Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2012 Dec 20.
Published in final edited form as: Biochim Biophys Acta. 2011 Jul 1;1813(10):1836–1844. doi: 10.1016/j.bbamcr.2011.06.012

HIV-1 Tat binds to SH3 domains: cellular and viral outcome of Tat/Grb2 interaction

Slava Rom 2, Marco Pacifici 1, Giovanni Passiatore 3, Susanna Aprea 4, Agnieszka Waligorska 1, Luis Del Valle 1, Francesca Peruzzi 1
PMCID: PMC3527102  NIHMSID: NIHMS309924  PMID: 21745501

Abstract

The Src-homology 3 (SH3) domain is one of the most frequent protein recognition modules (PRMs), being represented in signal transduction pathways and in several pathologies such as cancer and AIDS. Grb2 (growth factor receptor-bound protein 2) is an adaptor protein that contains two SH3 domains and is involved in receptor tyrosine kinase (RTK) signal transduction pathways. The HIV-1 transactivator factor Tat is required for viral replication and it has been shown to bind directly or indirectly to several host proteins, deregulating their functions.

In this study, we show interaction between the cellular factor Grb2 and the HIV-1 trans-activating protein Tat. The binding is mediated by the proline-rich sequence of Tat and the SH3 domain of Grb2. As the adaptor protein Grb2 participates in a wide variety of signaling pathways, we characterized at least one of the possible downstream effects of the Tat/Grb2 interaction on the well-known IGF-1R/Raf/MAPK cascade. We show that the binding of Tat to Grb2 impairs activation of the Raf/MAPK pathway, while potentiating the PKA/Raf inhibitory pathway. The Tat/Grb2 interaction affects also viral function by inhibiting the Tat-mediated transactivation of HIV-1 LTR and viral replication in infected primary microglia.

Keywords: HIV-1 Tat, Grb2, signal transduction, viral replication, HIVE, SH3 domain

1. Introduction

Protein-protein interaction mediated by a conserved sequence motif in one protein and a protein recognition module (PRM) in another is a common mechanism of assembling protein complexes participating in signal transduction pathways. Src Homology 3 (SH3) modules are conserved elements of about 60 amino acids present in a large number of proteins which participate in a variety of biological processes [1, 2]. Although SH3 domains generally recognize a PxxP motif in their binding partners, individual SH3 domains might possess distinct specificities for putative ligands. At least part of this specificity is thought to be determined by the amino acids flanking the core sequence [3, 4], making the overall three-dimensional structure of the PxxP-bearing protein specific only for certain SH3-carrying partners.

While protein-protein interactions mediated by SH3 domains participate in many cellular processes, one of the best characterized signaling pathways is the tyrosine kinase receptor mediated Ras activation. Growth factor receptor-binding protein-2 (Grb2), consisting of three domains, two SH3 and a single SH2 domain, is one of the central factors in the Ras signaling cascade. Grb2 can recruit Ras guanine nucleotide exchange factor, Sos, to the activated tyrosine kinase receptor at the plasma membrane, where Sos activates Ras [5]. Activated Ras then leads to activation of MAPK signaling cascade [6]. Besides its critical role in normal development [7], Grb2-mediated mitogenic signals have been implicated in several human tumors (reviewed in [8]).

The transactivating factor Tat is an 86–101 amino acid polypeptide encoded by the HIV-1 virus [9]. Several studies have demonstrated the importance of HIV-1 Tat in the viral replication cycle and in the pathogenesis of AIDS [10, 11]. Tat displays several important biological activities affecting uninfected and infected cells by a paracrine/autocrine mechanism due to secretion of Tat from infected cells and its uptake by uninfected neighboring cells [12–14]. Tat has been shown to modulate expression and activity of several cellular factors deregulating a variety of signal transduction pathways [15]. For instance the modulation of signaling pathways such as the MAPK or the PI3-K pathways by Tat are well documented [16–26]. Given the ability of Tat to directly interact with host factors, we sought to examine the amino acid sequence of this viral protein for the presence of protein-protein recognition elements. Similarly to another HIV protein, Nef [27], Tat also contains proline-rich motives which are putative SH3-binding domains, one at the N-terminal and the other at the C-terminus of the protein. In a SH3 domain binding screening, we found that Grb2-derived peptides gave the highest probability score of binding to Tat. GST-pull down assay further revealed a preferred binding of Tat to the C-terminal SH3 domain of Grb2. The outcome of Tat/Grb2 interaction was evaluated in terms of cellular and viral activities. In respect to cellular function, Tat/Grb2 interaction resulted in the attenuation of the MAPK pathway while potentiating the Raf inhibitory pathway. Of interest, in terms of viral functions, we found that Tat/Grb2 interaction decreased the activity of Tat on the HIV-1 LTR, as determined by reduced levels of p24 in the medium of HIV-1 infected human microglia.

Altogether our results provide evidence for a direct interaction of Tat with Grb2, and possibly other SH3-bearing proteins, suggesting a broad-spectrum mechanism for Tat-mediated deregulation of signaling pathways.

2. Materials and Methods

2.1 Cell culture, transfection, infection, recombinant proteins and inhibitors

The human Glioblastoma cell line LN229 was maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (GIBCO Invitrogen Co., Carlsbad, CA). Primary human fetal microglia cells were isolated and cultured as previously described [28]. Preparation of HIV-1, strain JRFL, stock and infection of primary microglia were performed at a multiplicity of infection (MOI) of 0.1, as described previously [28]. For transient expression experiments, LN229 cells were seeded on 60 mm dishes (BD Falcon™, Oakville, Ontario, Canada) at a density of 5 × 105 cells/plate, and the transfection was performed using FuGENE 6 Transfection reagent (Roche Diagnostics Corp., Indianapolis, IN) according to manufacturer’s instructions. When required, 24 hours after transfection cells were washed with PBS twice and starved for 24 hours in DMEM without FBS. Stimulation was done by IGF-1 (40 ng/ml; Invitrogen, Carlsbad, CA) for 0, 2 and 10 minutes and was stopped by medium removal and placing on ice.

Recombinant Tat101 was from Immunodiagnostics (Woburn, MA). Inhibitors, LY 294002 and H-89, were purchased from BioMol (BIOMOL Int., Plymouth Meeting, PA).

2.2 Antibodies and Western blots

Monoclonal antibody specific to Grb2 was purchased from BD Transduction Laboratories™ (BD Biosciences, San Jose, CA). Antibodies specific to phospho-Akt (Ser473), Akt, phosphorylated forms of Erk1/2 (Thr202/Tyr204), total Erk1/2, phospho-c-Raf (Ser259), total IFG-IR and Gab-1 were purchased from Cell Signaling Inc. (Danvers, MA). Polyclonal antibody specific to total c-Raf protein was purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

Cells were collected by scraping the plates in the presence of PBS, followed by centrifugation and lysis of the cell pellet in the appropriate volume of RIPA buffer (50 mM Tris pH 7.4, 1% NP-40, 0.25% sodium deoxycholate, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM PMSF, 1 mM sodium orthovanadate, phosphatase inhibitors and protease inhibitor cocktails). Fifteen to fifty micrograms of whole cell lysates were separated on a 4–15% SDS-PAGE (BioRad, Hercules, CA). Sample proteins separated by SDS-PAGE were transferred onto nitrocellulose membranes (BioRad) using BioRad semi-dry blotting system (BioRad, Hercules, CA).

2.3 Immunohistochemistry

Five samples of formalin-fixed, paraffin-embedded HIV-Encephalopathy samples were collected from the NIH funded, HIV National tissue consortium at the Manhattan Brain Bank, Mount Sinai School of Medicine. All samples were from the cortex and sub-cortical white matter of the frontal lobe, and histopathologically all contain microglial nodules and perivascular cuffs of inflammatory cells, including giant multinucleated cells, pathognomonic of HIV-Encephalitis. According to the clinical data provided by the HIV Brain Bank, all five patients showed signs of dementia, ranging from mild to moderate.

For immunohistochemistry, four micron thick sections were cut using a microtome and placed on charged glass slides. Immunohistochemistry was performed using the avidin-biotin peroxidase methodology, according to the manufacturer’s instructions (Vector Laboratories, Burlingame, CA). Our protocol includes deparaffination, rehydration in alcohol up to water, antigen retrieval in citrate buffer pH 6.0 at 98°C, endogenous peroxidase quenching and blocking in normal horse serum for 2 hours at room temperature. Primary antibodies used included a mouse monoclonal anti-Grb2 (Santa Cruz; 1:100 dilution) and a mouse monoclonal anti-Tat (ImmunoDiagnostics Inc, Woburn, MA; 1:500 dilution). After rinsing with PBS, secondary biotinylated antibodies were incubated for 1 hour (1:200 dilution), followed by avidin-biotin peroxidase complexes incubation (ABC Elite kit, Vector Laboratories, Burlingame, CA) and developing with Diaminobenzidine (DAB, Boehringer Ingelheim, Ingelheim, Germany), counterstained with hematoxylin and coverslipped.

For double labeling, the first steps of the protocol are similar to the protocol described above. However, after incubation with the first primary antibody, a secondary fluorescein tagged antibody was incubated for 1 hour at room temperature, and after rinsing thoroughly, the second primary antibody was incubated overnight. Finally a second secondary antibody tagged with rhodamine was incubated for 1 hour. Sections were coverslipped with an aqueous based mounting media containing DAPI and visualized under a fluorescent microscope (Olympus BX61 equipped with a DP72 camera, Center Valley, PA). Deconvolution of selected pictures was performed using the deconvolution software Slide Book 5 (Intelligent Imaging Innovations, Denver, CO).

2.4 Plasmids and GST-fusion protein construction

GST-fusion Grb2 full length and the various truncated constructs (ΔN-SH3, ΔC-SH3 and ΔNC-SH3) were generated by PCR using as template the sequence of human Grb2 contained into the pGex-2T-Grb2 plasmid (a kind gift of Dr. Robert J. Sheaff). The primers were: Grb2 Forward 5′-ACGGATCCATGGAAGCCATCGCCAAATATGAC, Grb2 Reverse 654 Stop 5′-ACCTCGAGTTAGACGTTCCGGTTCACGGGGG, Grb2 Δ1-69 Forward 5′-ACGGATCCAT GGAAGAAATGCTTAGCAAACAGCGG, and Grb2 Δ128-198 Reverse-stop 5′-ACCTCGAG CCGCAGGAATATCTGCTGGTTTCTGAGACAGATGT. Those primers were used in various combinations to obtained the desired amplified sequences that were subsequently cloned into pGex-5x1 expression vector (GE Healthcare Bio-Sciences Corp. Piscataway, NJ) between BamHI and XhoI sites (labeled in bold). Wild type and deletion mutants of Grb2 were also subcloned into pmCherry vector (BD Biosciences Clontech, Mountain View, CA) between NotI and EcoRI sites.

The GST-Tat (truncated Tat86, Tat72, Tat50) constructs have been previously described [29]. To generate GST-Tat101 wild type fusion protein the PCR primers were: Forward 5′-ACAAGGTACCATGGAGCCAGTAGATCCTAGC, and Reverse 5′-ACGCGGCCGCTCAAGCGCTCGGATCTGTCTCTG.

To generate pEYFP-Tat101 fusion protein, the PCR primers were: Forward 5′-ACAAGGTACCATGGAGCCAGTAGATCCTAGC, and Reverse 5′-ACGGATCCTCAAGCGCTCGGATCTGTCTCTG. The PCR product was cloned into pEYFP-C1 plasmid (BD Biosciences Clontech, Mountain View, CA) between KpnI and BamHI sites.

2.5 GST-pull down assays

Expression and purification of GST fusion proteins were performed according to manufacturer’s instructions. 300–400 μg of protein lysates from LN229 cells were incubated with purified GST-Tat fusion proteins (1 μg) bound to glutation-agarose beads or from Tat-expressing LN229 cell lysates were incubated with GST-Grb2 fusion proteins bound to glutation-agarose beads for 2 h at 4°C at rotator. The glutation-agarose resin was centrifuged at 14,000 × g for 3 min and washed 3 times with ice-cold RIPA buffer. Precipitated proteins were suspended in 2 × SDS protein-loading buffer, boiled for 5 min, and subjected 4–15% SDS-PAGE; this was followed by electrotransfer and immunoblot analysis as described above.

2.6 SH3 domain prediction

Prediction of SH3 domain interacting sites was performed using SH3-Hunter (http://cbm.bio.uniroma2.it/SH3-Hunter/) [30].

2.7 Protein Kinase A (PKA) kinase assay

PKA activity was measured using commercially available kit (PKA assay kit, Upstate, Lake Placid, NY), according to manufacturer instructions. In brief, LN229 cells were transfected, serum starved for 24 hrs and IGF-1 stimulated, as described above. Prior to lysis cells were washed twice with ice-cold PBS, scraped and lysed with RIPA buffer. For measurement of PKA activity in cellular extracts, 60 μg protein lysates were incubated with kemptide, ATP, cAMP and 2 μCi of [γ-32P] ATP in the presence of PKC/CaMK inhibitor cocktail for 10 minutes at 30°C. Samples from each reaction were spotted on P81 phosphocellulose membrane, and the reaction was stopped by immersion of the membrane discs in 0.75% phosphoric acid. Amount of incorporated [γ-32P] into the substrate was counted using multipurpose scintillation counter (Beckman LS6500).

2.8 HIV-1 LTR transactivation assay

LN229 cells were co-transfected with pEYFP-Tat101, pmCherry-Grb2 wild type or truncated mutants, an pHIV LTR –Firefly luciferase reporter plasmid [31] and a Renilla luciferase control pRL-TK plasmid (Promega, Madison, WI) using Fugene 6 (Roche Diagnostics Corp., Indianapolis, IN). Cells were collected 24 hours after transfection and subjected to luciferase assay, as per manufacturer’s recommendations (Promega, Madison, WI). Firefly values were normalized with Renilla as a mean of transfection efficiency.

2.9 Statistics

Results were analyzed by an unpaired, two- or one-sided Student’s t-test. P-values ≤ 0.05 were considered statistically significant.

3. Results

3.1 Tat protein contains two putative SH3 domain-binding sites

Bioinformatic analysis using SH3 Hunter web server (http://cbm.bio.uniroma2.it/SH3-Hunter/) [30] revealed the presence of two putative SH3 binding domains in the amino acid sequence of HIV-Tat full length. Given an input query protein sequence, the server identifies peptides containing poly-proline binding motifs (PxxP) and associates them to a list of SH3 domains, in order to create peptide-domain pairs. As shown in Figure 1A Tat protein sequence contains two putative SH3 domain binding sites residing in the N-terminal and C-terminal parts of the protein between amino acids 3–8 and 81–86, respectively. According to the SH3 Hunter program Tat is predicted to interact with RNA-binding protein Fus1 with significantly high score of 0.976 and reliability (sensitivity and precision) of 95% and 60%, respectively (Fig. 1B). With a slightly lower score of 0.967, the C-terminus of Tat could interact with growth factor receptor-bound protein 2 domain C (Grb2-C), Grb2 homolog in C. elegance (Sem5), Endophilin-A1 (End2) and Endophilin-A3 (End3) proteins with sensitivity of 57% and with precision of 70%. Further, Tat is also predicted to interact with much lower scores but with higher sensitivity with Grb2-C, signal transducing adaptor molecule SH3 domain and ITAM motif 1 (STAM-1), and End2. Most of the proteins predicted to bind poly-proline motif located between 81–86 amino acids of Tat protein. However, two domains, End2 and Grb2-C, showed ability to bind the proline rich motif of Tat located in the N-terminus.

Figure 1. Tat protein contains two putative SH3 domain-binding sites.

Figure 1

Open in a new tab

A) Amino acid sequence of Tat showing two possible SH3 binding sites (in bold). B) List of SH3 domain containing proteins predicted to bind TAT using SH3 hunter web server (http://cbm.bio.uniroma2.it/SH3-Hunter/). First column represents amino acid sequence of peptide and its location in the Tat protein. Second column gives names of domains of interacting proteins. The last three columns in the output define respectively the significance (score) and the reliability (sensitivity and precision) of the prediction.

3.2 Tat directly interacts with Grb2 protein

Since the SH3 domains of Grb2 were recurrent in the list we decided to test Tat-Grb2 interaction in vitro by GST-pull down assay. The full-length Tat101 and three deletion mutants were cloned into the pGex plasmids (Figure 2A). Tat101 and Tat1-86 constructs comprised both SH3 putative binding sites; Tat1-50 contained the N-terminal putative SH3 binding site, whereas Tat50-72 was depleted of both. Figure 2B shows that Tat101 (full length) as well as Tat1-86 deletion mutant were able to pull down Grb2 protein form LN229 whole cell lysate. Some degree of binding was detected with GST- Tat1-50, while the Tat50-72 mutant, lacking both PxxP motifs, failed to pull down Grb2. Next, we generated Tat mutants (pEYFP-Tat101) in which the proline residues within the SH3 binding domains were substituted with alanines as follows: single SH3 mutants had Prolines 3 and 6 (P3/6A) and 81 and 84 (P81/84A) changed, respectively; the double mutant contained all four proline residues mutated to alanines (P3/6/81/84A). LN229 cells were transfected with these mutants and with the control Tat wild-type. Results of GST-pull down assays show that both single pEYFP-Tat-SH3 mutants were efficiently pulled-down by GST-Grb2 (Figure 2C, lanes 2 and 3), although less efficiently than wild-type Tat (lane 5). The double mutant of Tat, in which a total of four proline residues were changed to alanines (P3/6/81/84A), was not pulled-down by Grb2 (Figure 2C, lane 4), confirming the prediction analysis that both putative SH3 binding domains of Tat may bind Grb2.

Figure 2. Tat directly interacts with Grb2.

Figure 2

Open in a new tab

A) Scheme of GST-Tat full-length and various mutants cloned into pGex-5x-1 plasmid for GST-fusion protein expression. B) Western blot to detect Grb2 pulled-down using wild type Tat101 or the various mutants. C+ represents whole cell lysate (15 μg). C) GST-Grb2 pull-down of Tat from cells transfected with Tat bearing a single SH3-binding domain mutated (P3/6A and P81/84A, respectively), the double mutation (P3/6/81/84A) or the wild type Tat (WT). D) Scheme of GST-Grb2 mutants. Grb2 full-length and three mutants ΔN, ΔC, ΔN/C were cloned into pGex-5x-1 plasmid for GST-fusion protein expression. E) Western blot to detect Grb2 interaction with Tat in cells transfected with Tat101. F) Immunoblot shows that Grb2 wt and Grb2-SH3-C can efficiently pull down Gab1, while recombinant Tat competes with Gab1 for the binding to Grb2 (Panel G).

Grb2 protein carries two SH3 domains, SH3-1 (N-terminal) and SH3-2 (C-terminal), separated by one Src homology 2 (SH2) domain positioned in the middle of the protein. We cloned three GST-tagged truncated fragments of Grb2 consisting of either SH3-1 (ΔC) or SH3-2 (ΔN), or depleted of both SH3 domains (ΔN/C) as well as the full length (WT) (Figure 2D). The four Grb2 expressing constructs were examined for their ability to pull down Tat from Tat-expressing cells (Figure 2E). Results confirmed that Grb2 full length directly interacted with Tat, and, among the mutants, the C-terminal SH3 domain of Grb2 (ΔN) pulled down Tat more efficiently than the N-terminal domain (ΔC) or the mutant lacking both SH3 domains (ΔN/C).

The Grb2-associated binder 1 (Gab1) protein has been reported to bind with high affinity to the C-terminal SH3 domain of Grb2 [32]. The specificity of such Grb2/Gab1 interaction was confirmed in our system by GST pull-down experiments showing that Gab1 can be efficiently pulled down by Grb2-SH3-C but not Grb2-SH3-N or Grb2-SH2 (Figure 2F). We then performed a competition assay in which Gab1 was pulled down by GST-Grb2-SH3-C in the absence or presence of recombinant Tat (Figure 2G). As expected, Grb2-SH3-C pulled down Gab1 in the absence of Tat; however, addition of 1 μg of recombinant Tat efficiently competed with Gab1 for the binding to the C-terminal domain of Grb2.

Taken together these results suggest that the interaction between Tat and Grb2 is mediated by the PxxP motifs of Tat and the C-terminal SH3 domain of Grb2.

The Tat-Grb2 interaction was additionally evaluated in cases of HIV-Encephalitis. Figure 3 shows representative images of HIVE brain tissue samples immunolabeled with Grb2 (Fig. 3A) and Tat (Fig. 3B and C). Of note, Tat-positive cells, mainly reactive astrocytes, are present only in areas of inflammation (panel B), while areas within the same brain sample which do not show signs of inflammation are also negative for Tat expressing cells (panel C). Immunofluorescence performed on a consecutive section demonstrates colocalization between Tat and Grb2 in the cytoplasm of reactive astrocytes (Fig. 3E, D, and F); while immunohistochemistry for p24 (Panel G) shows areas of viral replication. Immunofluorescence analysis further confirmed that p24-positive cells are also positive for Tat (Figure 3H-J).

Figure 3. Detection of Grb2 and HIV-1 Tat in HIV-Encephalitis.

Figure 3

Open in a new tab

Immunohistochemistry analysis shows the presence of Grb2 in the cytoplasm of reactive astrocytes in areas of neuro-inflammation (Panel A). The HIV-1 transactivator protein Tat is detected in endothelial cells, perivascular macrophages and robustly in the cytoplasm of reactive astrocytes in areas of encephalitis (Panel B). In contrast, non-affected areas of the brain within the same section show no expression of Tat (Panel C). Double labeling corroborates the modest presence of Grb2 (Panel D, rhodamine), and abundant expression of Tat (Panel E, fluorescein), in the cytoplasm of astrocytes, where the two proteins co-localize (Panel F), as demonstrated by deconvolution imaging (Inserts). G) Immunohistochemistry analysis to detect p24 in HIVE. H, I, J) Immunolabeling shows the presence of Tat in reactive astrocytes also positive for p24. Original magnification for all panels is 600x and 1000x in the inserts.

Immunofluorescence analysis of Tat/Grb2 interaction was additionally performed on LN229 cell cultures. Panels A through F of Figure 4 show representative images of Grb2 immunolabeling (in red) in cells transfected with the control PEYFP or YFP-Tat plasmids (in green), respectively. The colocalization of Tat with Grb2 is enhanced in these cells due to the subcellular distribution of Tat, which takes Grb2 to the nuclear compartment.

Figure 4. Co-localization of Grb2 and Tat in LN229 cells.

Figure 4

Open in a new tab

Representative images show Tat and Grb2 co-localization in LN229 cells transfected with pEYFP and pEYFP-Tat, respectively. Note the diffuse cytoplasmic immunolabeling of Grb2 in control pEYFP transfected cells (Panels B and C), and its nuclear traslocation when Tat is present (Panels E and F). Original magnifications 100X.

3.3 Impairment of ERK1/2 activation by Tat

Next, we asked whether the direct binding of Tat with Grb2 was functional. To this end we have utilized the LN229 Glioblastoma cell line and the IGF-1R signaling system. We first examined the phosphorylation status of ERK1/2 in Tat-expressing Glioblastoma cells upon IGF-1 stimulation. LN229 cells were transfected with pEYFP-Tat or pEYFP, as a control, serum-starved for 24 hours and then stimulated with IGF-1 for 2 and 10 minutes (Figure 5). Results from Western blot analysis show basal levels of phospho-ERKs at time 0. IGF-1 stimulation in PEYFP-transfected cells resulted in increased activation of ERKs after 2 or 10 minutes of stimulation; whereas less phosphorylation of ERK1/2 was observed in Tat-transfected cells at the same time points. Reduced phosphorylation of ERKs might be due, at least in part, to the Tat-mediated nuclear translocation of Grb2, as we observed by immunofluorescence (Figures 4). No difference was observed in respect to phospho-Akt levels (data not shown). Expression of Tat in LN229 did not affect levels of expression of IGF-IR (Figure 5, lower panel).

Figure 5. Inhibitory effect of Tat in IGF-IR-mediate ERK1/2 phosphorylation.

Figure 5

Open in a new tab

Representative Western blot showing activation of MAP kinases Erk1/2 by IGF-1 (40 ng/ml) in pEYFP or pEYFP-Tat expressing cells at the time points of 0, 2 and 10 minutes (upper panel). Total ERKs indicates equal loading (middle panel). Expression of IGF-IR is not affected by Tat (lower panel).

3.4 Tat-mediated increased phosphorylation of c-Raf S259 inhibitory site involves the binding of Tat with Grb2

To get inside the functional implication of Grb2-Tat interaction, we analyzed molecules in the Raf-MEK-MAPK pathway. No changes between Tat-transfected and control cells were observed when we studied the phosphorylation status of c-Raf on the activation sites Y340/Y341 (data not shown). We then determined the levels of c-Raf phosphorylation on Serine 259 (S259) inhibitory site in LN229 cells transfected with pEYFP, pEYFP-Tat, pEYFP-Tat and pmCherry-Grb2 or pmCherry-Grb2 only. Cells, transfected and controls, were serum-starved for 24 hours prior to stimulation with IGF-1 for two and ten minutes (Figure 6A). No phosphorylation was observed in control (pEYFP-transfected cells) at time zero, and addition of IGF-1 resulted in higher levels of phosphorylated c-Raf, confirming previous studies [33]. Tat expressing cells showed high level of phosphorylation of c-Raf (S259) without IGF-1 stimulation and treatment with IGF-1 did not further increase phospho-c-Raf levels (Figure 6A, lanes 4–6). If Tat/Grb2 interaction is involved in increased levels of phospho-c-Raf, overexpression of Grb2 might restore IGF-1-dependent phosphorylation of c-Raf on S259. PmCherry-Grb2 vector was transfected alone or together with pEYFP-Tat. Figure 6A (lanes 7–9) shows that overexpression of Grb2 was able to reduce phosphorylation of c-Raf (S259) in Tat-expressing cells. In general, overexpression of Grb2 alone resulted in a slightly higher level of phospho-c-Raf S259 at time 0, but, upon induction with IGF-1, the cells behaved essentially as the controls (Figure 6A, lanes 10–12). Next, we determined which SH3 site of Grb2 is more important in preventing the Tat-mediated increase of phospho-c-Raf S259. LN229 cells were transfected with Tat together with Grb2 full-length and the three mutants, ΔN, ΔC, and ΔN/C. Serum-starvation and stimulation was done as described in panel A. Expression of Grb2 WT inhibited phosphorylation of c-Raf S259 upon IGF-1 stimulation (Figure 6B, lanes 1–3). Expression of Grb2-ΔC or Grb2-ΔN/C had little effect on phosphorylation of c-Raf (Figure 6B, lanes 7–12). Conversely, the C-terminal SH3 domain of Grb2 was able to inhibit phosphorylation of S259 inhibitory site of c-Raf in LN229 Tat-transfected cells even better then full-length Grb2 protein (Figure 6B, lanes 4–6). As a result of inhibition of phosphorylation of c-Raf S259 caused by WT or ΔN Grb2 expression, ERKs activation was restored in those samples (data not shown).

Figure 6. Phosphorylation of S259 inhibitory site of c-Raf is increased in Tat-transfected Glioblastoma LN229 cells.

Figure 6

Open in a new tab

A) Western blot analysis to detect phosphorylation levels of c-Raf S259. Fold ratio of time 0 (lane 1) accepted as 1. B) Phosphorylation levels of c-Raf S259 and Erk1/2 in Tat overexpressing LN229 cells transfected together with Grb2 full-length and three mutants ΔN, ΔC, ΔN/C were detected by Western blot. Total c-Raf indicates equal loading. Experiments were repeated at least 3 times; representative Western blot is shown in the figure.

3.5 Protein Kinase A (PKA) phosphorylates c-Raf (S259)

Previous studies have shown that c-Raf could be phosphorylated on its inhibitory site S259 by two kinases Protein Kinase A (PKA) or AKT/protein kinase B (PKB) [34–36]. To investigate which of these two kinases was involved in the phosphorylation of c-Raf (S259) in our system we used specific compounds to inhibit PKA or PI3-K. LN229 cells were transfected with pEYFP (lanes 1–4) or pEYFP-Tat (lanes 5–8), serum-starved for 24 hours, pretreated with specific inhibitors (50 μM of LY294002, and 25 μM of H89, lanes 3 and 7, and lanes 4 and 8, respectively) for 30 min and stimulated with IGF-1 for the indicated times (Figure 7A). Results illustrate inhibition of c-Raf S259 phosphorylation only in control cells treated with H89, a specific inhibitor of PKA. PI3-K specific inhibitor LY294002 did not have any noticeable consequence on S259 phosphorylation. Of interest, in cells expressing Tat, both compounds had an inhibitory effect on Raf phosphorylation.

Figure 7. Tat-induced PKA activation mediates c-Raf (S259) phosphorylation.

Figure 7

Open in a new tab

A) Western blot to detect c-Raf S259 phosphorylation and activation of Erk1/2 in LN229 cells transfected with pEYFP or pEYFP-Tat, pretreated with specific inhibitors (LY294002 50 μM, H89 25 μM) for 30 min and stimulated with IGF-1 for the indicated times. B) The kinase activity of PKA was tested in LN229 cells transfected with pEYFP, pEYFP-Tat, pEYFP-Tat together with Grb2 or Grb2 alone and stimulated with IGF-1 for 0 and 10 minutes. Activity was assayed using commercially available kit. Asterisks indicate values statistically significant (p<0.05). Ns: not statistically significant.

Next, we determined whether expression of Tat alone or along with Grb2 could affect PKA activity. LN229 cells were transfected with pEYFP, pEYFP-Tat, Grb2/pEYFP-Tat and Grb2 alone, serum-starved for 24 hours, and stimulated with IGF-1 for 0 and 10 minutes. Activity of PKA in protein extracts from pEYFP-transfected cells showed slight increase after IGF-1 stimulation (Figure 7B, lanes 1 and 2). Tat-expressing cells displayed a basal level of PKA activity that was about 5-fold higher than in pEYFP-transfected cells (compare lanes 1 and 3, p ≤ 0.05), and addition of IGF-1 slightly decreased PKA activity (lane 4). Overexpression of Grb2 in Tat-expressing cells was able to reduce PKA activity (lanes 5 and 6). When Grb2 was overexpressed alone there was no statistically significant difference in PKA activity between IGF-1 stimulated and non-stimulated cells (lanes 7 and 8).

3.6 Inhibitory action of Grb2 on Tat transactivation and HIV replication

The activity of Tat on the HIV-1 LTR was evaluated in LN229 cells co-transfected with a reporter plasmid containing the viral LTR and various Grb2 constructs (Figure 8A). Luciferase activity was determined 24 hours post transfection. Among Tat and the various Grb2 constructs, only Tat activates the HIV-1 LTR, as expected. In the presence of Grb2 wild type or the mutant containing the C-terminus SH3 domain the activity of Tat was inhibited of about three-fold (70%). The mutant of Grb2 containing the N-terminus SH3 was less efficient in lowering the activity of Tat and luciferase values were reduced of about 37%. Even less efficient was the Grb2 mutant lacking both SH3 domains (SH2, 25%).

Figure 8. Suppression of LTR activity and inhibition of HIV-1 replication by overexpression of Grb2 protein.

Figure 8

Open in a new tab

A) Promoter functional assay showing activation of HIV-LTR by Tat. LN229 cells were co-transfected with pEYFP-Tat, Grb2 wild type or truncated mutants, an HIV LTR–Firefly luciferase reporter plasmid and a Renilla luciferase control pRL-null plasmid. 24 hours later luciferase activity was measured according to manufacturer’s protocol. Inhibition of Tat-induced LTR by Grb2 and the indicated mutants is statistically significant: *p=0.00016, ** p=0.00005, # p=0.000316, ## p=0.00907. B) ELISA assay to detect p24 in the supernatant obtained from HIV-infected primary human fetal microglia collected at day 1 (D1) and day 3 (D3) post-infection with HIV. In the HIV/Grb2 sample cells were transfected with Grb2 full-length one day prior infection with HIV-1 JF-RL. Bar graph shows the average results from three independent experiments. Asterisk indicates p<0.001.

Finally, we investigated the role of Grb2/Tat interaction on viral replication. To this end we transfected human primary fetal microglia cells with Grb2 one day prior to their infection with HIV-1. Levels of p24 were measured in the supernatant of cultured cells on day 1 and 3 post-infection. Figure 8B shows an approximate 30% decrease in p24 in the medium of Grb2-transfected cells compared to control at both days 1 and 3.

4. Discussion

The human immunodeficiency virus-1 transactivating factor Tat has been shown to affect cellular functions by interfering with signal transduction pathways [11, 20, 23]. This ability of Tat to interact with many proteins may be due, at least in part, to the presence of specific motifs in its amino acid sequence. Using SH3 Hunter bioinformatic server [30] we have identified two putative SH3 binding domains in the Tat protein sequence and a list of possible interacting SH3 domains (Fig. 1) such as those contained in Fus1, Sem5, Grb2-C, STAM-1, End3 and End2 proteins. Interestingly, four of them were either Grb2 (Grb2-C), Grb2 C. elegans homolog (Sem5), or Grb2-like proteins (End3 and End2), suggesting some degree of specificity in the SH3 recognition sites present in Tat. Sem5 protein is the GRB2 homolog in C. elegans [37, 38]. End2 and End3 (full names Endophilin-A2 and Endophilin-A3, respectively) are SH3 domain-containing GRB2-like proteins implicated in endocytosis [39, 40]. STAM-1 is a member of the STAM (SH3 domain containing signal-transducing adaptor molecule) family of proteins, which are composed of several domain structures, including the VHS (Vps27/Hrs/STAM) domain, ubiquitin-interacting motif (UIM), Src homology 3 domain, and a coiled-coil (CC) region. Through their CC regions, both STAM-1 and STAM-2 bind Hrs (hepatocyte growth factor-regulated substrate), a protein that is localized on the cytoplasmic face of the early endosome [41]. Although we investigated thoroughly only the interaction of Tat with Grb2, it is tempting to speculate that the interaction of Tat with the above mentioned molecules, and possibly other SH3-bearing proteins, may result in deregulation of a wide variety of cellular processes.

Grb2 is a ubiquitously expressed adapter protein that has mitogenic properties and is required for several basic cellular processes [6]. It can interact with tyrosine phosphorylated substrates, such as tyrosine kinase receptors, via the SH2 domain and with a variety of other signaling molecules via the two SH3 domains. Grb2 is constitutively bound to Son of sevenless (Sos), a guanine-nucleotide exchange factor that promotes GDP-GTP exchange on Ras, whose activation than leads to the activation of MAPK pathway [42, 43]. Direct interaction of Tat with Grb2 may displace the host protein from its usual binding partners and alter the Ras/MAPK pathways. Indeed, our in vitro data show that Tat can compete with Gab1 for the binding to the SH3 domain of Grb2, possibly altering Gab1 downstream cascade. An additional mechanism by which Tat may deregulate Grb2 downstream signaling could be mediated, at least in cell culture, by the subtraction of Grb2 from the cytoplasmic events. This hypothesis is supported by our data showing nuclear localization of Grb2 in Tat-expressing cells (Figure 4).

Immunohistochemistry analysis of HIVE brain samples revealed a modest presence of Grb2, mainly detected in astrocytes (Figure 3, panels A through F). The pattern of HIV-Tat expression appears very robust in area of encephalitis, where the viral protein is also detected in endothelial cells, perivascular macrophages and reactive astrocytes. In contrast, Tat is undetectable in areas of the same brain that are not affected by inflammation. Colocalization between Tat and Grb2 was observed in reactive astrocytes, corroborating the in vitro binding assays. Of interest to note that, although Grb2 is abundantly expressed in all cell types, immunohistochemistry analysis revealed strong labeling only in reactive atrocytes. It may indicate the activation/proliferation status of these cells, as previously suggested by Russo C. et al. in their study demonstrating increased Grb2/ShcA/APP interaction in reactive astrocytes of Alzheimer’s disease (AD) brain samples [44].

Many studies have been reported the pleiotropic activity of Tat in deregulating a wide range of signaling pathways by both direct and indirect mechanisms. The presence of SH3-binding domains in the sequence of Tat may account for at least some of the various activities of this viral protein. De la Fuente et al. made an interesting observation on the ability of Tat to downregulate expression of many cellular genes, particularly on cellular tyrosine kinase receptors (RTK) and their downstream signal transduction members, including the Ras-Raf-MEK pathway [45]. Perhaps impairment of the Ras/MEK pathway by Tat/Grb2 interaction may affect transcription of ERK1/2 downstream targets. As the cellular signaling pathways are not linear but cross-talk and overlap, Tat likely affects them at various levels in a complex network of direct and indirect mechanisms. We have tried to analyze some of them using a Glioblastoma cell line and the well-known IGF-1R signaling. Following the Ras/Raf/MAPK pathway we showed that Tat can interact at different levels; it binds to Grb2, subtracting this adaptor molecule to the Ras/MEK pathway, while it potentiates the Raf inhibitory pathway by activating PKA. Shifting of the substrates along signaling pathways appears to be an interesting feature of Tat. For instance, we have previously shown the ability of Tat to promote the non-canonical activation of Stat5A in PC12 cells stimulated with NGF, which results in the inhibition of cellular differentiation [46]. Ultimately, since the activity of Tat on cellular processes appears to be cell-type specific, the end point of Tat/host interaction, including the Tat/SH3-client interaction, could be either inhibitory or stimulatory. For example, Tat has been shown to mediate activation of ERK1/2 in endothelial cells [25] or to inhibit their activation in neural cells [47]. On the other hand, the outcome of Tat/host interaction may also affect some aspects of the viral cycle. We utilized primary human fetal microglia infected with HIV-1 and found that over-expression of Grb2 derails the activity of Tat from its natural target, the viral LTR (Figure 8A), resulting in a lower production of p24 as a measurement of viral replication (Figure 8B).

In summary, this report provides evidence for Tat/Grb2 direct interaction, which is mediated by the SH3 C-terminal domain of Grb2 and polyproline regions of Tat. This interaction is functional and bidirectional: it affects cellular pathways as well as viral replication. Considering the high number of cellular proteins that posses one or more SH3-binding domain, it is tempting to speculate that the Tat/SH3 interaction might be a general mechanism for Tat to interfere with many signaling pathways, and consequently, many cellular processes.

Highlights.

  1. The SH3 domain of Grb2 interacts with HIV-1 Tat protein.

  2. Tat/Grb2 interaction affects cellular signaling pathways and viral functions.

  3. It impairs IGF-1R/ERKs activation and enhances PKA/Raf inhibitory cascade in LN229.

  4. It inhibits viral replication in HIV-infected human primary microglia.

Acknowledgments

Slava Rom, Marco Pacifici, Giovanni Passiatore, Luis Del Valle and Francesca Peruzzi were previously with the Department of Neuroscience and Center for Neurovirology at Temple University School of Medicine, Philadelphia PA. This work was supported by NIH grant MH079751 to FP.

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  • 1.Mayer BJ. SH3 domains: complexity in moderation. J Cell Sci. 2001;114:1253–1263. doi: 10.1242/jcs.114.7.1253. [DOI] [PubMed] [Google Scholar]
  • 2.Pawson T. Protein modules and signalling networks. Nature. 1995;373:573–580. doi: 10.1038/373573a0. [DOI] [PubMed] [Google Scholar]
  • 3.Rickles RJ, Botfield MC, Zhou XM, Henry PA, Brugge JS, Zoller MJ. Phage display selection of ligand residues important for Src homology 3 domain binding specificity. Proc Natl Acad Sci U S A. 1995;92:10909–10913. doi: 10.1073/pnas.92.24.10909. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Sparks AB, Rider JE, Hoffman NG, Fowlkes DM, Quillam LA, Kay BK. Distinct ligand preferences of Src homology 3 domains from Src, Yes, Abl, Cortactin, p53bp2, PLCgamma, Crk, and Grb2. Proc Natl Acad Sci U S A. 1996;93:1540–1544. doi: 10.1073/pnas.93.4.1540. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Pawson T, Schlessingert J. SH2 and SH3 domains. Curr Biol. 1993;3:434–442. doi: 10.1016/0960-9822(93)90350-w. [DOI] [PubMed] [Google Scholar]
  • 6.Tari AM, Lopez-Berestein G. GRB2: a pivotal protein in signal transduction. Semin Oncol. 2001;28:142–147. doi: 10.1016/s0093-7754(01)90291-x. [DOI] [PubMed] [Google Scholar]
  • 7.Cheng AM, Saxton TM, Sakai R, Kulkarni S, Mbamalu G, Vogel W, Tortorice CG, Cardiff RD, Cross JC, Muller WJ, Pawson T. Mammalian Grb2 regulates multiple steps in embryonic development and malignant transformation. Cell. 1998;95:793–803. doi: 10.1016/s0092-8674(00)81702-x. [DOI] [PubMed] [Google Scholar]
  • 8.Giubellino A, Burke TR, Jr, Bottaro DP. Grb2 signaling in cell motility and cancer. Expert Opin Ther Targets. 2008;12:1021–1033. doi: 10.1517/14728222.12.8.1021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Gatignol A, Jeang KT. Tat as a transcriptional activator and a potential therapeutic target for HIV-1. Adv Pharmacol. 2000;48:209–227. doi: 10.1016/s1054-3589(00)48007-5. [DOI] [PubMed] [Google Scholar]
  • 10.Cullen BR. Trans-activation of human immunodeficiency virus occurs via a bimodal mechanism. Cell. 1986;46:973–982. doi: 10.1016/0092-8674(86)90696-3. [DOI] [PubMed] [Google Scholar]
  • 11.Peruzzi F. The multiple functions of HIV-1 Tat: proliferation versus apoptosis. Front Biosci. 2006;11:708–717. doi: 10.2741/1829. [DOI] [PubMed] [Google Scholar]
  • 12.Aprea S, Del Valle L, Mameli G, Sawaya BE, Khalili K, Peruzzi F. Tubulin-mediated binding of human immunodeficiency virus-1 Tat to the cytoskeleton causes proteasomal-dependent degradation of microtubule-associated protein 2 and neuronal damage. J Neurosci. 2006;26:4054–4062. doi: 10.1523/JNEUROSCI.0603-06.2006. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Del Valle L, Croul S, Morgello S, Amini S, Rappaport J, Khalili K. Detection of HIV-1 Tat and JCV capsid protein, VP1, in AIDS brain with progressive multifocal leukoencephalopathy. J Neurovirol. 2000;6:221–228. doi: 10.3109/13550280009015824. [DOI] [PubMed] [Google Scholar]
  • 14.Huigen MC, Kamp W, Nottet HS. Multiple effects of HIV-1 trans-activator protein on the pathogenesis of HIV-1 infection. Eur J Clin Invest. 2004;34:57–66. doi: 10.1111/j.1365-2362.2004.01282.x. [DOI] [PubMed] [Google Scholar]
  • 15.Ptak RG, Fu W, Sanders-Beer BE, Dickerson JE, Pinney JW, Robertson DL, Rozanov MN, Katz KS, Maglott DR, Pruitt KD, Dieffenbach CW. Cataloguing the HIV type 1 human protein interaction network. AIDS Res Hum Retroviruses. 2008;24:1497–1502. doi: 10.1089/aid.2008.0113. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Borgatti P, Zauli G, Colamussi ML, Gibellini D, Previati M, Cantley LL, Capitani S. Extracellular HIV-1 Tat protein activates phosphatidylinositol 3- and Akt/PKB kinases in CD4+ T lymphoblastoid Jurkat cells. Eur J Immunol. 1997;27:2805–2811. doi: 10.1002/eji.1830271110. [DOI] [PubMed] [Google Scholar]
  • 17.D’Aversa TG, Yu KO, Berman JW. Expression of chemokines by human fetal microglia after treatment with the human immunodeficiency virus type 1 protein Tat. J Neurovirol. 2004;10:86–97. doi: 10.1080/13550280490279807. [DOI] [PubMed] [Google Scholar]
  • 18.Deregibus MC, Cantaluppi V, Doublier S, Brizzi MF, Deambrosis I, Albini A, Camussi G. HIV-1-Tat protein activates phosphatidylinositol 3-kinase/AKT-dependent survival pathways in Kaposi’s sarcoma cells. J Biol Chem. 2002;277:25195–25202. doi: 10.1074/jbc.M200921200. [DOI] [PubMed] [Google Scholar]
  • 19.Evans P, Sacan A, Ungar L, Tozeren A. Sequence alignment reveals possible MAPK docking motifs on HIV proteins. PLoS One. 5:e8942. doi: 10.1371/journal.pone.0008942. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Herbein G, Gras G, Khan KA, Abbas W. Macrophage signaling in HIV-1 infection. Retrovirology. :7–34. doi: 10.1186/1742-4690-7-34. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ju SM, Song HY, Lee JA, Lee SJ, Choi SY, Park J. Extracellular HIV-1 Tat up-regulates expression of matrix metalloproteinase-9 via a MAPK-NF-kappaB dependent pathway in human astrocytes. Exp Mol Med. 2009;41:86–93. doi: 10.3858/emm.2009.41.2.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Del Valle L, Wang JY, Lassak A, Peruzzi F, Croul S, Khalili K, Reiss K. Insulin-like growth factor I receptor signaling system in JC virus T antigen-induced primitive neuroectodermal tumors--medulloblastomas. J Neurovirol. 2002;8(Suppl 2):138–147. doi: 10.1080/13550280290101111. [DOI] [PubMed] [Google Scholar]
  • 23.Peruzzi F, Bergonzini V, Aprea S, Reiss K, Sawaya BE, Rappaport J, Amini S, Khalili K. Cross talk between growth factors and viral and cellular factors alters neuronal signaling pathways: implication for HIV-associated dementia. Brain Res Brain Res Rev. 2005;50:114–125. doi: 10.1016/j.brainresrev.2005.05.002. [DOI] [PubMed] [Google Scholar]
  • 24.Rusnati M, Urbinati C, Musulin B, Ribatti D, Albini A, Noonan D, Marchisone C, Waltenberger J, Presta M. Activation of endothelial cell mitogen activated protein kinase ERK(1/2) by extracellular HIV-1 Tat protein. Endothelium. 2001;8:65–74. doi: 10.3109/10623320109063158. [DOI] [PubMed] [Google Scholar]
  • 25.Toschi E, Bacigalupo I, Strippoli R, Chiozzini C, Cereseto A, Falchi M, Nappi F, Sgadari C, Barillari G, Mainiero F, Ensoli B. HIV-1 Tat regulates endothelial cell cycle progression via activation of the Ras/ERK MAPK signaling pathway. Mol Biol Cell. 2006;17:1985–1994. doi: 10.1091/mbc.E05-08-0717. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Zauli G, Milani D, Mirandola P, Mazzoni M, Secchiero P, Miscia S, Capitani S. HIV-1 Tat protein down-regulates CREB transcription factor expression in PC12 neuronal cells through a phosphatidylinositol 3-kinase/AKT/cyclic nucleoside phosphodiesterase pathway. Faseb J. 2001;15:483–491. doi: 10.1096/fj.00-0354com. [DOI] [PubMed] [Google Scholar]
  • 27.Saksela K, Cheng G, Baltimore D. Proline-rich (PxxP) motifs in HIV-1 Nef bind to SH3 domains of a subset of Src kinases and are required for the enhanced growth of Nef+ viruses but not for down-regulation of CD4. EMBO J. 1995;14:484–491. doi: 10.1002/j.1460-2075.1995.tb07024.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Rom S, Rom I, Passiatore G, Pacifici M, Radhakrishnan S, Del Valle L, Pina-Oviedo S, Khalili K, Eletto D, Peruzzi F. CCL8/MCP-2 is a target for mir-146a in HIV-1-infected human microglial cells. FASEB J. 2010;24:2292–2300. doi: 10.1096/fj.09-143503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Sawaya BE, Khalili K, Gordon J, Taube R, Amini S. Cooperative interaction between HIV-1 regulatory proteins Tat and Vpr modulates transcription of the viral genome. J Biol Chem. 2000;275:35209–35214. doi: 10.1074/jbc.M005197200. [DOI] [PubMed] [Google Scholar]
  • 30.Ferraro E, Peluso D, Via A, Ausiello G, Helmer-Citterich M. SH3-Hunter: discovery of SH3 domain interaction sites in proteins. Nucleic Acids Res. 2007;35:W451–454. doi: 10.1093/nar/gkm296. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Chipitsyna G, Sawaya BE, Khalili K, Amini S. Cooperativity between Rad51 and C/EBP family transcription factors modulates basal and Tat-induced activation of the HIV-1 LTR in astrocytes. J Cell Physiol. 2006;207:605–613. doi: 10.1002/jcp.20612. [DOI] [PubMed] [Google Scholar]
  • 32.Lewitzky M, Kardinal C, Gehring NH, Schmidt EK, Konkol B, Eulitz M, Birchmeier W, Schaeper U, Feller SM. The C-terminal SH3 domain of the adapter protein Grb2 binds with high affinity to sequences in Gab1 and SLP-76 which lack the SH3-typical P-x-x-P core motif. Oncogene. 2001;20:1052–1062. doi: 10.1038/sj.onc.1204202. [DOI] [PubMed] [Google Scholar]
  • 33.Subramaniam S, Shahani N, Strelau J, Laliberte C, Brandt R, Kaplan D, Unsicker K. Insulin-like growth factor 1 inhibits extracellular signal-regulated kinase to promote neuronal survival via the phosphatidylinositol 3-kinase/protein kinase A/c-Raf pathway. J Neurosci. 2005;25:2838–2852. doi: 10.1523/JNEUROSCI.5060-04.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Chong H, Guan KL. Regulation of Raf through phosphorylation and N terminus-C terminus interaction. J Biol Chem. 2003;278:36269–36276. doi: 10.1074/jbc.M212803200. [DOI] [PubMed] [Google Scholar]
  • 35.Wellbrock C, Karasarides M, Marais R. The RAF proteins take centre stage. Nat Rev Mol Cell Biol. 2004;5:875–885. doi: 10.1038/nrm1498. [DOI] [PubMed] [Google Scholar]
  • 36.Zimmermann S, Rommel C, Ziogas A, Lovric J, Moelling K, Radziwill G. MEK1 mediates a positive feedback on Raf-1 activity independently of Ras and Src. Oncogene. 1997;15:1503–1511. doi: 10.1038/sj.onc.1201322. [DOI] [PubMed] [Google Scholar]
  • 37.Downward J. The GRB2/Sem-5 adaptor protein. FEBS Lett. 1994;338:113–117. doi: 10.1016/0014-5793(94)80346-3. [DOI] [PubMed] [Google Scholar]
  • 38.Rozakis-Adcock M, McGlade J, Mbamalu G, Pelicci G, Daly R, Li W, Batzer A, Thomas S, Brugge J, Pelicci PG, et al. Association of the Shc and Grb2/Sem5 SH2-containing proteins is implicated in activation of the Ras pathway by tyrosine kinases. Nature. 1992;360:689–692. doi: 10.1038/360689a0. [DOI] [PubMed] [Google Scholar]
  • 39.Giachino C, Lantelme E, Lanzetti L, Saccone S, Bella Valle G, Migone N. A novel SH3-containing human gene family preferentially expressed in the central nervous system. Genomics. 1997;41:427–434. doi: 10.1006/geno.1997.4645. [DOI] [PubMed] [Google Scholar]
  • 40.Reutens AT, Begley CG. Endophilin-1: a multifunctional protein. Int J Biochem Cell Biol. 2002;34:1173–1177. doi: 10.1016/s1357-2725(02)00063-8. [DOI] [PubMed] [Google Scholar]
  • 41.Mizuno E, Kawahata K, Okamoto A, Kitamura N, Komada M. Association with Hrs is required for the early endosomal localization, stability, and function of STAM. J Biochem. 2004;135:385–396. doi: 10.1093/jb/mvh046. [DOI] [PubMed] [Google Scholar]
  • 42.Aronheim A, Engelberg D, Li N, al-Alawi N, Schlessinger J, Karin M. Membrane targeting of the nucleotide exchange factor Sos is sufficient for activating the Ras signaling pathway. Cell. 1994;78:949–961. doi: 10.1016/0092-8674(94)90271-2. [DOI] [PubMed] [Google Scholar]
  • 43.Wong L, Johnson GR. Epidermal growth factor induces coupling of protein-tyrosine phosphatase 1D to GRB2 via the COOH-terminal SH3 domain of GRB2. J Biol Chem. 1996;271:20981–20984. doi: 10.1074/jbc.271.35.20981. [DOI] [PubMed] [Google Scholar]
  • 44.Russo C, Dolcini V, Salis S, Venezia V, Violani E, Carlo P, Zambrano N, Russo T, Schettini G. Signal transduction through tyrosine-phosphorylated carboxy-terminal fragments of APP via an enhanced interaction with Shc/Grb2 adaptor proteins in reactive astrocytes of Alzheimer’s disease brain. Ann N Y Acad Sci. 2002;973:323–333. doi: 10.1111/j.1749-6632.2002.tb04660.x. [DOI] [PubMed] [Google Scholar]
  • 45.De la Fuente C, Santiago F, Deng L, Eadie C, Zilberman I, Kehn K, Maddukuri A, Baylor S, Wu K, Lee CG, Pumfery A, Kashanchi F. Gene expression profile of HIV-1 Tat expressing cells: a close interplay between proliferative and differentiation signals. BMC Biochem. 2002;3:14. doi: 10.1186/1471-2091-3-14. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Bergonzini V, Delbue S, Wang JY, Reiss K, Prisco M, Amini S, Khalili K, Peruzzi F. HIV-Tat promotes cellular proliferation and inhibits NGF-induced differentiation through mechanisms involving Id1 regulation. Oncogene. 2004;23:7701–7711. doi: 10.1038/sj.onc.1207828. [DOI] [PubMed] [Google Scholar]
  • 47.Peruzzi F, Gordon J, Darbinian N, Amini S. Tat-induced deregulation of neuronal differentiation and survival by nerve growth factor pathway. J Neurovirol. 2002;8(Suppl 2):91–96. doi: 10.1080/13550280290167885. [DOI] [PubMed] [Google Scholar]
  • 48.Care A, Catalucci D, Felicetti F, Bonci D, Addario A, Gallo P, Bang ML, Segnalini P, Gu Y, Dalton ND, Elia L, Latronico MV, Hoydal M, Autore C, Russo MA, Dorn GW, 2nd, Ellingsen O, Ruiz-Lozano P, Peterson KL, Croce CM, Peschle C, Condorelli G. MicroRNA-133 controls cardiac hypertrophy. Nat Med. 2007;13:613–618. doi: 10.1038/nm1582. [DOI] [PubMed] [Google Scholar]

RESOURCES