immediate vicinity of the mutated stop codons as compared with their counterparts derived from the HGMD control sequences. This was, indeed, what was found when mutated and control sequences were compared. Although a relatively strong correlation was noted between the distributions of the distances (Pearson's correlation 0.75; p = 0.008), the number of alternative in-frame stop codons was found to be significantly lower among the mutated sequences than in the controls, but only in the range 0-49 nucleotides downstream of the mutated stop codon (p = 7.81 × 10^-4). This implies that at least some stop codon mutations with alternative stop codons 0-49 nucleotides downstream of the mutated stop codon will not have come to clinical attention, possibly because they will have given rise to stable mRNAs that were (i) not subject to nonstop mRNA decay and (ii) consequently translated into proteins of near-normal length and biological function.

Although the number of in-frame stop codons in the HGMD control dataset approximates to a Zipfian distribution, and steadily decreases with increasing distance from the original stop codon (Figure 1), we noted a significant excess (by comparison with the controls) of downstream in-frame stop codons within 150-199 nucleotides of the mutated stop codon (p = 8.551 × 10^-4). A signifi-cant (p = 6.558 × 10^-6) excess of in-frame stop codons within 100-299 nucleotides was also noted as compared with the HGMD controls. One possible explanation could be that the recruitment of these alternative stop codons at an intermediate distance from the mutated stop codon may serve to trigger nonstop mRNA decay, thereby dramatically decreasing the amount of protein product produced and giving rise to a clinical phenotype that is more likely to come to clinical attention. Confirmation or otherwise of this postulate must await the emergence of a clearer understanding of the mechanism of nonstop mRNA decay in mammalian cells.

Figure 1.

Distribution of distances (in nucleotides) to the next in-frame stop codon in mutated and HGMD control DNA sequences.

Figure 2 depicts a comparison of the single (N = 69 in 69 genes) and multiple (N = 18 in 18 genes) nonstop mutations with respect to the distribution of distances to the next downstream in-frame stop codon in each sequence. If those nonstop mutations which occurred within sequences lacking alternative in-frame stop codons in the range 0-49 nucleotides from the mutated codon did indeed display an increased likelihood of coming to clinical attention, then we might reasonably expect those sequences harbouring multiple nonstop mutations to exhibit an even greater paucity of alternative downstream in-frame stop codons in this size range relative to those sequences harbouring only one nonstop mutation. Although only 18 sequences harboured multiple nonstop mutations (yielding very small sample sizes in each distance category and precluding formal statistical assessment), only one (corresponding to 5.5 per cent of the total number of multiple nonstop mutations) of these sequences bearing multiple nonstop mutations was characterised by an alternative in-frame stop codon within 50 nucleotides downstream of the mutated stop codon, as opposed to 21 sequences with single mutations (30.9 per cent of the total number of single nonstop mutations) (Figure 2). This finding is therefore wholly compatible with our postulate that nonstop mutations occurring within DNA sequences lacking alternative in-frame stop codons in the immediate vicinity of the mutated stop codon display an increased likelihood of coming to clinical attention, possibly because the resulting extended mRNAs are more likely to be subject to nonstop mRNA decay.

Figure 2.

Distribution of distances to the next in-frame stop codon in DNA sequences harbouring single (N = 69) and multiple (N = 18) mutations.