Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2012 Nov 26;109(50):E3405–E3413. doi: 10.1073/pnas.1216539109

Autophagy hijacked through viroporin-activated calcium/calmodulin-dependent kinase kinase-β signaling is required for rotavirus replication

Sue E Crawford 1, Joseph M Hyser 1, Budi Utama 1, Mary K Estes 1,1
PMCID: PMC3528557  PMID: 23184977

Significance

This study describes a unique mechanism of virus-initiated autophagy and exploitation of autophagy membranes for virus replication. Autophagy is a highly regulated cellular process in which cells destroy and recycle their own components in lysosomes. The mechanism most viruses use to induce autophagy is unknown. We show a rotavirus pore-forming protein activates a calcium-dependent signaling pathway to initiate autophagy. Rotavirus hijacks autophagy membranes to transport viral proteins to sites of virus replication for assembly of infectious particles and interferes with autophagy maturation. Inhibition of the signaling pathway blocks virus production, suggesting a therapeutic target to fight infection.

Keywords: viroplasm, morphogenesis, LC3, STO-609

Abstract

Autophagy is a cellular degradation process involving an intracellular membrane trafficking pathway that recycles cellular components or eliminates intracellular microbes in lysosomes. Many pathogens subvert autophagy to enhance their replication, but the mechanisms these pathogens use to initiate the autophagy process have not been elucidated. This study identifies rotavirus as a pathogen that encodes a viroporin, nonstructural protein 4, which releases endoplasmic reticulum calcium into the cytoplasm, thereby activating a calcium/calmodulin-dependent kinase kinase-β and 5′ adenosine monophosphate-activated protein kinase-dependent signaling pathway to initiate autophagy. Rotavirus hijacks this membrane trafficking pathway to transport viral proteins from the endoplasmic reticulum to sites of viral replication to produce infectious virus. This process requires PI3K activity and autophagy-initiation proteins Atg3 and Atg5, and it is abrogated by chelating cytoplasmic calcium or inhibiting calcium/calmodulin-dependent kinase kinase-β. Although the early stages of autophagy are initiated, rotavirus infection also blocks autophagy maturation. These studies identify a unique mechanism of virus-mediated, calcium-activated signaling that initiates autophagy and hijacks this membrane trafficking pathway to transport viral proteins to sites of viral assembly.


Viruses are obligate intracellular parasites that, due to their limited coding capacity, have evolved strategies that usurp cellular processes to facilitate their own propagation. Macroautophagy (hereafter referred to as autophagy) is a cellular catabolic process used to maintain homeostasis by delivering cytoplasmic material to lysosomes for degradation via an intracellular membrane trafficking pathway (1). Autophagy also has intracellular antimicrobial properties and plays a role in the initiation of innate and adaptive immune responses to viral and bacterial infections. Numerous pathogens, including a number of DNA and RNA viruses, have been shown to evade or subvert autophagy (2); however, for most of these viruses, the mechanisms used to initiate autophagy and subvert the normal autophagy process have not been elucidated.

The formation of autophagy membranes is complex and not completely understood, but the autophagy (Atg) proteins comprise the core molecular machinery involved in this dynamic membrane rearrangement (3). Autophagy, which is repressed by the mammalian target of rapamycin (mTOR), can be activated by nutrient deprivation; growth factor depletion; or cellular stress, such as hypoxia, energy depletion, endoplasmic reticulum (ER) stress, high temperature, or high cell density conditions (4). Following nutrient deprivation, mTOR is inhibited and a complex composed of Atg13/ULK1/FIP200/Atg101 forms to initiate nucleation of an isolation membrane, or phagophore (5). The phagophore elongates and subsequently encloses cytoplasmic components, forming a double-membrane vacuole, the autophagosome. The elongation phase requires two ubiquitin-like conjugation reactions to form the Atg5/Atg12/Atg16 complex and to conjugate phosphatidylethanolamine (PE) onto microtubule-associated protein light chain 3 (LC3). The lipid tail of LC3 is inserted into the forming autophagosome. Finally, autophagosomes are transported in a dynein-dependent manner on microtubules to lysosomes, where they fuse to form autolysosomes, and the engulfed material is degraded by lysosomal enzymes.

Many important pathogens, including RNA viruses [picornaviruses (poliovirus, coxsackievirus, rhinovirus, and hepatitis A), coronaviruses (severe acute respiratory syndrome), and flaviviruses (hepatitis C virus, yellow fever virus, dengue virus, and West Nile virus)] and some DNA viruses (hepatitis B virus and parvovirus) induce the accumulation of autophagosomes or autolysosomes (6–10). It has been proposed for picornaviruses that these dramatically remodeled autophagic intracellular membranes serve as a structural platform for viral replication and assembly. However, the mechanism of autophagy induction for most of these viruses is unknown.

Rotavirus is the causative agent of severe gastroenteritis and vomiting in young children and animals worldwide (11). We previously reported that the rotavirus nonstructural protein 4 (NSP4), expressed alone or during virus infection, colocalizes with the endogenous autophagy marker protein LC3 in membranes that surround viroplasms, sites of viral replication and particle assembly, but the functional relevance of autophagy in rotavirus infection and the mechanism of autophagy induction remained unknown (12). The current study investigated whether autophagy is required for rotavirus replication and the mechanism used by rotavirus and NSP4 to initiate autophagy. We report an example of a virus-encoded viroporin that mediates the initiation of autophagy. We discovered that the rotavirus-encoded viroporin NSP4 releases calcium from the ER into the cytoplasm, activating calcium/calmodulin-dependent kinase kinase-β (CaMKK-β) signaling to initiate autophagy. The current study provides insight into a unique mechanism through which rotavirus initiates autophagy and hijacks this membrane trafficking pathway to transport viral proteins from the ER to sites of virus replication for assembly of infectious virus.

Results

Rotavirus Requires the Cellular Autophagy Machinery for Replication.

We previously reported that during rotavirus infection, a pool of NSP4 colocalizes with the autophagy marker protein LC3 and surrounds viroplasms, sites of virus replication (12). However, the requirement for or role that autophagy might play during rotavirus replication was unknown. We used multiple approaches to investigate whether the autophagy machinery is required for rotavirus replication: infection of cells in which induction of autophagy was inhibited with a pharmacological inhibitor and infection of cells genetically deficient in proteins required for autophagy membrane formation.

The pharmacological inhibitor 3-methyladenine (3-MA) inhibits Vps34, a type III PI3K that is part of the Beclin-1 complex and required for autophagosome formation (4). Treatment of cells with 3-MA before infection resulted in a significant reduction in viral yield compared with nontreated cells (Fig. 1A). Cell viability in mock-infected, 3-MA–treated cells was high (∼97% viable at 6 and 18 h) based on trypan blue staining, indicating that the reduction in virus infectivity was not due to cytotoxicity of 3-MA. Reports suggest PI3K-activated Akt and NF-κB are required for efficient synthesis of viral proteins and cell survival following rotavirus infection (13–15). To evaluate whether 3-MA affected virus infection or protein expression, NSP4 expression was examined and found to be similar at 6 h postinfection (hpi) in rotavirus-infected cell lysates pretreated with the same concentrations of 3-MA used in the infectivity assays (Fig. 1B). In addition, because of other potential autophagy-independent effects of 3-MA (16–20), and to confirm the requirement for autophagy in rotavirus replication, infectivity assays were performed in cells genetically deficient in proteins required for autophagy membrane formation.

Fig. 1.

Fig. 1.

Inhibition of autophagy reduces the yield of rotavirus. (A) MA104 cells were treated with 0, 10, or 25 mM 3-MA for 3 h before rotavirus infection [multiplicity of infection (moi) 1]. Cells and media were harvested at the indicated times, and infectious rotavirus was assayed by fluorescent focus assay. *P ≤ 0.01 compared with cells without 3-MA treatment. Error bars represent SD. (B) MA104 cells were treated with 0, 10, or 25 mM 3-MA for 3 h before rotavirus infection (moi 10). At 6 hpi, cells were analyzed by Western blot for NSP4 and for GAPDH as a loading control. Quantification of NSP4 normalized to GAPDH (n = 3) is shown below the blots. Mouse parental (Atg3+/+, gray bars) and Atg3 KO (Atg3−/−, white bars) embryonic fibroblast (MEF) cells (C) or parental (Atg5+/+, black bars) and Atg5 KO (Atg5−/−, white bars) MEF cells, Atg5−/− MEF cells transfected with WT Atg5-EGFP (dark gray bars), or Atg5−/− cells transfected with the mutant Atg5-GFP K130R (light gray bars) (D) were infected with rotavirus (moi 10) and then harvested at the indicated times. Cells and media were assayed for infectious rotavirus by fluorescent focus assay. Data shown represent one of three separate experiments performed in quadruplicate. *P ≤ 0.01 compared with parental cells. Error bars represent SD. (E) Rotavirus infection of Atg5+/+ MEFs or Atg5−/− MEFs transfected with a plasmid expressing WT Atg5-EGFP (WT) induces LC3 II. Atg5+/+, Atg5−/−, or Atg5−/− cells transfected with plasmids expressing WT Atg5-EGFP (WT) or Atg5-EGFP K130R were infected with rotavirus and harvested 18 hpi. The lysates were analyzed by Western blot using antibodies against LC3 and GAPDH.

Induction of autophagy is characterized by the conversion of cytoplasmic LC3 I into LC3 II, a PE-conjugated, membrane-inserted form. LC3 processing requires several Atg proteins, including Atg3 and Atg5 (21). In cells deficient in Atg3 or Atg5, the yield of rotavirus was approximately one log lower than the virus yield obtained from parental cells (Fig. 1 C and D). To confirm that the lack of rotavirus yield was due to the deficiency of Atg5 and loss of LC3 processing, Atg5−/− cells were transfected with WT Atg5-EGFP or an Atg5-EGFP K130R mutant that is incapable of interacting with Atg12, which allows isolation membrane formation but inhibits membrane elongation and autophagosome formation (20). LC3 processing was evaluated by Western blot in each of the different Atg5 cells following rotavirus infection (Fig. 1E). LC3 II was detected in rotavirus-infected parental and Atg5−/− cells expressing WT Atg5-EGFP but not in Atg5−/− cells or Atg5−/− cells expressing Atg5-EGFP K130R. Expression of WT Atg5-EGFP, but not the Atg5-EGFP K130R mutant, in Atg5−/− cells increased production of infectious rotavirus (Fig. 1D). These results indicate that the cellular autophagy machinery is required for infectious rotavirus production and inhibition of isolation membrane formation or elongation and LC3 insertion into these membranes significantly reduces the yield of rotavirus.

Rotavirus Infection Induces LC3 Lipidation and NSP4/LC3 Puncta Formation.

We next examined whether rotavirus infection initiates autophagy and stimulates LC3 II formation. Mock- and rotavirus-infected MA104 cells were analyzed by Western blot to detect the different forms of LC3. An increase in endogenous LC3 II, above the background level observed in mock-infected cells, was detected as early as 4 hpi in rotavirus-infected cells (Fig. 2A). Because expression of NSP4 alone is known to result in formation of NSP4/LC3 puncta (12), the same lysates used for detection of LC3 were analyzed for the expression of NSP4. NSP4 expression was detected at 3 hpi (Fig. 2B), before the increase in LC3 II formation.

Fig. 2.

Fig. 2.

Rotavirus (RV) infection leads to LC3 lipidation and insertion into autophagic membranes. Mock-infected (−) or rotavirus-infected (+) MA104 cell lysates harvested at the indicated time points postinfection were analyzed by Western blot. Proteins on the blots were detected with antibody against LC3 to detect cytoplasmic, endogenous LC3 I and the lipidated and membrane-inserted LC3 II and GAPDH (A) or NSP4 (B).

Membrane-bound LC3 II forms puncta that can be visualized using immunofluorescence for LC3 (4). Colocalization of NSP4 with LC3 in puncta surrounding viroplasms, sites of viral replication, has been previously reported in rotavirus-infected cells (12). To correlate LC3 II detection by Western blot with LC3 puncta formation, confocal microscopy was used to visualize the location of LC3, NSP4, and NSP5 (a component of viroplasms) in rotavirus-infected cells at various time points postinfection. NSP5-positive viroplasms were detected at 3 hpi. In the same cells, NSP4 was localized to the ER and LC3 exhibited diffuse cytoplasmic localization (Fig. 3A). At 4 hpi, small NSP4 puncta were observed, and most of these NSP4 puncta colocalized with endogenous LC3 (Fig. 3B). At 5 hpi, the small NSP4/LC3 puncta accumulated and coalesced, forming large, irregularly shaped puncta that were in close proximity to, but not colocalized with, viroplasms (Fig. 3C). However, at 6 hpi, NSP4/LC3 puncta were seen as compact puncta surrounding viroplasms as previously shown (Fig. 3D) (12). The Western blot and confocal results indicate that (i) rotavirus initiates the autophagy process, (ii) conversion of the cytoplasmic LC3 I into the membrane-inserted LC3 II form correlates temporally with detection of LC3-positive puncta, and (iii) LC3 colocalizes with NSP4 in the NSP4/LC3 puncta that merge and surround viroplasms.

Fig. 3.

Fig. 3.

Localization of NSP4, LC3, and viroplasms following rotavirus infection. Rotavirus-infected MA104 cells were fixed; permeabilized at 3 (A), 4 (B), 5 (C), and 6 (D) hpi; and stained with antibody against NSP5 to detect viroplasms (blue), endogenous LC3 (green), or NSP4 (red). (Scale bars: A and B,10 μm; C and D, 5 μm.)

Rotavirus Infection Suppresses Autophagy Maturation.

During the dynamic process of autophagy maturation, autophagosomes fuse with lysosomes to degrade the contents of the autolysosome, including LC3 II. Our data show rotavirus initiates the autophagy process. We next used several methods to examine whether NSP4/LC3 puncta fuse with lysosomes or whether rotavirus suppresses autophagy maturation.

Bafilomycin A1 is an inhibitor of lysosome-mediated degradation and blocks LC3 II degradation in the autolysosome (4). Mock- or rotavirus-infected MA104 cells were cultured in nonstarvation (DMEM) conditions with or without bafilomycin A1 added 1 hpi. Western blot analysis revealed that basal LC3 II catabolism occurred in the mock-infected cells cultured in DMEM based on minimal LC3 II detection (Fig. 4A). However, in the presence of bafilomycin A1, an increase in LC3 II was detected, reflecting a block in basal LC3 II catabolism. In contrast, a slight increase in the amount of LC3 II was detected in rotavirus-infected cells cultured in the absence of bafilomycin A1 compared with infected cells cultured in the presence of bafilomycin A1. It was previously reported that addition of bafilomycin A1 before infection inhibits the early steps of virus infection; therefore, we evaluated the expression of NSP4 at 6 hpi in virus-infected cells cultured in the absence and presence of bafilomycin A1 added 1 hpi. The expression level of NSP4 was similar in the presence or absence of bafilomycin A1 (Fig. 4A). These results suggest rotavirus infection both induces LC3 II lipidation and LC3 puncta formation (early stages of autophagy) and also blocks autophagy maturation.

Fig. 4.

Fig. 4.

Rotavirus infection suppresses autophagy maturation. (A) Mock- or rotavirus (RV)-infected cells were cultured in the absence (−) or presence (+) of 100 nM bafilomycin A1 (Baf) added at 1 hpi. The cells were harvested at 8 hpi and analyzed by Western blot for cytoplasmic LC3 I, the lipidated membrane-inserted LC3 II, and NSP4, and for GAPDH as a loading control. Quantification of LC3 II or NSP4 normalized to GAPDH (n = 3) is shown below the respective blots. (B) Monomeric (m) RFP-GFP-LC3–expressing rotavirus-infected MA104 cells were fixed at 20 hpi, stained with antirotavirus antibody (blue), and imaged by confocal microscopy. Both RFP and GFP fluorescence are observed in the same puncta in rotavirus-infected cells, indicating that rotavirus infection suppresses autophagosome maturation. (Scale bars: 10 μm.)

To determine whether rotavirus blocks NSP4/LC3-positive membranes from fusing with lysosomes, a tandem-tagged monomeric (m)RFP-GFP-LC3 probe was used to detect autolysosomes (4). Based on the chemical properties of the RFP and GFP fluorophores, the tandem-tagged mRFP-GFP-LC3 probe can detect whether an autophagosome has fused with a lysosome. In the near-neutral conditions inside autophagosomes, both RFP and GFP fluoresce; however, the low pH inside an autolysosome quenches GFP, and only the RFP fluorescent signal is detected. In cells starved to induce autophagy, autophagy maturation was observed in the majority of LC3 puncta based on detection of RFP alone, whereas in only a subset of LC3 puncta was GFP detected (Fig. S1A). In rotavirus-infected cells expressing mRFP-GFP-LC3, both RFP and GFP signals were detected and colocalized in puncta (Fig. 4B), indicating a block in autophagosome maturation.

To confirm that rotavirus blocks the NSP4/LC3-positive membranes from fusing with lysosomes, Lysotracker (Invitrogen) was allowed to accumulate in lysosomes from 4 to 7 hpi. Lysotracker probes are weakly basic amines that selectively accumulate in the low pH of lysosomes and autolysosomes. Lysotracker did not colocalize with NSP4/LC3/viroplasm puncta (Fig. S1B). Additionally, the NSP4/LC3/viroplasm puncta did not colocalize with the autolysosome marker protein LAMP1 (Fig. S1C). Together, these results indicate that the NSP4/LC3 puncta do not fuse with lysosomes; thus, rotavirus infection not only initiates the early stages of the autophagy process but suppresses autophagy maturation.

NSP4 Viroporin-Mediated Increase in Cytoplasmic Calcium, and Not the Unfolded Protein Response, Promotes NSP4/LC3 Puncta Formation.

Induction of autophagy is complex and can occur through multiple signaling pathways (4). NSP4 is synthesized as an ER transmembrane protein, and the rapid accumulation of NSP4 could induce the unfolded protein response (UPR) leading to the initiation of autophagy. Alternatively, autophagy could be initiated by elevated [Ca2+]cyto (22). We recently reported NSP4 is a viroporin that mediates an increase in [Ca2+]cyto (23). Because expression of NSP4 alone induced NSP4/LC3 puncta formation (12), we used expression of WT NSP4 and a viroporin mutant, NSP4-ASDASA, which does not elevate [Ca2+]cyto (23), to determine whether induction of the UPR or elevation of [Ca2+]cyto could be responsible for initiation of the autophagy process and LC3 puncta formation. We reasoned that autophagy induced by the UPR would be detected by the appearance of NSP4/LC3 puncta following expression of either WT NSP4-EGFP or NSP4-ASDASA-EGFP. However, if elevated [Ca2+]cyto triggered autophagy, NSP4/LC3 puncta would be observed following expression of WT NSP4-EGFP but not NSP4-ASDASA-EGFP. We observed NSP4/LC3 puncta in 90% of cells expressing WT NSP4-EGFP (Fig. 5 A, Top, and B) but in only 2% of cells expressing NSP4-ASDASA-EGFP (Fig. 5 A, Middle, and B; P < 0.001, Fisher’s exact test). The expression level of both proteins was similar as assessed by Western blot (23). These results suggest that NSP4/LC3 puncta formation is not a result of induction of the UPR but is a direct result of NSP4 viroporin-mediated elevation of [Ca2+]cyto.

Fig. 5.

Fig. 5.

NSP4-mediated increase in [Ca2+]cyto activates the CaMKK-β pathway to induce NSP4/LC3 puncta formation. (A) MA104 cells were transfected with WT NSP4-EGFP (Top) or NSP4-ASDASA-EGFP (Middle and Bottom). NSP4-ASDASA-EGFP–expressing cells were cultured in the absence (Middle) or presence (Bottom) of TG. At 24 hpi, the cells were fixed, stained with antibody against LC3, and imaged by confocal microscopy. (Scale bars: Top, 10 μm; Middle and Bottom, 5 μm.) (B) Quantitation of the number of cells imaged by confocal microscopy in A that contain NSP4 and LC3 that colocalize in puncta. (C) MA104 cells were transfected with WT NSP4-EGFP and cultured in media (Vehicle), 50 μM BAPTA-AM, or 50 μM STO-609. At 24 hpi, the cells were fixed, stained with antibody against LC3, and imaged by confocal microscopy, and the number of cells containing only NSP4 puncta (white bars) or puncta containing both NSP4 and LC3 that colocalize (black bars) were quantitated. *P < 0.001 compared with WT NSP4-EGFP–expressing cells.

The NSP4-ASDASA mutant was previously shown to form puncta following elevation of [Ca2+]cyto by the sarcoplasmic/ER Ca2+-ATPase (SERCA) inhibitor thapsigargin (TG) (23). To assess whether LC3 colocalized with these NSP4 puncta, NSP4-ASDASA-EGFP was expressed in the presence of TG. LC3/NSP4 puncta were observed in 77% of TG-treated NSP4-ASDASA-EGFP–expressing cells (n = 79 cells; Fig. 5 A, Bottom, and B) compared with 2% of NSP4-ASDASA-EGFP–expressing cells (n = 51 cells; Fig. 5 A, Middle, and B; P < 0.001, Fisher’s exact test). These data indicate that an increase in [Ca2+]cyto leads to NSP4/LC3 puncta formation.

To confirm that increased [Ca2+]cyto is responsible for NSP4/LC3 puncta formation, WT NSP4-EGFP–expressing cells were cultured in the absence or presence of the calcium chelator 1,2-Bis(2-aminophenoxy)ethane-N,N,N′,N′-tetraacetic acid tetrakis(acetoxymethyl ester) (BAPTA-AM) and the number of cells containing NSP4/LC3 puncta or NSP4 puncta alone was quantitated. In the absence of BAPTA-AM, 90% of WT NSP4-EGFP–expressing cells contained NSP4/LC3 puncta (n = 21 cells). However, only 5% of the BAPTA-treated WT NSP4-EGFP–expressing cells contained NSP4/LC3 puncta (n = 60 cells; Fig. 5C and Fig. S2A, Upper). BAPTA treatment also reduced the number of cells containing NSP4 puncta (62%). Altogether, these results indicate elevated [Ca2+]cyto induces autophagy and is required for the formation of NSP4/LC3 puncta.

NSP4-Mediated Elevation in [Ca2+]Cyto Activates CaMKK-β to Initiate Autophagy and NSP4/LC3 Puncta Formation.

Elevated [Ca2+]cyto-mediated induction of autophagy is proposed to occur through activation of CaMKK-β, which phosphorylates and activates 5′ adenosine monophosphate-activated protein kinase (AMPK) (24). To determine whether the NSP4 viroporin-mediated increase in [Ca2+]cyto signals through CaMKK-β for the induction of autophagy, WT NSP4-EGFP was expressed in MA104 cells in the absence or presence of 7-Oxo-7H-benzimidazo[2,1-a]benz[de]isoquinoline-3-carboxylic acid acetate (STO-609), a specific CaMKK-β inhibitor, and cells were evaluated for the presence of NSP4/LC3 puncta (25, 26). NSP4/LC3 puncta were observed in 90% of the WT NSP4-EGFP–expressing cells (n = 21), whereas NSP4/LC3 puncta were observed in only 40% of STO-609–treated WT NSP4-EGFP–expressing cells (n = 34 cells; Fig. 5C and Fig. S2A, Lower; P = 0.0002, Fisher’s exact test). STO-609 did not prevent the NSP4-mediated elevation in [Ca2+]cyto; a similar increase in [Ca2+]cyto was observed in cells expressing NSP4 either in the absence or presence of STO-609 as measured by the fluorescent Ca2+ indicator Fluo-2. This was also reflected in the ability of NSP4 to form puncta to a similar level in cells cultured in the presence or absence of STO-609 (Fig. 5C).

NSP4-Viroporin–Mediated Increase in [Ca2+]Cyto Activates the CaMKK-β Signaling Pathway to Induce Autophagy in Rotavirus-Infected Cells.

To confirm that rotavirus infection and Ca2+-mediated activation of CaMKK-β leads to phosphorylation of AMPK (P-AMPK) and initiation of autophagy, rotavirus-infected cells were cultured in the absence and presence of STO-609. At 4 hpi, P-AMPK was detected by Western blot analysis in rotavirus-infected cells cultured in the absence of STO-609 but was not detected in cells cultured in the presence of STO-609 (Fig. 6A). Detection of LC3 II was used to assess whether inhibition of CaMKK-β by STO-609 abrogated autophagy initiation following rotavirus infection. LC3 II was detected by Western blot analysis in the rotavirus-infected cells (6 hpi) cultured in the absence of STO-609, but only LC3 I was detected in the rotavirus-infected cells cultured in the presence of STO-609 (Fig. 6A). A similar level of NSP4 expression was observed in rotavirus-infected cell lysates cultured in the absence or presence of STO-609 (Fig. 6A, Lower).

Fig. 6.

Fig. 6.

Chelation of [Ca2+]cyto and inhibition of CaMKK-β by STO-609 abrogate rotavirus-induced autophagy and decrease rotavirus yield. (A) Rotavirus-infected MA104 cells were cultured in the absence (−) or presence (+) of STO-609 and harvested at 4 hpi (Left) or 6 hpi (Right). Cell lysates were analyzed by Western blot to detect P-AMPK, LC3, and NSP4, as well as GAPDH as a loading control. Quantification of NSP4 normalized to GAPDH (n = 3) is shown below the blot detected with antibody against NSP4. (B) MA104 cells transfected with NSP4-specific siRNA (G10) or Scr control and either rotavirus (RV)- or mock-infected. Cell lysates were harvested 6 hpi and analyzed by Western blot to detect LC3, and NSP4, as well as GAPDH as a loading control. Quantification of LC3 II/LC3 I ratios and NSP4 normalized to GAPDH is shown below the respective blots (n = 3). MA104 cells were infected with rotavirus [multiplicity of infection (moi) 1], and medium (black bars) or medium containing STO-609 (C; 25 μM, gray bars; 50 μM, white bars) or BAPTA-AM (D; 50 μM, white bars) was then added at 1 hpi. The cells and media were harvested at the indicated times and assayed for infectious rotavirus by fluorescent focus assay. Data shown represent one of three separate experiments performed in quadruplicate. *P ≤ 0.01 compared with cells without STO-609 or BAPTA-AM treatment. Error bars represent SD. Cell viability was assessed by trypan blue exclusion (98% and 96%, respectively, in mock-infected or STO-609– or BAPTA-AM–treated cells).

To confirm that expression of NSP4 alone in the context of virus infection is responsible for the induction of autophagy, MA104 cells were transfected with a scrambled (Scr) siRNA or siRNA against gene 10, which encodes NSP4 (G10), and infected with rotavirus 72 h post transfection. Western blot analysis revealed that NSP4 expression and, concomitantly, the LC3 II/LC3 I ratio were reduced in NSP4-specific siRNA-transfected cells compared with Scr siRNA-transfected cells (Fig. 6B). The LC3 II/LC3 I ratio detected in NSP4-specific siRNA-transfected cells was similar to that in mock-infected cells. Altogether, these results indicate that (i) NSP4-viroporin–mediated increase in [Ca2+]cyto following rotavirus infection activates the CaMKK-β signaling pathway to induce autophagy, (ii) treatment with the CaMKK-β–specific inhibitor STO-609 abrogates such initiation of autophagy, and (iii) expression of the rotavirus viroporin alone is responsible for induction of autophagy.

Inhibition of CaMKK-β or Chelating [Ca2+]Cyto Reduces the Yield of Rotavirus.

We next investigated production of infectious progeny grown in the presence or absence of STO-609 or BAPTA-AM. Because inhibiting autophagy using 3-MA or cells genetically deficient in proteins required for autophagy membrane formation reduced the yield of rotavirus, we expected that if autophagy was initiated by the viroporin-mediated activation of CaMKK-β, inhibition of CaMKK-β with STO-609 or chelating [Ca2+]cyto would reduce the yield of rotavirus. The yield of virus was significantly reduced (an average of 94% from 6 to 24 hpi, with 50 μM STO-609) in a concentration-dependent manner in the presence of the CaMKK-β inhibitor STO-609 (Fig. 6C). Similarly, chelating [Ca2+]cyto by BAPTA-AM significantly reduced the yield of rotavirus (an average of 84% from 6 to 24 hpi) (Fig. 6D) as well as NSP4 expression (an average of 17% from three experiments at 6 hpi). These results confirm that rotavirus, specifically the NSP4-viroporin–mediated increase in [Ca2+]cyto, activates CaMKK-β–AMPK signaling to induce autophagy and chelating calcium or inhibiting CaMKK-β suppresses rotavirus-mediated induction of autophagy and virus replication.

Rotavirus Hijacks the Autophagy Membrane Trafficking Pathway to Transport the Viral ER-Associated Proteins to Sites of Virus Replication.

NSP4 and LC3 form small puncta at an early time point postinfection (Fig. 3). These small puncta fuse and then surround viroplasms, where nascent virus replicates. Infectious particle assembly requires interaction of newly made virus particles with NSP4, which triggers particle budding into membranes, resulting in transiently enveloped particles. By an unknown mechanism, the transient envelope is lost and the outer capsid proteins (VP4 and VP7) then assemble onto the particle to form the mature, infectious particle.

Treating cells expressing the viroporin mutant NSP4-ASDASA-EGFP with TG resulted in the formation of NSP4-ASDASA-EGFP puncta that colocalized with LC3. In rotavirus-infected cells, NSP4 mediates the early increase of [Ca2+]cyto. Therefore, we next determined whether the increase of [Ca2+]cyto due to expression of WT NSP4 in the context of virus infection would trigger the viroporin mutant NSP4-ASDASA-EGFP to form puncta and whether NSP4-ASDASA-EGFP would surround viroplasms. In transfected but not rotavirus-infected cells, NSP4-ASDASA-EGFP was reticular, similar to that observed in Fig. 5A. However, in NSP4-ASDASA-EGFP–expressing and rotavirus-infected cells in which viral-encoded NSP4 increased [Ca2+]cyto, NSP4-ASDASA-EGFP puncta formed and surrounded viroplasms (Fig. S2B). This result indicates that the viral-encoded NSP4 increase in [Ca2+]cyto is responsible for trafficking the viroporin mutant protein to viroplasms.

In the presence of the CaMKK-β inhibitor, STO-609, production of infectious virus was significantly reduced (Fig. 6B). Therefore, we next determined by confocal microscopy the localization of NSP4 and VP7, an ER-associated outer capsid protein, in rotavirus-infected cells cultured in the absence or presence of STO-609 (Fig. 7). In the absence of STO-609, NSP4 and VP7 surround viroplasms (Fig. 7, Upper). In contrast, in the presence of STO-609 when autophagy is inhibited, NSP4 and VP7 trafficking to the viroplasms is inhibited and neither NSP4 nor VP7 surrounds viroplasms. The confocal and infectivity assay results indicate rotavirus hijacks the autophagy trafficking pathway to transport the ER-associated viral proteins required for infectious particle assembly to viroplasms.

Fig. 7.

Fig. 7.

Inhibition of autophagy by STO-609 hinders NSP4 and VP7 trafficking to viroplasms. Rotavirus-infected MA104 cells were cultured in the absence [(−)STO-609, Upper] or presence [(+)STO-609, Lower] of 50 μM STO-609. At 7 hpi, cells were fixed, permeabilized, and stained with antibody against NSP5 to detect viroplasms (teal), VP7 (green), or NSP4 (red). The nuclei were detected by DAPI. (Scale bar: 5 μm.)

Discussion

Autophagy is vital for the replication of numerous DNA and RNA viruses (2). Many of these viruses exploit the autophagy process to enhance viral replication by inducing de novo synthesis of autophagy membranes or impeding autophagy maturation. This report demonstrates that (i) a nonenveloped, segmented dsRNA virus (rotavirus) initiates the autophagy process; (ii) autophagy is initiated by a virus-encoded viroporin that releases ER calcium into the cytoplasm, activating a CaMKK-β- and AMPK-dependent signaling pathway; and (iii) a virus hijacks the autophagy membrane trafficking pathway to transport viral proteins required for infectious particle assembly to sites of virus replication.

Viroporins are small, hydrophobic proteins that oligomerize to create a transmembrane aqueous pore. NSP4 contains the common structural motifs of a viroporin, consisting of a hydrophobic domain that forms an amphipathic α-helix and a cluster of basic (positively charged) residues that electrostatically interact with negatively charged phospholipids to aid in membrane insertion. The NSP4 viroporin domain is responsible for the release of ER calcium into the cytoplasm, and NSP4 expression alone is sufficient to initiate NSP4/LC3 puncta formation (12). Mutation of the amphipathic α-helix of NSP4 that forms the pore lumen on oligomerization abrogates both ER calcium release and the formation of NSP4/LC3 puncta; however, treatment of viroporin mutant-expressing cells with TG triggered puncta formation. Although the NSP4 viroporin and TG both elevate cytosolic calcium, the mechanisms by which this occurs are very different. NSP4 increases ER membrane permeability to calcium without blocking SERCA-mediated calcium uptake (27, 28). In contrast, Michelangeli et al. (29) reported that TG treatment reduces virus yield due to improper VP7 assembly onto particles, which was attributed to TG blocking calcium uptake rather than the indirect elevation in cytosolic calcium. Our data show that NSP4 viroporin-mediated increases in cytoplasmic calcium activate a specific calcium-induced signaling pathway to initiate autophagy, which enables trafficking of NSP4 and VP7 to viroplasms for subsequent virus assembly.

Rotavirus-initiated autophagy involves the release of ER calcium by ER-localized NSP4 to elevate [Ca2+]cyto, thereby activating CaMKK-β that phosphorylates AMPK to initiate autophagy. Phosphorylated AMPK can either negatively regulate the mTOR complex (mTORC1) or directly phosphorylate ULK1, both of which can initiate the autophagy process (30, 31). Formation of endogenous LC3-containing autophagy-like membranes requires PI3K activity, as well as the autophagy-initiation proteins Atg3 and Atg5, indicating that these membranes are autophagy membranes. By confocal microscopy, NSP4 and LC3 form small and subsequently larger NSP4/LC3 puncta that eventually surround viroplasms. Our results are consistent with reports that the ER is a source of autophagy membranes (32) because NSP4 is initially synthesized as an ER transmembrane glycoprotein.

Rotavirus-induced autophagosome-like vesicles fail to fuse with lysosomes in rotavirus-infected cells, indicating that rotavirus infection not only initiates the autophagy process but suppresses autophagy maturation. Inhibiting autophagy maturation may help rotavirus evade the antiviral function of autophagy. Suppression of autophagy vesicle maturation has been reported for influenza A virus and HIV (33, 34). Influenza A M2 and HIV Nef viral proteins interact with beclin to suppress the fusion of autophagosomes and lysosomes. Although it is unknown whether rotavirus proteins interact with autophagy proteins to suppress autophagy maturation, rotavirus encodes two proteins, NSP4 and NSP2, that depolymerize the microtubule network (35, 36). Microtubules are required for autophagosome trafficking (37). The poliovirus 3A protein disrupts microtubules, which inhibits autophagosome-like vesicle trafficking (7). However, poliovirus induces autophagosome-like vesicles that are decorated by lipidated LC3 and the lysosomal marker protein LAMP1, indicating that these vesicles have fused with lysosomes (6). Future studies will determine whether disruption of microtubules or another mechanism is responsible for the lack of fusion between the autophagosome-like puncta surrounding viroplasms and lysosomes in rotavirus-infected cells.

RNA viruses, such as picornaviruses (poliovirus, coxsackievirus, and rhinovirus) and flaviviruses (hepatitis C virus and dengue virus), induce autophagy to rearrange membranes as a scaffold for genome replication (8, 38, 39). Induction of autophagy by rapamycin, the pharmacological inhibitor of mTOR, favors replication of these viruses (6, 40, 41). In contrast, rotavirus RNA replication, which occurs in viroplasms, does not use autophagy membranes as a surface for genome replication, and treatment of cells with rapamycin does not affect virus replication. Instead, rotavirus actively induces autophagy membrane formation and hijacks the membrane trafficking pathway of autophagy to transport the ER-associated proteins NSP4 and VP7 to viroplasms, the site of genome replication and immature particle formation. The interaction of NSP4 with immature particles at the interface between viroplasms and NSP4/LC3-containing membranes triggers particle budding through these membranes that facilitates the assembly of outer capsid proteins to form the mature infectious particles (11). Thus, rotavirus manipulates the autophagy membrane trafficking process to acquire membranes required for infectious particle assembly, yet the mechanisms and factors that facilitate NSP4/LC3 trafficking remain unknown. This is a unique example of a virus hijacking autophagy membranes for capsid protein trafficking to the site of virus assembly.

A number of viruses (picornaviruses: poliovirus, rhinovirus, coxsackievirus, and hepatitis B virus) induce autophagy as well as increase [Ca2+]cyto, leading to the question: Is virus-mediated elevation in [Ca2+]cyto a common mechanism for the induction of autophagy? The mechanism(s) used by these viruses to induce autophagy is largely unknown; however, all encode one or more proteins that increase [Ca2+]cyto from ER or Golgi [Ca2+] stores, or increase storage-operated calcium entry (42, 43). Thus, CaMKK-β activation through elevated [Ca2+]cyto may be a common mechanism for these viruses to induce autophagy. Future studies will determine if these pathogens induce autophagy by activating CaMKK-β and the potential for STO-609 to be a broadly acting antiviral drug.

Materials and Methods

Cells and Virus.

Rotavirus SA114F (G3P6[1]) was cultivated in fetal rhesus monkey kidney (MA104) cells in the presence of trypsin as previously described (44). Immortalized Atg5−/− and Atg5+/+ (45) or Atg3−/− and Atg3+/+ mouse embryonic fibroblasts (46) were cultivated in DMEM containing 10% FBS, as well as 1× essential and nonessential amino acids (Invitrogen). Virus in cells and media was titered by fluorescent focus assay as previously described (47).

Antibodies and Chemicals.

The antibodies against NSP4 used in this study were mouse monoclonal antibody B4-2/55/17(1)/13 and rabbit peptide-specific antibody αNSP4114–135 (48). A guinea pig hyperimmune serum prepared against NSP5 purified from Escherichia coli as previously described (49) was generated by Cocalico Biologicals, Inc. Monoclonal antibody to VP7 (mAb 60) was kindly provided by H. B. Greenberg (Stanford University School of Medicine, Palo Alto, CA). LC3 antibody was obtained from Novus, and GAPDH antibody was obtained from Chemicon (mouse mAb 374). Secondary Alexa Fluor 488-, 568-, and 633-conjugated antibodies were obtained from Invitrogen. Lysotracker, BAPTA-AM, and TG were obtained from Invitrogen; bafilomycin A was obtained from Santa Cruz Biotechnology; 3-MA was obtained from Sigma; and STO-609 was obtained from Tocris.

Transient Transfection.

MA104 cells were transfected with the mRFP-GFP-LC3 plasmid (Addgene), or Atg5−/− cells were transfected with the plasmids (p) pEGFP-C1-mApg5 (WT Atg5-EGFP) expressing mouse WT Atg5 or with pEGFP-C1-mApg5(K130R) (Atg5-EGFP K130R) expressing a mutant Atg5 (Addgene) (20) as previously described (12). The transfection efficiencies were between 50% and 60% as assessed by EGFP expression before infection. Cells were infected with SA114F rotavirus 24 h posttransfection.

For siRNA experiments, 75 pmol of annealed duplex siRNA (Dharmacon Research) for the SA11 clone 3 gene 10 siRNA sequence, AAGCCACAGUCAGCCAUAUCG, or for Scr control, AAGCGGCCCUCCAAAGCCAAA, was transfected into MA104 cells using Lipofectamine 2000 (Invitrogen) (50). Cells were infected 72 h after transfection with SA11 clone 3 rotavirus or were mock-infected.

Western Blot Analysis.

Samples were analyzed by Western blot as previously described (47). Quantification of bands on Western blots was performed using ImageJ (National Institutes of Health).

Confocal Microscopy.

Confocal microscopy was performed as previously described (51).

Puncta Formation Assay.

MA104 cells on coverslips were transfected with plasmids expressing WT NSP4-EGFP or NSP4-ASDASA-EGFP (23) as previously described (12). MA104 cells were either loaded with 50 μM BAPTA-AM at 4 h posttransfection or maintained in normal medium. At ∼20 h posttransfection, a subset of the transfected cells was treated with 1 μM TG for 3 h, and all the cells were then fixed, permeabilized, and stained as described above. To quantitate the number of cells containing diffuse or punctate NSP4-EGFP or NSP4-ASDASA-EGFP and colocalization with LC3, random fields from two experiments were imaged by confocal microscopy and the images were collected. Cells with a reticular NSP4-EGFP distribution were scored as having no puncta. The majority of cells with either NSP4 alone or NSP4/LC3 puncta contained between 7 and 35 puncta; however, NSP4-ASDASA-EGFP–expressing cells with the presence of even a single punctate structure were scored as having puncta.

Trypan Blue Staining.

To check cell viability, cells were stained with 0.4% trypan blue at room temperature for 5 min.

Statistical Analysis.

Statistical differences between groups were determined using a two-tailed Student t test or Fisher’s exact test. P values of <0.05 were considered significant.

Supplementary Material

Supporting Information

Acknowledgments

This study was supported by National Institutes of Health Public Health Service Award R01 AI080656. Funding for imaging was provided by Specialized Cooperative Centers Program in Reproduction (SCCPR) Grant U54 HD-007495 (to B. W. O’Malley); Grant P30 DK-56338, which funds the Texas Medical Center Digestive Diseases Center (to M.K.E.); and Grant P30 CA-125123 (to C. K. Osborne). Funding was also provided by the Dan L. Duncan Cancer Center of Baylor College of Medicine.

Footnotes

The authors declare no conflict of interest.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1216539109/-/DCSupplemental.

References

  • 1.Levine B, Mizushima N, Virgin HW. Autophagy in immunity and inflammation. Nature. 2011;469(7330):323–335. doi: 10.1038/nature09782. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Dreux M, Chisari FV. Viruses and the autophagy machinery. Cell Cycle. 2010;9(7):1295–1307. doi: 10.4161/cc.9.7.11109. [DOI] [PubMed] [Google Scholar]
  • 3.Levine B, Kroemer G. Autophagy in the pathogenesis of disease. Cell. 2008;132(1):27–42. doi: 10.1016/j.cell.2007.12.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Mizushima N, Yoshimori T, Levine B. Methods in mammalian autophagy research. Cell. 2010;140(3):313–326. doi: 10.1016/j.cell.2010.01.028. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Itakura E, Mizushima N. Characterization of autophagosome formation site by a hierarchical analysis of mammalian Atg proteins. Autophagy. 2010;6(6):764–776. doi: 10.4161/auto.6.6.12709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Jackson WT, et al. Subversion of cellular autophagosomal machinery by RNA viruses. PLoS Biol. 2005;3(5):e156. doi: 10.1371/journal.pbio.0030156. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Taylor MP, Burgon TB, Kirkegaard K, Jackson WT. Role of microtubules in extracellular release of poliovirus. J Virol. 2009;83(13):6599–6609. doi: 10.1128/JVI.01819-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Wong J, et al. Autophagosome supports coxsackievirus B3 replication in host cells. J Virol. 2008;82(18):9143–9153. doi: 10.1128/JVI.00641-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Dreux M, Gastaminza P, Wieland SF, Chisari FV. The autophagy machinery is required to initiate hepatitis C virus replication. Proc Natl Acad Sci USA. 2009;106(33):14046–14051. doi: 10.1073/pnas.0907344106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Sir D, et al. Induction of incomplete autophagic response by hepatitis C virus via the unfolded protein response. Hepatology. 2008;48(4):1054–1061. doi: 10.1002/hep.22464. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Estes MK, Kapikian AZ. In: Fields Virology. Knipe DM, Howley PM, editors. Philadelphia: Lippincott William & Wilkins; 2007. pp. 1917–1974. [Google Scholar]
  • 12.Berkova Z, et al. Rotavirus NSP4 induces a novel vesicular compartment regulated by calcium and associated with viroplasms. J Virol. 2006;80(12):6061–6071. doi: 10.1128/JVI.02167-05. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Bagchi P, et al. Rotavirus nonstructural protein 1 suppresses virus-induced cellular apoptosis to facilitate viral growth by activating the cell survival pathways during early stages of infection. J Virol. 2010;84(13):6834–6845. doi: 10.1128/JVI.00225-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Dutta D, et al. The molecular chaperone heat shock protein-90 positively regulates rotavirus infection. Virology. 2009;391(2):325–333. doi: 10.1016/j.virol.2009.06.044. [DOI] [PubMed] [Google Scholar]
  • 15.Halasz P, Holloway G, Coulson BS. Death mechanisms in epithelial cells following rotavirus infection, exposure to inactivated rotavirus or genome transfection. J Gen Virol. 2010;91(Pt 8):2007–2018. doi: 10.1099/vir.0.018275-0. [DOI] [PubMed] [Google Scholar]
  • 16.Caro LH, Plomp PJ, Wolvetang EJ, Kerkhof C, Meijer AJ. 3-Methyladenine, an inhibitor of autophagy, has multiple effects on metabolism. Eur J Biochem. 1988;175(2):325–329. doi: 10.1111/j.1432-1033.1988.tb14200.x. [DOI] [PubMed] [Google Scholar]
  • 17.Punnonen EL, Marjomäki VS, Reunanen H. 3-Methyladenine inhibits transport from late endosomes to lysosomes in cultured rat and mouse fibroblasts. Eur J Cell Biol. 1994;65(1):14–25. [PubMed] [Google Scholar]
  • 18.Herbst S, Schaible UE, Schneider BE. Interferon gamma activated macrophages kill mycobacteria by nitric oxide induced apoptosis. PLoS ONE. 2011;6(5):e19105. doi: 10.1371/journal.pone.0019105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Xue L, Borutaite V, Tolkovsky AM. Inhibition of mitochondrial permeability transition and release of cytochrome c by anti-apoptotic nucleoside analogues. Biochem Pharmacol. 2002;64(3):441–449. doi: 10.1016/s0006-2952(02)01181-4. [DOI] [PubMed] [Google Scholar]
  • 20.Mizushima N, et al. Dissection of autophagosome formation using Apg5-deficient mouse embryonic stem cells. J Cell Biol. 2001;152(4):657–668. doi: 10.1083/jcb.152.4.657. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Geng J, Klionsky DJ. The Atg8 and Atg12 ubiquitin-like conjugation systems in macroautophagy. ‘Protein modifications: Beyond the usual suspects’ review series. EMBO Rep. 2008;9(9):859–864. doi: 10.1038/embor.2008.163. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Høyer-Hansen M, Jäättelä M. Connecting endoplasmic reticulum stress to autophagy by unfolded protein response and calcium. Cell Death Differ. 2007;14(9):1576–1582. doi: 10.1038/sj.cdd.4402200. [DOI] [PubMed] [Google Scholar]
  • 23.Hyser JM, Collinson-Pautz MR, Utama B, Estes MK. Rotavirus disrupts calcium homeostasis by NSP4 viroporin activity. MBio. 2010;1(5):pii: e00265-10. doi: 10.1128/mBio.00265-10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Høyer-Hansen M, et al. Control of macroautophagy by calcium, calmodulin-dependent kinase kinase-beta, and Bcl-2. Mol Cell. 2007;25(2):193–205. doi: 10.1016/j.molcel.2006.12.009. [DOI] [PubMed] [Google Scholar]
  • 25.Tokumitsu H, et al. STO-609, a specific inhibitor of the Ca(2+)/calmodulin-dependent protein kinase kinase. J Biol Chem. 2002;277(18):15813–15818. doi: 10.1074/jbc.M201075200. [DOI] [PubMed] [Google Scholar]
  • 26.Tokumitsu H, Inuzuka H, Ishikawa Y, Kobayashi R. A single amino acid difference between alpha and beta Ca2+/calmodulin-dependent protein kinase kinase dictates sensitivity to the specific inhibitor, STO-609. J Biol Chem. 2003;278(13):10908–10913. doi: 10.1074/jbc.M213183200. [DOI] [PubMed] [Google Scholar]
  • 27.Tian P, et al. The nonstructural glycoprotein of rotavirus affects intracellular calcium levels. J Virol. 1994;68(1):251–257. doi: 10.1128/jvi.68.1.251-257.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Tian P, et al. The rotavirus nonstructural glycoprotein NSP4 mobilizes Ca2+ from the endoplasmic reticulum. J Virol. 1995;69(9):5763–5772. doi: 10.1128/jvi.69.9.5763-5772.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Michelangeli F, Liprandi F, Chemello ME, Ciarlet M, Ruiz MC. Selective depletion of stored calcium by thapsigargin blocks rotavirus maturation but not the cytopathic effect. J Virol. 1995;69(6):3838–3847. doi: 10.1128/jvi.69.6.3838-3847.1995. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Mizushima N. The role of the Atg1/ULK1 complex in autophagy regulation. Curr Opin Cell Biol. 2010;22(2):132–139. doi: 10.1016/j.ceb.2009.12.004. [DOI] [PubMed] [Google Scholar]
  • 31.Kim J, Kundu M, Viollet B, Guan KL. AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat Cell Biol. 2011;13(2):132–141. doi: 10.1038/ncb2152. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Axe EL, et al. Autophagosome formation from membrane compartments enriched in phosphatidylinositol 3-phosphate and dynamically connected to the endoplasmic reticulum. J Cell Biol. 2008;182(4):685–701. doi: 10.1083/jcb.200803137. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Kyei GB, et al. Autophagy pathway intersects with HIV-1 biosynthesis and regulates viral yields in macrophages. J Cell Biol. 2009;186(2):255–268. doi: 10.1083/jcb.200903070. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Gannagé M, et al. Matrix protein 2 of influenza A virus blocks autophagosome fusion with lysosomes. Cell Host Microbe. 2009;6(4):367–380. doi: 10.1016/j.chom.2009.09.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Yang W, McCrae MA. The rotavirus enterotoxin (NSP4) promotes re-modeling of the intracellular microtubule network. Virus Res. 2012;163(1):269–274. doi: 10.1016/j.virusres.2011.10.011. [DOI] [PubMed] [Google Scholar]
  • 36.Martin D, Duarte M, Lepault J, Poncet D. Sequestration of free tubulin molecules by the viral protein NSP2 induces microtubule depolymerization during rotavirus infection. J Virol. 2010;84(5):2522–2532. doi: 10.1128/JVI.01883-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Jahreiss L, Menzies FM, Rubinsztein DC. The itinerary of autophagosomes: From peripheral formation to kiss-and-run fusion with lysosomes. Traffic. 2008;9(4):574–587. doi: 10.1111/j.1600-0854.2008.00701.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Kirkegaard K. Subversion of the cellular autophagy pathway by viruses. Curr Top Microbiol Immunol. 2009;335:323–333. doi: 10.1007/978-3-642-00302-8_16. [DOI] [PubMed] [Google Scholar]
  • 39.Prentice E, Jerome WG, Yoshimori T, Mizushima N, Denison MR. Coronavirus replication complex formation utilizes components of cellular autophagy. J Biol Chem. 2004;279(11):10136–10141. doi: 10.1074/jbc.M306124200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.McLean JE, Wudzinska A, Datan E, Quaglino D, Zakeri Z. Flavivirus NS4A-induced autophagy protects cells against death and enhances virus replication. J Biol Chem. 2011;286(25):22147–22159. doi: 10.1074/jbc.M110.192500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Huang SC, Chang CL, Wang PS, Tsai Y, Liu HS. Enterovirus 71-induced autophagy detected in vitro and in vivo promotes viral replication. J Med Virol. 2009;81(7):1241–1252. doi: 10.1002/jmv.21502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.de Jong AS, et al. Functional analysis of picornavirus 2B proteins: Effects on calcium homeostasis and intracellular protein trafficking. J Virol. 2008;82(7):3782–3790. doi: 10.1128/JVI.02076-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Yang B, Bouchard MJ. The hepatitis B virus X protein elevates cytosolic calcium signals by modulating mitochondrial calcium uptake. J Virol. 2012;86(1):313–327. doi: 10.1128/JVI.06442-11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Estes MK, Graham DY, Gerba CP, Smith EM. Simian rotavirus SA11 replication in cell cultures. J Virol. 1979;31(3):810–815. doi: 10.1128/jvi.31.3.810-815.1979. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Alexander DE, Ward SL, Mizushima N, Levine B, Leib DA. Analysis of the role of autophagy in replication of herpes simplex virus in cell culture. J Virol. 2007;81(22):12128–12134. doi: 10.1128/JVI.01356-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Sou YS, et al. The Atg8 conjugation system is indispensable for proper development of autophagic isolation membranes in mice. Mol Biol Cell. 2008;19(11):4762–4775. doi: 10.1091/mbc.E08-03-0309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 47.Crawford SE, et al. Trypsin cleavage stabilizes the rotavirus VP4 spike. J Virol. 2001;75(13):6052–6061. doi: 10.1128/JVI.75.13.6052-6061.2001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Hyser JM, Zeng CQ, Beharry Z, Palzkill T, Estes MK. Epitope mapping and use of epitope-specific antisera to characterize the VP5* binding site in rotavirus SA11 NSP4. Virology. 2008;373(1):211–228. doi: 10.1016/j.virol.2007.11.021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Jiang X, et al. Cryoelectron microscopy structures of rotavirus NSP2-NSP5 and NSP2-RNA complexes: Implications for genome replication. J Virol. 2006;80(21):10829–10835. doi: 10.1128/JVI.01347-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50.Berkova Z, Crawford SE, Blutt SE, Morris AP, Estes MK. Expression of rotavirus NSP4 alters the actin network organization through the actin remodeling protein cofilin. J Virol. 2007;81(7):3545–3553. doi: 10.1128/JVI.01080-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 51.Hyser JM, Utama B, Crawford SE, Estes MK. Genetic divergence of rotavirus nonstructural protein 4 results in distinct serogroup-specific viroporin activity and intracellular punctate structure morphologies. J Virol. 2012;86(9):4921–4934. doi: 10.1128/JVI.06759-11. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting Information

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES