Skip to main content
Endocrinology logoLink to Endocrinology
. 2012 Dec 7;154(1):330–339. doi: 10.1210/en.2012-1829

PACAP Controls Adrenomedullary Catecholamine Secretion and Expression of Catecholamine Biosynthetic Enzymes at High Splanchnic Nerve Firing Rates Characteristic of Stress Transduction in Male Mice

N Stroth 1, B A Kuri 1, T Mustafa 1, S-A Chan 1, C B Smith 1,✉, L E Eiden 1,✉
PMCID: PMC3529367  PMID: 23221599

Abstract

The neuropeptide PACAP (pituitary adenylate cyclase-activating polypeptide) is a cotransmitter of acetylcholine at the adrenomedullary synapse, where autonomic regulation of hormone secretion occurs. We have previously reported that survival of prolonged metabolic stress in mice requires PACAP-dependent biosynthesis and secretion of adrenomedullary catecholamines (CAs). In the present experiments, we show that CA secretion evoked by direct high-frequency stimulation of the splanchnic nerve is abolished in native adrenal slices from male PACAP-deficient mice. Further, we demonstrate that PACAP is both necessary and sufficient for CA secretion ex vivo during stimulation protocols designed to mimic stress. In vivo, up-regulation of transcripts encoding adrenomedullary CA-synthesizing enzymes (tyrosine hydroxylase, phenylethanolamine N-methyltransferase) in response to both psychogenic and metabolic stressors (restraint and hypoglycemia) is PACAP-dependent. Stressor-induced alteration of the adrenomedullary secretory cocktail also appears to require PACAP, because up-regulation of galanin mRNA is abrogated in male PACAP-deficient mice. We further show that hypoglycemia-induced corticosterone secretion is not PACAP-dependent, ruling out the possibility that glucocorticoids are the main mediators of the aforementioned effects. Instead, experiments with bovine chromaffin cells suggest that PACAP acts directly at the level of the adrenal medulla. By integrating prolonged CA secretion, expression of biosynthetic enzymes and production of modulatory neuropeptides such as galanin, PACAP is crucial for adrenomedullary function. Importantly, our results show that PACAP is the dominant adrenomedullary neurotransmitter during conditions of enhanced secretory demand.


Mammalian stress responses are chiefly mediated by the hypothalamic-pituitary-adrenocortical (HPA) axis (1), adrenomedullary hormonal system (AHS), and sympathetic nervous system. The relative activities of these neuroendocrine circuits depend on the nature and duration of the initial stressor (1). Involvement of neuropeptides, the release of which is preferentially induced by high-frequency firing of stress-transducing neurons, has been suggested as a cellular hallmark of stress responses (2). At the adrenomedullary synapse, terminals of those neurons that comprise the splanchnic nerve coexpress the neuropeptide pituitary adenylate cyclase-activating polypeptide (PACAP) and the classical transmitter acetylcholine (ACh)(3–5). These terminals innervate chromaffin cells of the adrenal medulla and provoke secretion of catecholamines (CAs; mainly epinephrine), which constitutes the final step in stimulation of the AHS (1). Concomitantly, splanchnic nerve stimulation during stress causes expression and secretion of chromaffin cell neuropeptides including enkephalin, neuropeptide Y, and galanin (GAL) (6, 7).

Insulin-induced hypoglycemia (metabolic stressor) triggers a counterregulatory response during which CA secretion, activation of tyrosine hydroxylase (TH) and compensatory CA biosynthesis occur in the adrenal medulla. These events are significantly impaired in PACAP-deficient mice, resulting in dose-dependent mortality (4). Ex vivo, CA secretion from adrenal slices after high-frequency stimulation of the splanchnic nerve is abolished by the PACAP antagonist PACAP (6–38) (8). In addition to immediate regulation of catecholaminergic output, experiments in culture and in vivo implicate PACAP in adrenal expression of genes that encode CA biosynthetic enzymes (9–11) and neuropeptide modulators of adrenal secretory activity (12).

PACAP regulates hormone biosynthesis and secretion at peripheral (4) and central sites (13). To date, the relative role(s) of these sites during stress transduction have not been conclusively studied. Hence, our present experiments focus on ex vivo and cell culture models that isolate the AHS from the whole animal. Our results reveal that PACAP is crucial for sustained secretion of CA hormones and expression of their biosynthetic enzymes during stress.

Materials and Methods

Reagents

Common reagents were obtained through Sigma-Aldrich (St. Louis, MO) or Thermo Fisher Scientific (Waltham, MA), unless otherwise indicated. Common buffers (Tris-acetate-EDTA, PBS, saline-sodium citrate), diethylpyrocarbonate-treated water and miscellaneous solutions (Tris-HCl, NaCl etc.) were from Quality Biological (Gaithersburg, MD). Oligonucleotides were purchased from Integrated DNA Technologies (Coralville, IA).

Animals and treatments in vivo

PACAP-deficient mice generated by our group (4) were backcrossed with wild-type C57BL/6N (National Cancer Institute's Animal Production Program) over 12 generations. Subsequently, age-matched PACAP-deficient (PACAP−/−) and wild-type mice (PACAP+/+) were obtained via homozygous breeding pairs. Mature adult (3–7.6 months old) male mice were used for experiments in vivo. Mice were housed two to five individuals per cage in a dedicated facility providing controlled temperature (24 C), controlled relative humidity (∼40%), and a 12-h light, 12-h dark cycle (lights on at 0600 h). Standard rodent chow and tap water were provided ad libitum. Approximately 18 h before treatment, animals were transferred from the housing facility to the laboratory, at which point they were separated into individual cages. Treatments started between 0900 and 1100 h. All experiments were approved by the National Institute of Mental Health's Animal Care and Use Committee, and we made every effort to minimize the number of mice used in each part of the study.

Before experiments involving hypoglycemia, mice were fasted (chow removed from hopper) for about 18 h with continued access to drinking water. Human recombinant insulin (Humulin R, Eli Lilly & Co., Indianapolis, IN) was diluted to 0.5 U/ml in 0.9% sterile saline solution and administered ip at a dose of 2 U/kg body weight. Mice were subsequently returned to their individual cages. In a first set of experiments, mice were killed by decapitation 3 h after injection of insulin (stressor) or saline (control). In a second set of experiments, mice received an injection of glucose (2 g/kg, ip) 1 h after insulin to prevent mortality in PACAP−/− animals (4) and were killed 3 h or 6 h after the initial insulin injection. Untreated mice were used as controls in the latter experiments.

Restraint was carried out as described previously (10). Briefly, mice were restrained in tapered plastic film envelopes (DecapiCones; Braintree Scientific, Braintree, MA), with all four limbs underneath them, preventing any significant movement while allowing for unobstructed breathing. Mice were left untreated (controls) or restrained continuously for 1 h, 3 h, or 6 h. At the end of the treatment period, mice were decapitated while still restrained. Untreated controls were picked up from their cages by the tail, placed in DecapiCones and decapitated immediately (time from pickup to decapitation <20 sec).

After decapitation, both adrenal glands per mouse were quickly excised and frozen on dry ice (for RNA extraction), or embedded in Optimal Cutting Temperature compound (Sakura Finetek, Torrance, CA) and dropped into liquid nitrogen (for in situ hybridization). Tissue samples were stored at −80 C until use.

Measurement of corticosterone in serum

One cohort of male mice received an injection of saline or insulin as described above. Mice were decapitated 3 h after injection, and trunk blood was collected for preparation of serum. Corticosterone concentrations in serum were measured by RIA (Corticosterone Double Antibody 125I RIA kit; MP Biomedicals, Solon, OH) according to the manufacturer's instructions.

Preparation of tissue sections and in situ hybridization

Tissues were obtained and prepared for in situ hybridization as described elsewhere (13). Briefly, 14-μm frozen sections from left adrenal gland were thaw mounted, fixed in 4% formaldehyde (freshly prepared from paraformaldehyde) in PBS, washed in PBS (3 × 10 min), permeabilized in 0.4% Triton X-100 in PBS, washed in PBS, and rinsed in double-distilled water. Sections were acetylated in TEA buffer (1% triethanolamine in PBS, pH 8.0) containing 0.25% acetic anhydride, washed in PBS, rinsed in double-distilled water, dehydrated through 50% and 70% isopropanol, and allowed to air dry. A cRNA probe for GAL mRNA was derived from a 422-bp gene-specific PCR fragment. This fragment was subcloned into the pGEM-T vector (Promega Corp., Madison, WI), amplified using SP6 and T7 primers (see Table 1C), and transcribed in vitro in the presence of SP6 and T7 RNA polymerases (Roche Diagnostics, Mannheim, Germany) as well as 35S-labeled UTP (PerkinElmer, Boston, MA). Resulting sense and antisense transcripts were treated with RNase-free DNase I (Roche), purified (Micro Bio-Spin P-30 Tris Chromatography Columns; Bio-Rad Laboratories, Inc., Hercules, CA) and adjusted to 50,000 dpm/μl in hybridization buffer [10% dextran sulfate (EMD Chemicals, Gibbstown, NJ), 600 mm NaCl, 10 mm Tris-HCl, 1 mm EDTA disodium salt, 0.05% tRNA (Invitrogen, Carlsbad, CA), 1 × Denhardt's solution (USB Corp., Cleveland, OH), 100 μg/ml sonicated salmon sperm DNA (QIAGEN, Valencia, CA), 50% formamide] before application to tissue sections and overnight hybridization in a humidified chamber at 60 C. Posthybridization consisted of serial washing steps and removal of free cRNA through incubation in RNase buffer (containing 40 μg/ml RNase A and 2000 U RNase T1; Roche). Sections were finally air dried and coated with autoradiography emulsion Type NTB (Carestream Molecular Imaging, New Haven, CT). After exposure in the dark for 50 h at 4 C, sections were developed and fixed using Developer D-19 and Fixer (Eastman Kodak, Rochester, NY; obtained through Ted Pella Inc., Redding, CA) before light counterstaining with cresyl violet. Using a Darklite illuminator (Micro Video Instruments, Inc., Avon, MA), hybridization signals were visualized microscopically (Eclipse 50i microscope; Nikon Instruments, Melville, NY) and photographed (Retiga 1300i Fast 1394 camera; QImaging, Surrey, British Columbia, Canada).

Table 1.

Oligonucleotide primers used in the present study

PCR primers for mouse target genes
Primer Sequence (5′-3′) Amplicon (bp) PrimerBank ID
mGAL-F GGCAGCGTTATCCTGCTAGG 104 6753940a1
mGAL-R CTGTTCAGGGTCCAACCTCT
mPNMT-F GACTGGAGTGTGTATAGTCAGCA 109 6679405a3
mPNMT-R CGATAGGCAGGACTCGCTTC
mTH-F CTGTCTCGGGCTTTGAAAGTG 163 6678337a2
mTH-R GACGCACAGAACTGAGGAGG
PCR primers for bovine target genes
Primer Sequence (5′-3′) Amplicon (bp)
bGAL-F GACAGCCACAGGTCATTTCAA 76
bGAL-R GCCGGGCTTCGTCTTCA
bGAPDH-F GCATCGTGGAGGGACTTATGA 135
bGAPDH-R CAGCGCCAGTAGAAGCAGG
bPNMT-F CTTTCGACTGGAGCGTGTACAG 200
bPNMT-R CACTCCTTCTCCTGCCAGGAT
bTH-F CCTGACCTGGACTTGGATCAT 92
bTH-R TGCTTGTACTGGAAGGCGATCT
Primers for generation of in vitro transcription templates
Primer Sequence (5′-3′) Purpose
GAL-ISH-F GTGACCCTGTCAGCCACTCT Generation of a 422 bp
GAL-ISH-R ACGATTGGCTTGAGGAGTTG fragment for subcloning
SP6 CGATTTAGGTGACACTATAG Amplification of the fragment
T7 TAATACGACTCACTATAGGG plus promoter sequences

Mouse primers were retrieved from PrimerBank (http://pga.mgh.harvard.edu/primerbank/index.html) (25). Bovine primers were designed using Primer3 (available online, e.g. at http://frodo.wi.mit.edu/). GAPDH, Glyceraldehyde-3-phosphate dehydrogenase; ID, identification; ISH, in situ hybridization; F, forward; R, reverse. See Materials and Methods for additional details.

Adrenal slice preparation

Male mice (4-8 wk old) were used in this part of the study. Anesthesia and euthanasia protocols were approved by the Case Western Reserve University's Institutional Animal Care and Use Committee, a federal oversight body (federal welfare assurance number A3145-01). Animals were deeply anesthetized by isoflurane (USP, Halocarbon Products Corp., North Augusta, SC) inhalation and killed by decapitation. Adrenal glands were immediately excised and immersed in ice-cold low-calcium bicarbonate-buffered saline (BBS) containing (in mm) 140 NaCl, 2 KCl, 0.1 CaCl2, 5 MgCl2, 26 NaHCO3, and 10 glucose, bubbled with 95% O2/5% CO2. All chemicals were from Fisher Scientific (Florence, KY), except MgCl2 (Sigma-Aldrich). Osmolarity of the BBS solution was 320 mOsmol/liter. Adrenal glands were trimmed of excess fat and connective tissue and embedded in low melting temperature agarose (Lonza, Rockland, ME). Agarose was prepared by melting in low-calcium BBS heated to boiling for approximately 6 min, followed by equilibration in a 35 C water bath. Immediately after embedding, glands and agarose were placed on ice to set. Gelled agarose was trimmed into 3- to 5-mm blocks, each containing a single adrenal gland. Agarose blocks were glued to a vibratome sectioning stage (WPI, Sarasota, FL). The stage was placed in a slicing chamber filled with ice-cold low-calcium BBS that was continuously bubbled with 95% O2/5% CO2. Adrenal glands were sectioned at 200 μm, and slices were collected and placed in a holding chamber containing low-calcium BBS bubbled with 95% O2/5% CO2 at 25 C. Experiments were carried out 2-7 h after slice preparation.

Bipolar nerve stimulation ex vivo

The splanchnic nerve, which remains attached to the adrenal gland in our preparation, was stimulated by a bipolar stimulator (FHC. Inc., Bowdoin, ME) designed with two platinum electrodes, spaced 250 μm apart. The electrodes were connected to an ISO-Stim 01-D stimulator (NPI Electronic, Tamm, Germany) controlled by an EPC-9 amplifier programmed to generate TTL triggers. Under basal stimulation, the splanchnic nerve was stimulated for 10 pulses at a frequency of 0.2 Hz. Under stress stimulation, the nerve was stimulated with four bursts of 15 pulses at 2 Hz frequency with an interburst interval of 15 sec. Stimuli were delivered at a constant voltage of 35 V with 10 μsec duration.

Amperometric measurement of CA secretion

Tissue slices were constantly superfused during recordings with HEPES-buffered Ringer solution containing (in mm) 150 NaCl, 10 HEPES, 10 glucose, 2.8 CaCl2, 2.8 KCl, and 2 MgCl2. Ringer solution was adjusted to pH 7.2 with NaOH, and osmolarity was adjusted to 320 mOsmol/liter with mannitol. Tissue slices were held in place in the recording chamber by placing a silver wire over the agarose perimeter of the adrenal slice. Carbon fiber electrodes (ALA Scientific Instruments, Westbury, NY) of 5 μm diameter were used for detection of CA secretion from chromaffin cells in situ. Carbon fibers were placed as close to a cell as possible, without distorting the cell membrane. During amperometric recordings, a +650 mV charge was placed on the fiber through a dedicated VA-10 amperometry amplifier (ALA Scientific). Oxidative current was acquired through the VA-10, prefiltered at 1.3 kHz, and digitized at 20 kHz through an ITC-1600 digital to analog convertor (HEKA, Bellmore, NY). Quantified pooled data were determined from baseline subtracted, integrated amperometric currents at the 60-sec time point. PACAP38 and ACh used in adrenal slice experiments were obtained from Sigma-Aldrich.

Cell culture and treatment with PACAP38

Primary cultures of male bovine (steer) chromaffin cells (BCCs) were generated and maintained as described elsewhere (12). Approximately 500,000 cells per well were plated in 24-well plates coated with poly-d-lysine. PACAP38 (Phoenix Pharmaceuticals, Burlingame, CA) was diluted in culture medium before being added to the cells.

RNA extraction, reverse transcription (RT), and quantitative PCR

Total RNA was extracted from both adrenal glands per mouse using an ultrasonic processor (GE 130PB; Hielscher Systems, Ringwood, NJ) and a commercial kit (RNeasy Mini; QIAGEN) according to the manufacturer's instructions. Genomic DNA was fragmented via addition of RNase-free DNase I (Roche), and an aliquot of each sample, corresponding to 0.5 μg RNA, was reverse transcribed with random hexamer primers and 50 U of SuperScript II Reverse Transcriptase (Invitrogen). The final reaction volume of 22 μl was diluted 1:2 in diethylpyrocarbonate-treated H2O before 2 μl of the resulting cDNA sample were used per well for quantitative PCR. Reactions were prepared by adding iQ SYBR Green Supermix (Bio-Rad) and a final concentration of 200 nm gene-specific primers (see Table 1), with each cDNA sample assayed in duplicate. The following conditions were used on an iCycler iQ Real Time PCR System (Bio-Rad): initial heating to 95 C for 3 min, 40 cycles of 95 C for 10 sec plus 55 C for 45 sec, followed by 95 C for 60 sec and 55 C for 60 sec. BCCs were processed in a similar fashion, with the exception that total RNA was sometimes extracted with a different commercial kit (RNAqueous; Applied Biosystems/Ambion, Austin, TX), a different DNase (Deoxyribonuclease I, Invitrogen) was used, and primer concentration in quantitative PCR was 10 nm. Based on the aforementioned workflow and the threshold cycles of gene-specific standard curves, absolute transcript abundance was calculated for all mouse tissue samples and expressed as picograms per adrenal pair. For BCCs, relative changes in gene expression were determined based on the ΔΔCt method (14) using GAPDH as reference gene.

Statistical analysis

All statistical results were calculated using Prism 5 (GraphPad Software, La Jolla, CA). Data obtained in vivo were analyzed by two-way ANOVA with genotype and treatment as factors. Bonferroni's posttest was used for comparison between genotypes at individual time points. Where a significant main effect of treatment was found, Student's unpaired t test (comparison of two groups) or one-way ANOVA (comparison of more than two groups) was used for post hoc analysis within genotype. Data from adrenal slices ex vivo and BCCs in culture were analyzed with Student's unpaired t test (comparison of two groups) or one-way ANOVA followed by Bonferroni's posttest (comparison of more than two groups). Differences were considered statistically significant at P < 0.05.

Results

Release of presynaptic PACAP is necessary and sufficient for CA secretion evoked by high-frequency stimulation of the splanchnic nerve

PACAP and ACh are known to be coreleased from splanchnic nerve terminals during stress, but their precise contributions to sustaining evoked CA secretion have not been conclusively determined. We therefore used native adrenal slices to isolate the adrenomedullary synapse (intact splanchnic afferents plus chromaffin target cells) and to study evoked CA secretion ex vivo. The pattern of CA secretion induced by application of 1 μm exogenous PACAP38 resembled the pattern seen after high-frequency stimulation of the splanchnic nerve, such that uniform amperometric spike density occurred over several minutes (Fig. 1A). In contrast, exposure to 100 μm exogenous ACh resulted in high spike density secretion that quickly desensitized (Fig. 1B). Application of PACAP38 to ACh-desensitized adrenal slices elicited nerve stimulation-like spikes, suggesting that exogenous PACAP is sufficient to drive stress-level responses independently of ACh (Fig. 1B). To address whether endogenous PACAP is required for these acute responses, we used native neuronal stimulation of splanchnic nerve afferents in our mouse adrenal slice preparation. Stimulation protocols were designed to mimic low-intensity sympathetic tone (basal) vs. high-intensity stress signaling (stress). In slices prepared from PACAP+/+ mice, stress signaling evoked a large increase in CA secretion compared with basal stimulation (Fig. 2). This stress-induced increase was completely abolished in slice preparations from PACAP−/− mice, whereas basal CA secretion was normal (Fig. 2). We subsequently tested the effects of exogenous PACAP across the time frame (minutes to hours) in which splanchnic nerve stimulation evokes prolonged CA secretion from chromaffin cells. Application of PACAP38 at 1 μm for up to 1 h elicited prolonged, uniformly elevated CA secretion from mouse adrenal slices (Fig. 3). Taken together, these results demonstrate that release of PACAP from splanchnic nerve terminals is both necessary and sufficient for sustaining evoked CA secretion from the adrenal glands.

Fig. 1.

Fig. 1.

Exogenous PACAP is sufficient to evoke CA secretion from ACh-desensitized mouse adrenal slices. A, PACAP38 (1 μm) elicits prolonged CA secretion. B, Amperometric (Amp) recording across about 5 min shows that spike density upon application of 100 μm ACh desensitizes, and that later coapplication of 1 μm PACAP38 elicits nerve stimulation-like spikes. pA, picoamperes; s, seconds.

Fig. 2.

Fig. 2.

Endogenous PACAP is necessary for CA secretion evoked by high-frequency stimulation of the splanchnic nerve. Tissue slices were prepared from male PACAP+/+ and PACAP−/− mice. Constant-voltage bipolar stimulation was applied to the splanchnic nerve, and CA release was measured by electrochemical amperometry as previously described (8). A, Total CA output from two representative experiments is displayed as integrated amperometric current. B, Secretory responses to electrical stimulation mimicking sympathetic tone (basal) and stress signaling (stress) as measured in adrenal slices (n = 6-8 per group). Amperometric measurements of CA secretion as shown in panel A were integrated over 2 min and are expressed as means ± sem. Statistical analysis was performed by one-way ANOVA with Bonferroni's posttest. Asterisks indicate significant differences between groups (*, P < 0.01; ***, P < 0.001). pC, picocoulombs; s, seconds.

Fig. 3.

Fig. 3.

Application of PACAP38 causes prolonged, uniformly elevated CA secretion. A, CA secretion per 5-min time bin. B, One-hour cumulative current record of CA secretion from mouse adrenal slices induced by application of 1 μm PACAP38. Pound signs indicate significant difference between values from untreated vs. PACAP38-treated adrenal slices (unpaired t test; ##, P = 0.002). Amp., Amperometric; pC, picocoulombs; min, minutes.

Expression of CA-synthesizing enzymes and GAL is up-regulated in a PACAP-dependent manner during stress in vivo

Having shown PACAP to be responsible for the sustained adrenomedullary CA secretion that occurs as a result of stress transmission, we asked whether long-term up-regulation of secretory capacity is also afforded by this neuropeptide. Thus, psychogenic (restraint) and metabolic (insulin-induced hypoglycemia) stressors were used to assess the impact of endogenous PACAP on adrenomedullary gene expression in vivo. Transcripts encoding tyrosine hydroxylase (TH) and phenylethanolamine N-methyltransferase (PNMT), two enzymes required for CA synthesis, as well as the neuropeptide GAL, were measured by quantitative PCR in the adrenal glands of PACAP+/+ and PACAP−/− mice. In experiments using restraint, two-way ANOVA showed main effects of genotype [F (1, 32) = 18.8, P = 0.0001] and treatment [F (3, 32) = 15.5, P < 0.0001] on adrenal TH mRNA expression. Although restraint caused increases in both genotypes, maximal stressor-induced expression at 3 h was >40% lower in PACAP−/− compared with PACAP+/+ (Fig. 4A). A similar pattern was observed for PNMT [genotype: F (1,32) = 25.2; P < 0.0001; treatment: F (3,32) = 11.9; P < 0.0001] and GAL mRNA [genotype: F (1,32) = 50.7; P < 0.0001; treatment: F (3,32) = 16.3, P < 0.0001], both showing increased expression in response to restraint and higher abundance in PACAP+/+ compared with PACAP−/− mice. Thus, the maximum of restraint-induced PNMT and GAL expression was approximately 60% and 70% lower, respectively, in PACAP−/− compared with PACAP+/+ mice (Fig. 4A).

Fig. 4.

Fig. 4.

Stress-induced up-regulation of TH, PNMT, and GAL mRNA in mouse adrenal glands is PACAP-dependent. A, Restraint: male mice (n = 5 per group) were restrained in their home cages for 1 h, 3 h, or 6 h and killed immediately thereafter. Controls were untreated. B, Hypoglycemia: male mice (n = 4-6 per group) received an injection of 2 U/kg insulin and were killed 3 h later. Controls were untreated or injected with 0.9% saline. Transcript abundance was measured by quantitative PCR in both adrenal glands per mouse and expressed as means ± sem. Results were analyzed using two-way ANOVA followed by post hoc comparisons within and between genotypes, as described in Materials and Methods. Pound signs indicate significant effects of restraint or hypoglycemia within genotype (#, P < 0.05; ##, P < 0.01; ###, P < 0.001). Asterisks indicate significant differences between genotypes (*, P < 0.05; **, P < 0.01; ***, P < 0.001). C, Stress-induced GAL expression occurs throughout the adrenal medulla. cRNA probes labeled with 35S-UTP were hybridized to 14 μm-thick frozen sections of adrenal glands from mice exposed to hypoglycemia. Sections were coated with autoradiography emulsion, developed after 50 h of exposure, and counterstained with cresyl violet. Images were captured under dark-field illumination to visualize hybridization signals. Scale bar, 200 μm.

A second set of experiments used hypoglycemia, induced by ip injection of insulin (2 U/kg body weight), as a stressor. In the case of TH, main effects of genotype [F (1,20) = 6.79; P = 0.017] and treatment [F (1,20) = 15.5; P = 0.0008] were found, with mRNA being up-regulated in both genotypes. Abundance of TH mRNA was more than 30% lower in PACAP−/− compared with PACAP+/+ mice after stressor exposure, whereas no difference was observed in controls (Fig. 4B). Similar patterns were found for PNMT [genotype: F (1,12) = 29.8; P = 0.0001; treatment: F (1,12) = 8.96; P = 0.011], although post hoc analysis showed that the increase in PACAP+/+ mice was not statistically significant (P = 0.08). This appears to result from a higher baseline in the control group (compared with the restraint experiment), possibly due to mild stress induced by overnight fasting plus injection of saline. Thus, PNMT mRNA was more than 60% less abundant both in controls and stressed PACAP−/− mice (Fig. 4B). Main effects of genotype [F (1,12) = 14.8; P = 0.002] and treatment [F (1,12) = 28.9; P = 0.0002] were also found for GAL mRNA, the abundance of which was more than 50% lower in PACAP−/− compared with PACAP+/+ after exposure to hypoglycemia (Fig. 4B). Taken together, these data demonstrate that dynamic regulation of TH, PNMT, and GAL expression in mouse adrenal glands is strongly dependent on PACAP, with stressor-induced increases being severely reduced in PACAP-deficient mice.

Dopamine β-hydroxylase (DBH), the second enzyme in the CA synthesis pathway, was expressed equally abundantly in both genotypes and not affected by stress (data not shown). Vesicular monoamine transporter 2 (VMAT2) mRNA was significantly elevated by stress but not dependent on PACAP (data not shown).

In situ hybridization was carried out to confirm that GAL mRNA expression during stress occurs in the adrenal medulla, i.e. that compartment of the adrenal glands in which CAs are synthesized and secreted. Frozen tissue sections from mice subjected to hypoglycemia were used for this purpose. In control mice, relatively weak hybridization signals (silver grains) were found, with only few cells displaying sizeable GAL expression. Compared with controls, a marked increase throughout the adrenal medulla was observed at the 6-h time point in PACAP+/+ mice (+/+; Fig. 4C). This increase was strongly blunted in PACAP−/− mice (−/−; Fig. 4C), in line with our quantitative PCR experiments (Fig. 4, A and B). The adrenal cortex (Fig. 4C) and negative controls (hybridization with GAL sense cRNA; data not shown) yielded no specific signals. Based on data from quantitative PCR and in situ hybridization experiments, we conclude that increased GAL expression during stress occurs throughout the adrenal medulla and is almost completely PACAP- dependent.

PACAP regulates expression of TH, PNMT, and GAL directly at the level of the adrenal medulla

We and others have previously shown that PACAP is expressed in terminals of the splanchnic nerve. Release of PACAP at the adrenomedullary synapse, in addition to controlling CA secretion, could thus directly mediate the dynamic regulation of TH, PNMT, and GAL described above. Our experiments have further revealed PACAP-dependent corticosterone secretion during stress in mice (10, 13), indicating the possible involvement of endocrine signals in regulation of adrenomedullary gene expression. However, Tsukiyama et al. (15) recently reported that corticosterone secretion is PACAP-dependent only in response to psychogenic stressors, such as restraint and open field exposure, suggesting stressor specificity in PACAP-dependent regulation of the HPA axis. To clarify the mechanism by which PACAP regulates TH, PNMT, and GAL mRNA in response to both psychogenic and metabolic stressors (see results above), we therefore tested the effects of hypoglycemia on corticosterone secretion. After 3 h of hypoglycemia, corticosterone concentrations in serum were robustly increased in PACAP+/+ and PACAP−/− mice [treatment: F (1,25) = 50.3; P < 0.0001], with no difference between genotypes [genotype: F (1,25) = 0.008; P = 0.93; Fig. 5A]. This finding rules out the possibility that PACAP-dependent up-regulation of adrenomedullary gene expression in vivo is mainly mediated by glucocorticoids.

Fig. 5.

Fig. 5.

PACAP controls adrenomedullary gene expression through direct peripheral action. A, Corticosterone secretion in response to hypoglycemia is not PACAP-dependent. Male mice (n = 7-8 per group) received an injection of 2 U/kg insulin or 0.9% saline and were killed 3 h later. Corticosterone concentrations in serum were determined via RIA and found to be equally increased by hypoglycemia in both genotypes (##, P < 0.01; ###, P < 0.0001). B, BCCs were exposed to PACAP38 (100 nm) for 6 h. Abundance of TH, PNMT, and GAL mRNA was measured by quantitative PCR and expressed as fold changes relative to vehicle-treated controls. Values represent means ± sem (n = 3–5 per group) and were analyzed by unpaired t test for each transcript. Pound signs indicate statistically significant effects of treatment (#, P < 0.05; ###, P < 0.001).

Next, we tested direct effects of PACAP on cultured BCCs by quantitative PCR. Treatment with 100 nm PACAP38 for 6 h caused increased expression of TH mRNA (P < 0.05; unpaired t test), resembling PACAP-dependent up-regulation in vivo (Fig. 5B). Expression of PNMT was quite variable in response to PACAP (P = 0.08), whereas GAL mRNA was up-regulated approximately 7.5-fold (P < 0.001) compared with untreated controls (Fig. 5B). Collectively, these data indicate that PACAP-dependent effects occur directly at the level of the adrenomedullary synapse.

Discussion

In the mammalian nervous system, responses to diverse stressors that pose actual or perceived threats to the organism are mediated via specific neural circuits (16). These responses typically involve stimulation of the HPA axis and AHS, ultimately resulting in stressor-specific patterns of neuroendocrine and hormonal effector secretion (1). Because the effectors of the HPA axis (glucocorticoids; mainly corticosterone in rodents) and AHS (CAs; mainly epinephrine) affect virtually every organ system in the body, their secretion must be tightly regulated. This is underscored by the fact that both inappropriate basal activity and inappropriate responsiveness of the HPA axis and AHS are associated with a wide range of diseases (17). At the cellular level, regulation of secretion involves stress-transducing neurons and selective release of transmitters from their synaptic terminals. Thus, classical neurotransmitters are released at synaptic sites under basal or resting conditions, whereas at high neuronal firing frequencies, such as during stress responses, cotransmitters including neuropeptides are differentially recruited (2). As an important example of such a neuropeptide cotransmitter, we studied PACAP and investigated its role in regulation of adrenomedullary hormonal function, using PACAP-deficient mice exposed to stressors in vivo, native adrenal slice preparations ex vivo, and chromaffin cells in culture.

Insulin-induced hypoglycemia is a metabolic stressor that causes massive activation of the AHS (1). This activation is mediated via indirect reflex excitation of the splanchnic nerve, the direct electrical stimulation in vivo of which also evokes large increases in CA secretion (18). We have previously demonstrated that adrenomedullary CA secretion and synthesis after hypoglycemia are impaired in PACAP-deficient mice (4). Furthermore, we have shown that inhibition of PACAP signaling with the antagonist PACAP(6–38) completely blocks CA release evoked by direct stimulation of the splanchnic nerve in a native adrenal slice preparation (8). However, PACAP(6–38) has recently been reported to have a secondary effect as an inhibitor at the cocaine and amphetamine-regulated transcript (CART) receptor (19), raising the possibility that peptides in addition to PACAP could mediate adrenomedullary secretion after splanchnic nerve stimulation. Our present experiments provide final evidence for endogenous PACAP acting as the major adrenomedullary synaptic transmitter under stress-transducing conditions. Thus, we show that direct ex vivo stimulation of the splanchnic nerve with frequencies mimicking stress (and presumably release of PACAP from large dense-core vesicles of splanchnic nerve terminals) causes increased CA secretion from chromaffin cells, which is completely abolished in preparations from PACAP-deficient mice. On the other hand, splanchnic stimulation at frequencies mimicking basal tone (and presumably release of ACh only from small synaptic vesicles) results in CA release that is independent of PACAP.

Sustained activity and functional plasticity of the AHS during stress involve transcriptional regulation of CA-synthesizing enzymes (20, 21). Several lines of evidence implicate PACAP in this process. First, up-regulation of transcripts encoding TH and PNMT in the adrenal glands in response to restraint is blunted in PACAP-deficient mice (10). Second, studies in cultured adrenomedullary chromaffin cells have suggested that PACAP regulates the expression of TH, DBH, and PNMT (9, 11). In our present experiments with restraint and hypoglycemia, we provide further evidence for PACAP-dependent expression of CA-synthesizing enzymes during stress in vivo. In wild-type mice, stressor exposure increases the abundance of adrenal TH and PNMT mRNA, a response that is severely blunted in PACAP-deficient mice. Although the overall pattern is similar for both stressors, up-regulation of expression and its dependence on PACAP are more pronounced after restraint compared with hypoglycemia. DBH mRNA is equally abundant in both genotypes and not affected by stress, whereas vesicular monoamine transporter 2 (VMAT2) mRNA is up-regulated to a similar extent in wild-type and PACAP-deficient adrenal glands (data not shown).

Different stressors pose varying degrees of actual or perceived threat to the integrity of an organism. Exposure to such stressors therefore elicits different patterns of neuroendocrine activity via stimulation of stressor-specific neural circuits (1, 16). In our present experiments, the patterns of TH, PNMT, and GAL mRNA regulation in response to restraint and hypoglycemia appeared very similar, suggesting that the underlying mechanism(s) might be shared. We and others have shown that PACAP is required for increased corticosterone secretion in response to psychogenic stressors such as restraint (10, 13, 15) and social defeat (26), but not in response to metabolic/systemic stressors such as ether inhalation, cold exposure (15), lipopolysaccharide challenge (26), or hypoglycemia (present report). Consequently, glucocorticoids are unlikely to mediate the PACAP-dependent adrenomedullary gene expression patterns described here. Indeed, we now show that hypoglycemia-induced corticosterone secretion is completely intact in PACAP-deficient mice.

To test whether PACAP's effects instead occur directly at the level of the adrenomedullary synapse, we used BCCs in culture and exposed them to PACAP38. Previous studies concerning direct effects of PACAP have shown consistent up-regulation of TH but more variable results for PNMT, finding no induction after 24 h of treatment (9) or a small increase after 16 h (11), respectively. We chose a time frame of exposure to PACAP38 in culture (6 h) that more closely represents the time frame in vivo during which PACAP-dependent up-regulation of adrenomedullary gene expression is maximal (3 h in the present experiments; up to 6 h in previous studies; see Ref. 10). In agreement with the literature, we found that treatment of chromaffin cells with PACAP38 increases abundance of TH mRNA. Up-regulation of PNMT mRNA occurred as well but was not statistically significant in our present experiments. Overall, the data suggest that release of PACAP at the adrenomedullary synapse increases expression of CA-synthesizing enzymes during stress. It should be pointed out that immobilization-induced PNMT expression appears to be controlled by HPA axis-derived hormones (presumably glucocorticoids) in rats (22). However, this mechanism alone cannot explain PACAP-dependent TH and PNMT expression in mice, because both transcripts are up-regulated in a PACAP-dependent manner in response to restraint and hypoglycemia whereas glucocorticoid secretion is PACAP dependent only in response to restraint. Increased expression of PNMT mRNA during psychogenic stress may thus occur through a combination of direct (adrenomedullary synapse) and indirect (activation of the HPA axis) effects, but our results indicate that direct effects are dominant.

Concomitant with up-regulation of TH and PNMT, we show robust increases of GAL mRNA abundance throughout the adrenal medulla of PACAP+/+ mice during stress, whereas induction in PACAP−/− mice is severely blunted. Experiments with BCCs suggest that regulation of GAL is controlled by release of PACAP from splanchnic nerve terminals, because treatment of BCCs with PACAP38 mimics the PACAP-dependent expression pattern seen in vivo. GAL mRNA and peptide are known to be up-regulated after hypoglycemia-induced reflex activation of the splanchnic nerve in rats, with peptide concentrations robustly elevated for up to 2 wk (6, 23). Furthermore, it has been shown that GAL potentiates the epinephrine response to a psychosocial stressor in vivo, without affecting epinephrine secretion in unstressed rats (24). Based on these findings and our present data, we propose that PACAP, in addition to regulating the catecholaminergic system as such, controls expression of adrenomedullary neuropeptides that modulate epinephrine secretion, thereby providing multiple regulatory mechanisms specifically during stress.

In conclusion, we show PACAP to be both necessary and sufficient as the transmitter mediating CA secretion during high-frequency stimulation of the splanchnic nerve, as occurs after exposure to psychogenic and metabolic stressors. By regulating the secretion of CAs as well as increased expression of CA biosynthetic enzymes, PACAP serves as an integrator of adrenomedullary hormonal responses.

Acknowledgments

We thank the two anonymous reviewers for their critical remarks and suggestions on improving our manuscript. We also thank Djida Ait-Ali for assisting with corticosterone assays.

Work in L.E.E.'s laboratory was supported by National Institute of Mental Health Intramural Research Project 1Z01MH002386. B.A.K. was supported by National Institutes of Health Grant TS HL07653.

Disclosure Summary: The authors have nothing to disclose.

Footnotes

Abbreviations:
ACh
acetylcholine
AHS
adrenomedullary hormonal system
BCC
bovine (steer) chromaffin cells
BBS
bicarbonate-buffered saline
CA
catecholamine
GAL
galanin
HPA axis
hypothalamic-pituitary-adrenocortical axis
PACAP
pituitary adenylate cyclase-activating polypeptide
PNMT
phenylethanolamine N-methyltransferase
TH
tyrosine hydroxylase.

References

  • 1. Goldstein DS, Kopin IJ. 2008. Adrenomedullary, adrenocortical, and sympathoneural responses to stressors: a meta-analysis. Endocr Regul 42:111–119 [PMC free article] [PubMed] [Google Scholar]
  • 2. Hökfelt T, Bartfai T, Bloom F. 2003. Neuropeptides: opportunities for drug discovery. Lancet Neurol 2:463–472 [DOI] [PubMed] [Google Scholar]
  • 3. Frödin M, Hannibal J, Wulff BS, Gammeltoft S, Fahrenkrug J. 1995. Neuronal localization of pituitary adenylate cyclase-activating polypeptide 38 in the adrenal medulla and growth-inhibitory effect on chromaffin cells. Neuroscience 65:599–608 [DOI] [PubMed] [Google Scholar]
  • 4. Hamelink C, Tjurmina O, Damadzic R, Young WS, Weihe E, Lee HW, Eiden LE. 2002. Pituitary adenylate cyclase-activating polypeptide is a sympathoadrenal neurotransmitter involved in catecholamine regulation and glucohomeostasis. Proc Natl Acad Sci USA 99:461–466 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Holgert H, Holmberg K, Hannibal J, Fahrenkrug J, Brimijoin S, Hartman BK, Hökfelt T. 1996. PACAP in the adrenal gland–relationship with choline acetyltransferase, enkephalin and chromaffin cells and effects of immunological sympathectomy. Neuroreport 8:297–301 [DOI] [PubMed] [Google Scholar]
  • 6. Fischer-Colbrie R, Eskay RL, Eiden LE, Maas D. 1992. Transsynaptic regulation of galanin, neurotensin, and substance P in the adrenal medulla: combinatorial control by second-messenger signaling pathways. J Neurochem 59:780–783 [DOI] [PubMed] [Google Scholar]
  • 7. Fischer-Colbrie R, Iacangelo A, Eiden LE. 1988. Neural and humoral factors separately regulate neuropeptide Y, enkephalin, and chromogranin A and B mRNA levels in rat adrenal medulla. Proc Natl Acad Sci USA 85:3240–3244 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Kuri BA, Chan SA, Smith CB. 2009. PACAP regulates immediate catecholamine release from adrenal chromaffin cells in an activity-dependent manner through a protein kinase C-dependent pathway. J Neurochem 110:1214–1225 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Choi HJ, Park SY, Hwang O. 1999. Differential involvement of PKA and PKC in regulation of catecholamine enzyme genes by PACAP. Peptides 20:817–822 [DOI] [PubMed] [Google Scholar]
  • 10. Stroth N, Eiden LE. 2010. Stress hormone synthesis in mouse hypothalamus and adrenal gland triggered by restraint is dependent on pituitary adenylate cyclase-activating polypeptide signaling. Neuroscience 165:1025–1030 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Tönshoff C, Hemmick L, Evinger MJ. 1997. Pituitary adenylate cyclase activating polypeptide (PACAP) regulates expression of catecholamine biosynthetic enzyme genes in bovine adrenal chromaffin cells. J Mol Neurosci 9:127–140 [DOI] [PubMed] [Google Scholar]
  • 12. Ait-Ali D, Stroth N, Sen JM, Eiden LE. 2010. PACAP-cytokine interactions govern adrenal neuropeptide biosynthesis after systemic administration of LPS. Neuropharmacology 58:208–214 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Stroth N, Liu Y, Aguilera G, Eiden LE. 2011. Pituitary adenylate cyclase-activating polypeptide controls stimulus-transcription coupling in the hypothalamic-pituitary-adrenal axis to mediate sustained hormone secretion during stress. J Neuroendocrinol 23:944–955 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Δ Δ C(T)) method. Methods 25:402–408 [DOI] [PubMed] [Google Scholar]
  • 15. Tsukiyama N, Saida Y, Kakuda M, Shintani N, Hayata A, Morita Y, Tanida M, Tajiri M, Hazama K, Ogata K, Hashimoto H, Baba A. 2011. PACAP centrally mediates emotional stress-induced corticosterone responses in mice. Stress 14:368–375 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Pacák K, Palkovits M. 2001. Stressor specificity of central neuroendocrine responses: implications for stress-related disorders. Endocr Rev 22:502–548 [DOI] [PubMed] [Google Scholar]
  • 17. Chrousos GP. 2009. Stress and disorders of the stress system. Nat Rev Endocrinol 5:374–381 [DOI] [PubMed] [Google Scholar]
  • 18. Vollmer RR, Balcita-Pedicino JJ, Debnam AJ, Edwards DJ. 2000. Adrenal medullary catecholamine secretion patterns in rats evoked by reflex and direct neural stimulation. Clin Exp Hypertens 22:705–715 [DOI] [PubMed] [Google Scholar]
  • 19. Lin Y, Hall RA, Kuhar MJ. 2011. CART peptide stimulation of G protein-mediated signaling in differentiated PC12 cells: identification of PACAP 6-38 as a CART receptor antagonist. Neuropeptides 45:351–358 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Kvetnansky R, Sabban EL, Palkovits M. 2009. Catecholaminergic systems in stress: structural and molecular genetic approaches. Physiol Rev 89:535–606 [DOI] [PubMed] [Google Scholar]
  • 21. Tai TC, Claycomb R, Siddall BJ, Bell RA, Kvetnansky R, Wong DL. 2007. Stress-induced changes in epinephrine expression in the adrenal medulla in vivo. J Neurochem 101:1108–1118 [DOI] [PubMed] [Google Scholar]
  • 22. Viskupic E, Kvetnansky R, Sabban EL, Fukuhara K, Weise VK, Kopin IJ, Schwartz JP. 1994. Increase in rat adrenal phenylethanolamine N-methyltransferase mRNA level caused by immobilization stress depends on intact pituitary-adrenocortical axis. J Neurochem 63:808–814 [DOI] [PubMed] [Google Scholar]
  • 23. Anouar Y, Eiden LE. 1995. Rapid and long-lasting increase in galanin mRNA levels in rat adrenal medulla following insulin-induced reflex splanchnic nerve stimulation. Neuroendocrinology 62:611–618 [DOI] [PubMed] [Google Scholar]
  • 24. Ceresini G, Sgoifo A, Freddi M, Musso E, Parmigiani S, Del Rio G, Valenti G. 1998. Effects of galanin and the galanin receptor antagonist galantide on plasma catecholamine levels during a psychosocial stress stimulus in rats. Neuroendocrinology 67:67–72 [DOI] [PubMed] [Google Scholar]
  • 25. Wang X, Seed B. 2003. A PCR primer bank for quantitative gene expression analysis. Nucleic Acids Res 31:e154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Lehmann ML, Mustafa T, Eiden AM, Herkenham M, Eiden LE. 10 October, 2012. PACAP-deficient mice show attenuated corticosterone secretion and fail to develop depressive behavior during chronic social defeat stress. Psychoneuroendocrinology 10.1016/j.psyneuen.2012.09.006 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Endocrinology are provided here courtesy of The Endocrine Society

RESOURCES