Ethylene biosynthesis genes were transcriptionnally enhanced by finger drop during banana fruit ripening. Among them, there are ethylene- and ripening- (MaACO1, MaACS1) and wounded-related (MaACS2). Thus, this process might be associated with ethylene production and share in common some components with wounding, another breaking event.
Abstract
Background and aims
Banana finger drop is defined as dislodgement of individual fruits from the hand at the pedicel rupture area. For some banana varieties, this is a major feature of the ripening process, in addition to ethylene production and sugar metabolism. The few studies devoted to assessing the physiological and molecular basis of this process revealed (i) the similarity between this process and softening, (ii) the early onset of related molecular events, between the first and fourth day after ripening induction, and (iii) the putative involvement of ethylene as a regulatory factor. This study was conducted with the aim of identifying, through a candidate gene approach, a quality-related marker that could be used as a tool in breeding programmes. Here we examined the relationship between ripening ethylene biosynthesis (EB) and finger drop in order to gain further insight into the upstream regulatory steps of the banana finger drop process and to identify putative related candidate genes.
Methods
Postharvest ripening of green banana fruit was induced by acetylene treatment and fruit taken at 1–4 days after ripening induction, and total RNA extracted from the median area [control zone (CZ)] and the pedicel rupture area [drop zone (DZ)] of peel tissue. Then the expression patterns of EB genes (MaACO1, MaACO2, MaACS1, MaACS2, MaACS3 and MaACS4) were comparatively examined in CZ and DZ via real-time quantitative polymerase chain reaction.
Principal results
Differential expression of EB gene was observed in CZ and DZ during the postharvest period examined in this study. MaACO1, MaACS2 and MaACS1 were more highly induced in DZ than in the control, while a slight induction of the MaACS4 gene was observed. No marked differences between the two zones were observed for the MaACO2 gene.
Conclusions
The finger drop process enhanced EB gene expression including developmental- and ripening-induced genes (MaACO1), specific ripening-induced genes (MaACS1) and wound-induced genes (MaACS2). Thus, this process might be associated with a specific ethylene production in DZ of the pedicel area and the result of crosstalk between developmental, ripening and wound regulatory pathways. MaACO1, MaACS1, MaACS2, and to a lesser extent MaACS4 genes, which are more highly induced in DZ than in CZ, could be considered as putative candidates of the finger drop process.
Introduction
Ethylene is a gaseous plant hormone that regulates many developmental events and biotic and abiotic stress responses of plants. Banana fruits undergo a climacteric ripening process. This is characterized by a ripening-related increase in respiration and a burst of ethylene production concomitantly with physicochemical and biochemical changes, including chlorophyll breakdown, increased starch degradation and sugar synthesis, and fruit softening.
Finger drop is a key feature that is closely associated with ripening of some banana varieties. This phenomenon has a substantial economic impact for the banana marketing sector. Indeed, bananas are marketed in hands of generally 4–9 fruits. Dislodgement of individual fruits from the hand at the pedicel area considerably reduces the commercial value of the product because hands with missing fingers or fingers without pedicels cannot be sold to consumers. Despite this economic importance, very few studies have been devoted to this phenomenon.
The finger drop process was first observed in bananas of the Cavendish subgroup in 1934 (Hicks 1934). It was defined as physiological softening and weakening, thus causing individual fruit in a hand to separate from the crown (Baldry et al. 1981). The sensitivity to finger drop within Musa germplasm varies according to the variety and ploidy (New and Marriott 1983; Pereira et al. 2004), growing and postharvest ripening, and storage conditions (Semple and Thompson 1988; Paull 1996; Saengpook et al. 2007). At the biochemical level, changes in water-soluble pectin, i.e. a cell wall polysaccharide component, have also been reported to be associated with finger drop. In addition to the activities of some cell wall hydrolases including pectate lyase and polygalacturonase, an increase in water-soluble pectin has been observed in the drop zone (DZ) as compared with control fruit (Imsabai et al. 2006). Recent molecular studies performed in Cavendish bananas also showed that a change in the expression of major cell-wall-modifying genes occurs specifically in the finger drop area (Mbéguié-A-Mbéguié et al. 2009). Overall, major molecular changes in the expression of genes coding for cell-wall-modifying proteins (CWMPs) occurred 1–4 days after ripening induction, but in a sequential manner. Firstly, there were changes in the expression of pectolytic and cell-wall-loosening genes, mainly during Days 1–2, followed by changes in the expression of xyloglucan genes, mainly during Days 3–4. The fact that some CWMP genes are involved in both finger drop and the fruit-softening process, with transcriptional regulation by ethylene, suggests that these two processes that occur during banana fruit ripening might involve common regulatory mechanisms and factors, with ethylene being one of them.
Numerous physicochemical, biochemical and molecular findings have shown that fruit softening is one of the ripening physiological processes that is most sensitive to ethylene (Gerasopoulos and Richardson 1996; Jiang et al. 1999; Kim et al. 1999; ; Flores et al. 2001; Grimplet 2004; Hayama et al. 2006; Johnston et al. 2009).
In higher plants, including banana, 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (ACS) and ACC oxidase (ACO) catalysed the two key steps of the ethylene biosynthesis (EB) pathway: the formation of methionine via S-adenosyl-l-methionine (AdoMet) and the cyclic non-protein amino acid ACC, respectively. In banana, ethylene production displays a sharp peak at the onset of ripening, followed by a rapid decrease thereafter due to a slight decline in the ACC content and a sharp decrease of in vivo ACO activity attributed to the availability of its cofactors, especially iron and ascorbate (Liu et al. 1999; Choudhury et al. 2008).
The ACS and ACO proteins have been widely studied at both biochemical and molecular levels in different species. ACC oxidase and ACS are encoded by a multigenic family whose members are differentially regulated at transcriptional and translational levels by various developmental environmental and hormonal signals (Bleecker and Kende 2000; Wang et al. 2002; Lin et al. 2009). At least nine ACS and three ACO genes have been isolated from banana and published in the literature or directly registered in the GenBank database (Liu et al. 1999; Huang et al. 2006; Inaba et al. 2007). However, only a few of them were fully characterized in regard to ripening and none in regard to the finger drop process. The ACS and ACO genes are transcriptionally and differentially regulated according to the tissue and stimuli. One ACS (MaACS1) and two ACO (MaACO1 and MaACO2) genes were found to be ripening related (Liu et al. 1999; Huang et al. 2006; Inaba et al. 2007). Post-translational regulation has also been reported in several plants, and mainly for ACS enzymes. This regulation is based on the C-terminal region of the ACS protein that can be directly phosphorylated by protein kinase, leading to an increase in protein stability (Lin et al. 2009; Han et al. 2010; Kamiyoshihara et al. 2010; Skottke et al. 2011; Wang et al. 2011; Choudhury et al. 2012), or bound to a substrate-specific adaptor, i.e. the ETO1 protein, and directed to the ubiquitin (Ub)/26S proteasome system (Chae and Kieber 2005; Yoshida et al. 2005). The ACS activity enzyme encoded by a ripening-related gene MaACS1 from banana was also subjected to post-translational regulation during fruit ripening. A few studies also reported a proteolytic cleavage of the protein leading to a decrease in the apparent pI of the protein and its inactivation, suggesting that this protein might also be under post-translational regulation as was ACS protein (Barlow et al. 1997; Ramassamy et al. 1997).
In this study, we investigated, at the transcriptional level, the putative relationship between the finger drop process and EB, i.e. two processes that occur during banana fruit ripening. To this end, the transcript abundance of ACS and ACO genes from banana was estimated comparatively in the median zone and DZ during the ripening of bananas harvested at the commercial maturity stage. Our findings suggest a possible role of ethylene and ripening-regulated elements in the regulation of the finger drop mechanism.
Methods
Fruit harvesting and ripening induction
The banana fruits (Musa acuminata, AAA, Cavendish, cv Grande Naine) used in this study were collected from at least four banana plants taken randomly from a banana farm near the CIRAD research station (elevation 250 m; andosol; rainfall 3500 mm/year), Guadeloupe (French West Indies). Banana plants were grown under conventional field practices and, on the basis of heat concept unit (Umber et al. 2011), fruits were harvested at commercial maturity stage [i.e. 900 degree-day (dd)], which corresponds to ∼90 days after flowering.
After harvest, internal fruit of the median hand of all banana bunches, considered to be comparable (Liu 1976), were pooled and kept for 24 h at 20 °C in chambers. Fruits were then placed into sealed Plexiglas boxes, and their ripening was induced by injection of 1000 p.p.m. acetylene and the boxes were kept for 24 h at 20 °C and ambient humidity. At the end of treatment, fruits were removed from the boxes and kept ripening at 20 °C in air and ambient temperature. During postharvest ripening, a sample of three fruits was taken daily to assess the postharvest ripening process and finger drop development.
Assessment of the physiological stage of fruit and measurement of finger drop development during postharvest ripening
The physiological stage of fruit was assessed through measurement of soluble solid content (SSC). To this end, 5 g of fresh powder of pulp tissue were homogenized in an equivalent volume of distilled water and the mixture was centrifuged for 10 min at 10 000 × g and 4 °C. The fruit juice was collected and the SSC was determined using a digital Refracto 30PX/GS refractometer from Mettler Toledo (Grosseron, Saint-Herblain, France) and expressed in Brix. The development of finger drop was measured as previously described (Chillet et al. 2008).
All experiments were performed on three fruits at each time point. Immediately after these analyses, peel tissue corresponding to the median part of the fruit [control zone (CZ)] and to the rupture area of the fruit pedicel (DZ), and pulp tissue were sampled separately, frozen in liquid nitrogen and stored at −80 °C until use for total RNA extraction and gene expression analysis.
RNA extraction and quantitative real-time polymerase chain reaction analysis
Total RNAs were extracted twice from a pooled sample tissue using a modified hot borate method (Wan and Wilkins 1994; Mbéguié-A-Mbéguié et al. 2008b). At each developmental stage, peel tissue from three fruits was pooled due to the small quantity of peel material obtained per fruit, mainly from the DZ, thus making it difficult to blend in a coffee grinder.
The relative expression of each transcript was determined in triplicate on two independent RNA extracts by quantitative real-time polymerase chain reaction (qPCR) using a 7500 Real-Time PCR System (Applied Biosystems, Courtaboeuf, France). The first-strand cDNA synthesis was performed from 2 µg of RQ1-DNase-treated RNA from each RNA extract using a random hexamer primer and MMLV reverse transcriptase (Promega, Charbonnières, France) according to the manufacturer's instructions. The synthesized cDNA was diluted 1 : 10 with distilled water, and 5 μL of the diluted cDNA and gene-specific primer were used as the template for qPCR analysis in a 20 µL volume reaction, as previously described in Mbéguié-A-Mbéguié et al. (2008a). All primer sequences used in this study are listed in Table 1.
Table 1.
Sequences of gene-specific primers used in this study. The actin, MaACO1, MaACO2 and MaACS2 gene-specific primers used in this study were those previously described by Mbéguié-A-Mbéguié et al. (2008a). MaACS1, MaACS3 and MaACS4 primers were designed using primer-BLAST software (Rozen and Skaletsky 2000) and mainly within the 3′-untranslated region for MaACS1, and within the coding region for MaACS3 and MaACS4 sequences (Liu et al. 1999; Inaba et al. 2007). Each assay using the gene-specific primers amplified a single product of the correct size, and the PCR efficiency (slope) of primers within the 86–99 % range (3.7–3.37) was calculated as described in Mbéguié-A-Mbéguié et al. (2008a)
| Gene | Primer name | Sequences | Annealing temperature | Product size (bp) |
|---|---|---|---|---|
| MaACT | Act-F | GAGAAGATACAGTGTCTGGA | 60 | 231 |
| Act-R | ATTACCATCGAAATATTAAAAG | |||
| MaACO1 | ACO1-F | AAGCTCTACGTCGGGCATAA | 60 | 152 |
| ACO1-R | GACAGCTTCCTAACGCGAAG | |||
| MaACO2 | ACO2-F | CCAAGGAACCGAGATTTGAA | 60 | 125 |
| ACO2-R | TGGTAGCTTCCACGATGACA | |||
| MaACS1 | ACS1-F | AGAACTCCTCCTACTTCGAT | 60 | 215 |
| ACS1-R | ATGATAGTCCTGAAAGTTGG | |||
| MaACS2 | ACS2-F1 | TGCGGCCTTGTTCTGCTGGG | 60 | 151 |
| ACS2-R1 | AAACCACCCCGGTTCGTCGC | |||
| MaACS3 | ACS3-F1 | CCGTACTATCCAGGGTTCGACAGGG | 60 | 231 |
| ACS3-R1 | GAAGTCGACGAGGGTGTCCAGTTCT | |||
| MaACS4 | ACS4-F1 | GCAGAAGCGTGGCCTCAGGG | 60 | 166 |
| ACS4-R1 | CGAGTCGAAGCTGGTGCCCG |
The relative fold differences in expression of each gene between samples were determined using the 2−ΔΔCt formula (Livak and Schmittgen 2001) with the actin gene as reference and the fruit CZ of peel tissue sampled at harvest before ripening induction used as calibrator.
Results
Finger drop pattern during postharvest fruit ripening
During postharvest ripening of acetylene-treated banana fruit, the SSC content estimated via the Brix value started to increase at Day 1 after ripening induction and increased progressively until Day 4, when it reached its maximum. The Brix value remained constant from Day 4 to Day 6 (Fig. 1). According to the rupture force measurement, Cavendish banana finger drop started 1 day after ripening induction and continued progressively throughout the postharvest ripening stage. However, a marked decrease was observed between Days 1 and 3 after ripening induction, with a more than 2-fold decrease in the pedicel rupture force. As the pedicel rupture force pattern is considered to be an effective way of measuring banana finger drop (Saengpook et al. 2007), our data suggest that our experimental conditions induced the development of the finger drop process in Cavendish bananas.
Fig. 1.

Finger drop pattern during postharvest fruit ripening. Peel tissue of control (CZ) and drop (DZ) zones used in this study are illustrated in (A). Finger drop pattern observed during fruit ripening and measured via the pedicel rupture force are illustrated in (B).
Expression of EB genes in peel tissue from CZ and DZ during banana fruit ripening
The expression profiles of six EB genes, including two ACO and four ACS, were studied during postharvest ripening of banana fruit harvested at the commercial mature green stage and treated with acetylene (Fig. 2).
Fig. 2.
Ethylene biosynthesis gene expression during postharvest ripening of Cavendish bananas assessed using reverse transcription–polymerase chain reaction. RNA was extracted twice from CZ and DZ of banana peel tissues sampled at harvest and then at 1–4 days after ripening induction. The y-axis represents the relative fold difference in mRNA level and was calculated using the 2−ΔΔCt formula (Livak and Schmittgen 2001) with actin as the reference. The mRNA fold difference was relative to that of peel tissue from the CZ of fruit sampled at harvest. Each data point is the mean of values obtained through a qPCR reaction performed in triplicate on one sample. Each sample was prepared from four fruits originating from three replicate bunches. Vertical bars indicate the standard deviation (SD). The SD was lower than the symbol when no bar is shown. The experiment was performed on two independent RNA extractions with similar results.
No change was observed in the MaACO2 mRNA level in both CZ and DZ tissues. At harvest, the MaACS3 level was 2-fold higher in the DZ compared with the control. This level decreased markedly at Day 1 after ripening induction to reach a level comparable to that observed in the CZ, and then the MaACS3 mRNA level remained constant in both tissues. The other EB genes, i.e. MaACO1, MaACS1, MaACS2 and MaACS4, were highly and transiently induced in DZ compared with the control, MaACO1 and MaACS4 being the most and least expressed ones, respectively. For the MaACS1, MaACS2 and MaACS4 genes, mRNA accumulation peaked 2 days after ripening induction. MaACS4 was the unique gene presenting, at harvest time, a low transcript level in the DZ compared with the control.
Discussion
Finger drop is a major fruit ripening feature for some banana varieties. Our findings confirmed this by showing a progressive decrease in rupture pedicel force, concomitantly with finger drop sensitivity, throughout fruit ripening, along with a decrease in the SSC, as expressed by the Brix value (Fig. 1). Our previous findings also showed that molecular mechanisms related to the banana finger drop phenomenon occurred earlier after ripening induction as was ripening ethylene production (Mbéguié-A-Mbéguié et al. 2009). This led us to suggest ripening ethylene as a potential upstream regulator of the finger drop process. Assuming that this putative regulation—if it takes place—might involve EB components, in this study we examined the changes in expression of EB genes during postharvest ripening of banana fruit taken at 1–4 days after ripening induction, and in both median zone (CZ) and DZ.
Ethylene biosynthesis genes are transcriptionally induced in peel tissue by ripening (i.e. an increase in their mRNA accumulation in the median zone), MaACS1 and MaACO1 being the highly expressed ones, consistent with the important role played by these genes in ripening EB (Liu et al. 1999; Inaba et al. 2007), while no marked changes were observed in the expression of MaACS3, MaACS4 and MaACO2 genes in CZ, suggesting that these genes might be less important during ripening of banana peel tissue. In contrast with previous studies showing that MaACS2 gene was expressed only in banana pulp tissue and upon wounding (Liu et al. 1999), our data showed a low but transient induction of MaACS2 in control zone of peel suggesting that this gene was ripening regulated in peel tissue. The discrepancy between the two data may be due to the analytical method, i.e. northern blot used by Liu et al. (1999) and qPCR used in this study.
The finger drop process enhanced EB gene expression, including the MaACO1, MaACS1, MaACS2 and MaACS4 genes, of which the corresponding mRNA was accumulated to a great extent in DZ compared to the control. Therefore, we hypothesized that the finger drop process is associated with ethylene production occurring specifically in the DZ with a putative involvement of one ACC oxidase (MaACO1) and three ACC synthase (MaACS1, MaACS2 and MaACS4) genes. However, this hypothesis needs to be validated through the measurement of ethylene produced by peel tissue taken from DZ in comparison to that taken from the median zone.
The MaACO1 and MaACS2 genes previously identified as wound-inducible genes in pulp and leaf banana tissues (Liu et al. 1999; Mbéguié-A-Mbéguié et al. 2008a) were also transcriptionally enhanced by finger drop. Although the tissues and physiological stages examined in these previous studies are different, our data suggested that finger drop might also imply a wound-related mechanism. Considering that ripening and wounding processes are both associated with ethylene production, it should be interesting to assess whether finger drop, wounding and ripening share some ethylene transduction pathway components.
ACS and ACO genes are encoded by a large and small multigenic family, respectively. In contrast to ACO, the members of which are highly conserved, the ACS multigenic family was classified into three types according to the consensus motifs present at their C-terminal polypeptide (Yoshida et al. 2005). It has been stated that individual members of the ACS and ACO multigenic families were not restricted to only one function. In order to assess the relationships between the structure of ACS and ACO polypeptides and their putative function, an unrooted phylogenetic tree was constructed from a multiple alignment of ACS and ACO polypeptides registered in the database (Fig. 3). Three major lineages can be discerned from the ACS phylogenetic tree (Fig. 3A). MaACS1 belongs to Type 1 ACC synthase. Indeed, the MaACS1 C-terminal region presents the main features of Type 1 ACS protein including the Ser residues in the ‘RLSF’ motif, necessary for CDPK phosphorylation (Chae and Kieber 2005), followed by a 27-amino-acid tail containing the two Ser residues 476 and 479 recently proved to be phosphorylated during banana fruit ripening (Choudhury et al. 2010, 2012), and finally the absence of the ‘WVF’ binding ETO1 motif (Yoshida et al. 2005), which is degenerated to ‘WDEAL’. MaACS2, MaACS3 and MaACS4 polypeptide sequences are grouped in the same cluster, which is clearly divergent from MaACS1.
Fig. 3.
Phylogenetic analysis of ACS (A) and ACO (B) sequences from banana and other plant species. The phylogenetic tree was constructed with the Gonnet residue weights and after a complete sequence alignment performed using the ClustalX algorithm (Jeanmougin et al. 1998). For multiple alignments, the gap opening penalty was 10, with a gap extension penalty of 0.2 and the delay divergent sequences was set at 30 %. The consensus tree was displayed using the TREEVIEW program (Page 1996). All banana sequences are indicated by underlining while those whose expression was examined in this study are in bold. ACC synthase sequences used for phylogenetic tree construction are: Musa acuminata [MaACS1 (AB021906), MaACS2 (AB021907), MACS2 (AF056162), MaACS3 (AB021908), MaACS4 (AB266314), MaACS6 (AJ223186)], Arabidopsis thaliana [AtACS2 (Q06402), AtACS4 (NP_179866), AtACS5 (AAG50098), AtACS6 (Q9SAR0), AtACS7 (AAG48754), AtACS8 (AAG50090), AtACS9 (AAG48755)], Cucumus sativum [CsACS1 (BAA33374), CsACS2 (BAA33375), CsACS3 (BAA33376)], Doritaenopsi sp. [DsACS1a (L07882), DsACS1b (L07883)], Lupinus albus [LuACS1 (AF119411), LuACS2 (AF119412), LuACS3 (AF119413), LuACS4 (AF119410), LuACS5 (AF119414)], Solanum lycopersicon [SlACS1a (AAF97614), SlACS1b (AAF97615), SlACS2(CAA41855), SlACS3(AAB48945), SlACS4(AAA03164), SlACS6(BAA34923), SlACS7(AAC32317)], Solanum tuberosum [StACS1a (Z27233), StACS1b (Z27234), StACS2 (Z27235)] and Vigna radiata [VrASC1 (CAA77688), VrACS6 (U34986), VrACS7 (U34987)]. ACC oxidase sequences used for phylogenetic tree construction are: Musa acuminata [MaACO1(AY804252), MaACO2 (X95599), MAO1B(AF030410)], Arabidopsis thaliana [AtACO1 (AEC06898), AtACO2 (AEE33960), AtACS3 (Q8H1S4), AtACS5 (Q43383), AtACS6 (AAG48754), AtACS7 (AAG50090), AtACS9 (AAG48755), AtACO10 (Q9LSW6)], Cucumus sativum [CsACO1 (AB006806), CsACO2 (AB006807)], Diospyros kaki [DkACO1 (AB073008), DkACO2 (AB073009)], Doritaenopsis sp. [DsACO1 (L37103), DsACO2(L07912)], Solanum lycopersicon [SlACO1 (X58273), SlACO4 (AB013101), SlACO5 (AJ715790)], Solanum tuberosum [StACO1 (AF384820), StACO2 (AF384821)] and Vigna radiata [VrASO1 (U06046), VrACO2(AM180697)].
A previous study suggested that MaACS2, MaACS3 and MaACS4 are members of the same subgroup of the ACS family (Liu et al. 1999; Inaba et al. 2007). Consistent with this, the phylogenetic tree includes MaACS2, MaACS3 and MaACS4 into a divergent subgroup family of Type 2 ACS. However, this needs to be confirmed with a phylogenetic tree constructed with the complete MaACS2, MaACS3 and MaACS4 polypeptide sequences, as those used here are partial and lack the last 80 amino acid residues. Two main subfamilies are observed for the ACO phylogenetic tree (Fig. 3B). Banana ACO genes examined in this study are grouped with the other major ACO genes, consistent with the high conservation of these proteins. Based on the present data (i.e. the limited number of ACO and ACS genes examined), a putative relationship between ACO and ACS lineages and their corresponding function in regard to finger drop cannot yet be established. A more detailed analysis of the expression of the members of both ACO and ACS family genes is necessary before assigning a functional homology to this lineage. This is now possible with the availability of the banana genome sequence (D'Hont et al. 2012).
Conclusions and forward look
In conclusion, our data showed that the finger drop process might be associated with ethylene production, implying a large number of EB genes. However, this hypothesis needs to be validated through the measurement of ethylene produced at DZ.
The finger drop process is probably a result of the crosstalk between ethylene (i.e. ripening and wounding) and developmental regulatory pathways. The ethylene transduction pathway model has been proposed and the related components identified (Cara and Giovannoni 2008). On the other hand, MADS-box genes have recently been identified as a major component in the molecular circuit of the developmental regulation of fruit (Vrebalov et al. 2002; Giovannoni 2004; Elitzur et al. 2010). It should be interesting to identify the ethylene and developmental transduction components involved in the finger drop process. This represents an interesting challenge to gain further insight into the banana ripening process and especially the physiological events occurring in banana peel tissue, whose ripening process clearly differs compared with that of pulp.
Finally, with the prospect of identifying ripening-related markers through a candidate gene approach, MaACO1, MaACS1, MaACS2, and to a lesser extent MaACS4 genes that are induced in DZ to a greater extent than in CZ could be considered as putative candidates related to the upstream regulatory steps of the finger drop process. However, and before their use in molecular breeding schemes for banana improvement, these candidates need to be validated through functional studies using cultivars contrasting their tendency to develop finger drop.
Sources of funding
The work is a part of the ongoing research project ‘Qualité des Produits Végétaux’ funded by the Fonds Européen de Dévéloppement Régional (FEDER) Convergence: Guadeloupe 2007–2013.
Contributions by the authors
D.M.-A-M. designed the project, performed all the molecular biology experiments, constructed the phylogenetic tree, analysed the qPCR data (Fig. 2) and wrote the manuscript. O.H. performed all the physicochemical experiments, including fruit sampling, treatment, monitoring of postharvest ripening and physicochemical data analysis described in Fig. 1.
Conflict of interest statement
None declared.
Acknowledgement
We thank Mr Poumaroux and the banana growers of Guadeloupe for providing the bananas assessed in this study.
Literature cited
- Baldry J, Coursey DG, Howard GE. The comparative consumer acceptability of triploid banana fruit. Tropical Science. 1981;23:33–66. [Google Scholar]
- Barlow JN, Zhang Z, John P, Baldwin JE, Schofield CJ. Inactivation of 1-aminocyclopropane-1-carboxylate oxidase involves oxidative modifications. Biochemistry. 1997;36:3563–3569. doi: 10.1021/bi962521y. doi:10.1021/bi962521y. [DOI] [PubMed] [Google Scholar]
- Bleecker AB, Kende H. Ethylene: a gaseous signal molecule in plants. Annual Review of Cell and Developmental Biology. 2000;16:1–18. doi: 10.1146/annurev.cellbio.16.1.1. doi:10.1146/annurev.cellbio.16.1.1. [DOI] [PubMed] [Google Scholar]
- Cara B, Giovannoni JJ. Molecular biology of ethylene during tomato fruit development and maturation. Plant Science. 2008;175:106–113. doi:10.1016/j.plantsci.2008.03.021. [Google Scholar]
- Chae HS, Kieber JJ. Eto Brute? Role of ACS turnover in regulating ethylene biosynthesis. Trends in Plant Science. 2005;10:291–296. doi: 10.1016/j.tplants.2005.04.006. doi:10.1016/j.tplants.2005.04.006. [DOI] [PubMed] [Google Scholar]
- Chillet M, de Lapeyre de Bellaire L, Hubert O, Mbéguié-A-Mbéguié D. Mechanical characterisation of banana fruits. Fruits. 2008;63:51–52. doi:10.1051/fruits:2007045. [Google Scholar]
- Choudhury SR, Saha PP, Singh SK, Sengupta DN. Characterization of differential ripening pattern in association with ethylene biosynthesis in the fruits of five naturally occurring banana cultivars and detection of a GCC-box-specific DNA-binding protein. Plant Cell Reports. 2008;27:1235–1249. doi: 10.1007/s00299-008-0547-4. doi:10.1007/s00299-008-0547-4. [DOI] [PubMed] [Google Scholar]
- Choudhury SR, Singh SK, Roy S, Sengupta DN. An insight into the sequential, structural and phylogenetic properties of banana 1-aminocyclopropane-1-carboxylate synthase 1 and study of its interaction with pyridoxal-5′-phosphate and aminoethoxyvinylglycine. Journal of Biosciences. 2010;35:281–294. doi: 10.1007/s12038-010-0032-4. doi:10.1007/s12038-010-0032-4. [DOI] [PubMed] [Google Scholar]
- Choudhury SR, Roy S, Sengupta DN. A Ser/Thr protein kinase phosphorylates MA-ACS1 (Musa acuminata 1-aminocyclopropane-1-carboxylic acid synthase 1) during banana fruit ripening. Planta. 2012;236:491–511. doi: 10.1007/s00425-012-1627-9. doi:10.1007/s00425-012-1627-9. [DOI] [PubMed] [Google Scholar]
- D'Hont A, Denoeud F, Aury J-A, Baurens F-C, Carreel F, Garsmeur O, Noel B, Bocs S, Droc G, Rouard M, Da Silva C, Jabbari K, Cardi C, Poulain J, Souquet M, Labadie K, Jourda C, Lengellé J, Rodier-Goud M, Alberti A, Bernard M, Correa M, Ayyampalayam S, Mckain MR, Leebens-Mack J, Burgess D, Freeling M, Mbéguié-A-Mbéguié D, Chabannes M, Wicker T, Panaud O, Barbosa J, Hribova E, Heslop-Harrison P, Habas R, Rivallan R, Francois P, Poiron C, Kilian A, Burthia D, Jenny C, Bakry F, Brown S, Guignon V, Kema G, Dita M, Waalwijk C, Joseph S, Dievart A, Jaillon O, Leclercq J, Argout X, Lyons E, Almeida A, Jeridi M, Dolezel J, Roux N, Risterucci A-M, Weissenbach J, Ruiz M, Glaszmann J-C, Quétier F, Yahiaoui N, Wincker P. The banana (Musa acuminata) genome and the evolution of monocotyledonous plants. Nature. 2012;488:213–217. doi: 10.1038/nature11241. [DOI] [PubMed] [Google Scholar]
- Elitzur T, Vrebalov J, Giovannoni JJ, Goldschmidt EE, Friedman H. The regulation of MADS-box gene expression during ripening of banana and their regulatory interaction with ethylene. Journal of Experimental Botany. 2010;61:1523–1535. doi: 10.1093/jxb/erq017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Flores F, Ben Amor M, Jones B, Pech JC, Bouzayen M, Latché A, Romojaro F. The use of ethylene-suppressed lines to assess differential sensitivity to ethylene of the various ripening pathways in cantaloupe melons. Physiologia Plantarum. 2001;113:128–133. doi:10.1034/j.1399-3054.2001.1130117.x. [Google Scholar]
- Gerasopoulos D, Richardson DG. Effects of exogenous propylene and fruit calcium on ripening of non-chilled and chilled Anjou pears. Postharvest Biology and Technology. 1996;8:111–120. doi:10.1016/0925-5214(95)00067-4. [Google Scholar]
- Grimplet J. France: 2004. Génomique fonctionnelle et marqueurs de qualité chez l'abricot. PhD Thesis Institut Nationale Polytechnique de Toulouse. [Google Scholar]
- Giovannoni JJ. Genetic regulation of fruit development and ripening. The Plant Cell. 2004;16(Suppl):S170–S180. doi: 10.1105/tpc.019158. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Han L, Li GJ, Yang KY, Mao G, Wang R, Liu Y, Zhang S. Mitogen-activated protein kinase 3 and 6 regulate Botrytis cinerea-induced ethylene production in Arabidopsis. The Plant Journal. 2010;64:114–127. doi: 10.1111/j.1365-313X.2010.04318.x. [DOI] [PubMed] [Google Scholar]
- Hayama H, Shimada T, Fujii H, Ito A, Kashimura Y. Ethylene-regulation of fruit softening and softening-related genes in peach. Journal of Experimental Botany. 2006;57:4071–4077. doi: 10.1093/jxb/erl178. doi:10.1093/jxb/erl178. [DOI] [PubMed] [Google Scholar]
- Hicks EW. Finger dropping from bunches of Australian Cavendish bananas. Journal of Council Science of Indian Research. 1934;7:165–168. [Google Scholar]
- Huang FC, Do YY, Huang PL. Genomic organization of a diverse ACC synthase gene family in banana and expression characteristics of the gene member involved in ripening of banana fruits. Journal of Agricultural Food Chemistry. 2006;54:3859–3868. doi: 10.1021/jf060001w. [DOI] [PubMed] [Google Scholar]
- Imsabai W, Ketsa S, van Doorn W. Physiological and biochemical changes during banana ripening and finger drop. Postharvest Biology and Technology. 2006;39:211–216. doi:10.1016/j.postharvbio.2005.10.001. [Google Scholar]
- Inaba A, Liu X, Yokotani N, Yamane M, Lu WJ, Nakano R, Kubo Y. Differential feedback regulation of ethylene biosynthesis in pulp and peel tissues of banana fruit. Journal of Experimental Botany. 2007;258:1047–1057. doi: 10.1093/jxb/erl265. [DOI] [PubMed] [Google Scholar]
- Jeanmougin F, Thompson JD, Gouy M, Higgins DG, Gibson TJ. Multiple sequence alignment with Clustal X. Trends in Biochemical Sciences. 1998;23:403–405. doi: 10.1016/s0968-0004(98)01285-7. doi:10.1016/S0968-0004(98)01285-7. [DOI] [PubMed] [Google Scholar]
- Jiang Y, Joyce DC, Macnish AJ. Responses of banana fruit to treatment with 1-methylcyclopropene. Plant Growth Regulation. 1999;28:77–82. doi:10.1023/A:1006222631666. [Google Scholar]
- Johnston JW, Gunaseelan K, Pidakala P, Wang M, Schaffer RJ. Co-ordination of early and late ripening events in apples is regulated through differential sensitivities to ethylene. Journal of Experimental Botany. 2009;60:2689–2699. doi: 10.1093/jxb/erp122. doi:10.1093/jxb/erp122. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Kamiyoshihara Y, Iwata M, Fukaya T, Tatsuki M, Mori H. Turnover of LeACS2, a wound-inducible 1-aminocyclopropane-1-carboxylic acid synthase in tomato, is regulated by phosphorylation/dephosphorylation. The Plant Journal. 2010;64:140–150. doi: 10.1111/j.1365-313X.2010.04316.x. [DOI] [PubMed] [Google Scholar]
- Kim HO, Hewett EW, Lallu N. The role of ethylene in kiwifruit softening. Acta Horticulturae. 1999;498:255–262. [Google Scholar]
- Lin Z, Zhong S, Grierson D. Recent advances in ethylene research. Journal of Experimental Botany. 2009;60:3311–3336. doi: 10.1093/jxb/erp204. doi:10.1093/jxb/erp204. [DOI] [PubMed] [Google Scholar]
- Liu F. Correlation between banana storage life and minimum treatment time required for ethylene response. Journal of the American Society of Horticultural Science. 1976;101:63–65. [Google Scholar]
- Liu X, Shiomi S, Nakatsuka A, Kubo Y, Nakamura R, Inaba A. Characterization of ethylene biosynthesis associated with ripening in banana fruit. Plant Physiology. 1999;121:1257–1265. doi: 10.1104/pp.121.4.1257. doi:10.1104/pp.121.4.1257. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 2001;25:402–408. doi: 10.1006/meth.2001.1262. doi:10.1006/meth.2001.1262. [DOI] [PubMed] [Google Scholar]
- Mbéguié-A-Mbéguié D, Olivier Hubert O, Fils-Lycaon B, Chillet M, Baurens FC. EIN3-like gene expression during fruit ripening of Cavendish banana (Musa acuminata cv. Grande naine) Physiologia Plantarum. 2008;133:435–448. doi: 10.1111/j.1399-3054.2008.01083.x. a doi:10.1111/j.1399-3054.2008.01083.x. [DOI] [PubMed] [Google Scholar]
- Mbéguié-A-Mbéguié D, Fils-Lycaon B, Chillet M, Hubert O, Galas C, Gomez RM. Extraction and purification of total RNA from banana tissues (small scale) Fruit. 2008;63:255–261. b doi:10.1051/fruits:2008020. [Google Scholar]
- Mbéguié-A-Mbéguié D, Hubert O, Baurens FC, Sidibé-Bocs S, Matsumoto T, Chillet M, Fils-Lycaon B. Expression patterns of cell wall modifying genes from banana during ripening in relationship with finger drop. Journal of Experimental Botany. 2009;60:2021–2034. doi: 10.1093/jxb/erp079. doi:10.1093/jxb/erp079. [DOI] [PMC free article] [PubMed] [Google Scholar]
- New S, Marriott J. Factors affecting the development of finger drop in bananas after ripening. Journal of Food Technology. 1983;18:241–250. doi:10.1111/j.1365-2621.1983.tb00265.x. [Google Scholar]
- Page RDM. TREEVIEW: an application to display phylogenetic trees on personal computers. Computer Applications in the Biosciences. 1996;12:357–358. doi: 10.1093/bioinformatics/12.4.357. [DOI] [PubMed] [Google Scholar]
- Paull RE. Ethylene, storage and ripening temperatures affect Dwarf Brazilian banana finger drop. Postharvest Biology and Technology. 1996;8:65–74. doi:10.1016/0925-5214(95)00058-5. [Google Scholar]
- Pereira MCT, Salomão LCC, de Oliveira e Silva S, Cecon PR, Puschmann R, de Jesus ON, Cerqueira RC. Different banana genotypes in relation to their susceptibility to finger drop and fruit characterization. Revista Brasilia Fruticultura. 2004;26:499–502. doi:10.1590/S0100-29452004000300030. [Google Scholar]
- Ramassamy S, Bouzayen M, Pech JC, Latché A. Catalytic inactivation of ACC oxidase is associated with a decrease in the apparent pI of the protein. In: Pech JC, Latché A, Bouzayen M, editors. Plant sciences 1997; 1997. 3ème Colloque Société Française de Physiologie Végétale, Toulouse, 1.2.3 Decembre 97, 71–72. [Google Scholar]
- Rozen S, Skaletsky HJ. Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S, editors. Bioinformatics methods and protocols: methods in molecular biology. Totowa, NJ: Humana Press; 2000. pp. 365–386. [DOI] [PubMed] [Google Scholar]
- Saengpook C, Ketsa S, van Doorn W. Effects of relative humidity on banana finger drop. Postharvest Biology and Technology. 2007;45:151–154. doi:10.1016/j.postharvbio.2007.02.004. [Google Scholar]
- Semple AJ, Thompson AK. Influence of the ripening environment on the development of finger drop in bananas. Journal of the Science of Food and Agriculture. 1988;46:139–146. doi:10.1002/jsfa.2740460203. [Google Scholar]
- Skottke KR, Yoon GM, Kieber JJ, DeLong A. Protein phosphatase 2A controls ethylene biosynthesis by differentially regulating the turnover of ACC synthase isoforms. PLoS Genetique. 2011;7:e1001370. doi: 10.1371/journal.pgen.1001370. doi:10.1371/journal.pgen.1001370. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Umber M, Paget B, Hubert O, Salas I, Salmon F, Jenny C, Chillet M, Bugaud C. Application of thermal sums concept to estimate the time to harvest new banana hybrids for export. Scientia Horticulturae. 2011;129:52–57. doi:10.1016/j.scienta.2011.03.005. [Google Scholar]
- Vrebalov J, Ruezinsky D, Padmanabhan V, White R, Medrano D, Drake R, Schuch W, Giovannoni J. A MADS-box gene necessary for fruit ripening at the tomato ripening-inhibitor (rin) locus. Science. 2002;296:343–346. doi: 10.1126/science.1068181. [DOI] [PubMed] [Google Scholar]
- Wan CY, Wilkins TA. A modified hot borate method significantly enhances the yield of high-quality RNA from cotton. Analytical Biochemistry. 1994;223:7–13. doi: 10.1006/abio.1994.1538. doi:10.1006/abio.1994.1538. [DOI] [PubMed] [Google Scholar]
- Wang H, Mei W, Qin Y, Zhu Y. 1-Aminocyclopropane-1-carboxylic acid synthase 2 is phosphorylated by calcium-dependent protein kinase 1 during cotton fiber elongation. Acta Biochimica et Biophysica Sinica. 2011;43:654–661. doi: 10.1093/abbs/gmr056. doi:10.1093/abbs/gmr056. [DOI] [PubMed] [Google Scholar]
- Wang KLC, Li H, Ecker JR. Ethylene biosynthesis and signaling networks. The Plant Cell. 2002;14:S131–S151. doi: 10.1105/tpc.001768. [DOI] [PMC free article] [PubMed] [Google Scholar]
- Yoshida H, Nagata M, Saito K, Wang KL, Ecker JR. Arabidopsis ETO1 specifically interacts with and negatively regulates type 2 1-aminocyclopropane-1-carboxylate synthases. BMC Plant Biology. 2005;5:14. doi: 10.1186/1471-2229-5-14. doi:10.1186/1471-2229-5-14. [DOI] [PMC free article] [PubMed] [Google Scholar]



