Abstract
Arcanobacterium pyogenes, a common inhabitant of the mucosal surfaces of livestock, is also a pathogen associated with a variety of infections. In livestock, A. pyogenes is exposed to antimicrobial agents used for prophylaxis and therapy, notably tylosin, a macrolide used extensively for the prevention of liver abscessation in feedlot cattle in the United States. Many, but not all, tylosin-resistant A. pyogenes isolates carry erm(X), suggesting the presence of other determinants of tylosin resistance. Oligonucleotide primers designed for conserved regions of erm(B), erm(C), and erm(T) were used to amplify a 404-bp fragment from a tylosin-resistant A. pyogenes isolate, OX-7. DNA sequencing revealed that the PCR product was 100% identical to erm(B) genes, and the erm(B) gene region was cloned in Escherichia coli. The A. pyogenes Erm B determinant had the most DNA identity with an Erm B determinant carried by the Clostridium perfringens plasmid pIP402. However, the A. pyogenes determinant lacked direct repeat DR1 and contained a deletion in DR2. Flanking the A. pyogenes erm(B) gene were partial and entire genes similar to those found on the Enterococcus faecalis multiresistance plasmid pRE25. This novel architecture suggests that the erm(B) element may have arisen by recombination of two distinct genetic elements. Ten of 32 tylosin-resistant isolates carried erm(B), as determined by DNA hybridization, and all 10 isolates carried a similar element. Insertion of the element was site specific, as PCR and Southern blotting analysis revealed that the erm(B) element was inserted into orfY, a gene of unknown function. However, in three strains, this insertion resulted in a partial duplication of orfY.
A common commensal organism on the mucous membranes of cattle and swine, Arcanobacterium pyogenes is also an opportunistic pathogen in these animals. A. pyogenes is responsible for a number of suppurative infections of the skin, joints, and visceral organs, including liver abscesses in feedlot cattle (13) and pneumonia (11) and arthritis (28) in pigs. Liver abscesses in feedlot cattle are a substantial problem for the beef cattle industry and are second only to respiratory diseases in terms of economic losses. The primary etiologic agent of liver abscessation is Fusobacterium necrophorum (22). However, A. pyogenes acts as a synergistic pathogen in this disease, being present in up to 90% of abscesses (17).
The use of antimicrobial agents as feed additives for disease prophylaxis and growth promotion is a common practice in the U.S. beef cattle industry. Tylosin is the most effective and commonly used feed additive for the prevention of bovine liver abscessation (16, 29). A study involving almost 7,000 feedlot cattle demonstrated that tylosin use reduced the incidence of liver abscessation by 73% and increased weight gain and feed conversion by 2.3 and 2.6%, respectively (30). Correspondingly, tylosin use is extensive, with 42.3% of U.S. feedlot cattle receiving tylosin as a feed additive (29). Interestingly, in cattle that were fed tylosin, the incidence of liver abscesses containing A. pyogenes increased from 10 to 53% (15).
While tylosin resistance in A. pyogenes has been documented (10, 27, 32), it is only recently that the mechanisms of tylosin resistance in A. pyogenes have been investigated. We identified an erm(X) determinant in the majority of tylosin-resistant A. pyogenes isolates (12). However, the identification of tylosin-resistant A. pyogenes isolates that did not carry erm(X) (12) highlighted the presence of other tylosin resistance mechanisms.
In this study, we report the identification of a novel Erm B determinant found in 31.2% of tylosin-resistant A. pyogenes isolates. The A. pyogenes erm(B)-associated sequences may have arisen by recombination and/or rearrangement of two distinct genetic elements. Furthermore, insertion of this element is site specific in A. pyogenes.
MATERIALS AND METHODS
Bacterial strains and growth conditions
The 110 A. pyogenes strains used in this study were field isolates obtained from veterinary diagnostic laboratories or personal collections. These strains were isolated from cattle (n = 76), swine (n = 24), birds (n = 5), dogs (n = 2), a deer (n = 1), a sheep (n = 1), and a cat (n = 1). A. pyogenes strains were grown on brain heart infusion (BHI; Difco) agar plates supplemented with 5% bovine blood at 37°C and 5% CO2 or in BHI broth supplemented with 5% newborn calf serum (Omega Scientific Inc.) at 37°C with shaking. Escherichia coli DH5αMCR strains (Gibco-BRL) were grown at 37°C on Luria-Bertani (LB; Difco) agar or in LB broth with shaking. Antibiotics were added as appropriate at the following concentrations: for A. pyogenes, erythromycin (EM) or tylosin at 15 μg/ml and kanamycin (KM) at 30 μg/ml; for E. coli, chloramphenicol at 30 μg/ml, EM at 200 μg/ml, and KM at 50 μg/ml.
DNA techniques
Genomic DNA from A. pyogenes was isolated by using the method of Pospiech and Neumann (20). E. coli plasmid DNA extraction, transformation, DNA restriction, ligation, agarose gel electrophoresis, and Southern transfer of DNA to nylon membranes were performed essentially as described previously (2). The preparation of DNA probes by PCR with oligonucleotide primers internal to specific genes, DNA hybridization, and probe detection were performed by using the digoxigenin DNA labeling and detection kit (Roche), as recommended by the manufacturer. The preparation of DNA-containing agarose plugs and pulsed-field gel electrophoresis (PFGE) were performed essentially as described previously (4). PCR DNA amplification was performed by using Taq DNA polymerase (Promega) with the supplied reaction buffer for 35 cycles, consisting of 1 min at 94°C, 1 min at 50 to 55°C, and 1 min/kb at 72°C with a final extension step of 72°C for 5 min. Oligonucleotide primer sequences are shown in Table 1, and their locations on the erm(B) gene map are indicated in Fig. 1A.
TABLE 1.
Sequences of oligonucleotide primers used in this study
| Primer | Gene (orientation) | Nucleotide positions in the erm(B) gene region | Sequence (5′-3′) |
|---|---|---|---|
| ermBCTF | erm(B) (forward) | 1742-1763 | GAAATTGGAACAGGTAAAGG |
| ermBCTR | erm(B) (reverse) | 2126-2145 | TTTACTTTTGGTTTAGGATG |
| ermB6 | orfζ (reverse) | 3568-3589 | CTGACCCTGGTTGCCCACCAAG |
| tetW43 | orfY (forward) | 1059-1080, 3862-3883a | TATCGTATTAGCGGATTAGAGG |
| tetW47 | orfY (reverse) | 4228-4249 | TCATCTCTTTAGGCGGTTCTGC |
Due to the partial duplication of orfY in OX-7, this primer binds at two sites in the erm(B) gene region.
FIG. 1.
Genetic organization of the erm(B) element from A. pyogenes and comparison with related erm(B) elements. (A) Map of the A. pyogenes OX-7 erm(B) gene region. ORFs and their orientations are represented by arrows. Partial ORFs are represented by rectangles. In all cases, the partial ORFs are oriented in the same direction as the other ORFs. The shaded portions of the orfY gene fusions delineate the orfY sequences and the insertion points of the erm(B) element. orfγ and orfω are represented by black and gray, respectively. The palB sequence is indicated by a small black rectangle. The positions and directions of the oligonucleotide primers used in this study are represented by bent arrows below the gene map. (B) Comparative genetic organization of erm(B) elements from A. pyogenes strain OX-7, C. perfringens plasmid pIP402 (GenBank accession no. U18931), and E. faecalis plasmid pRE25 (GenBank accession no. X92945). The open rectangles denote the DRs originally identified in the pIP402 sequence. The dashed lines in the A. pyogenes erm(B) element delineate the deletion in DR2. The two orfγ′ sequences in pRE25 are different, but partially overlapping, sequences encoding the C-terminal portion of γ.
Nucleotide sequence determination
The sequence of the erm(B) gene region was determined from pJGS579 and its subclones by using automated DNA sequencing. Sequencing was performed with both strands, crossing all restriction sites, with KS or T7 sequencing primers or oligonucleotide primers designed for the sequence of the erm(B) gene region. The sequencing reactions were performed by the Genomic Analysis and Technology Core at the University of Arizona with a model 377 DNA sequencer (Applied Biosystems Inc.).
Computer sequence analysis
Nucleotide sequence data were compiled by using the Sequencher program (GeneCodes). Database searches were performed by using the BlastX and BlastP algorithms (1). Sequence analysis was performed by using the suite of programs available through the Genetics Computer Group (Accelyrs). Multiple sequence alignments were performed by using CLUSTAL W (26).
Determination of MICs
The determination of MICs for A. pyogenes was conducted according to the National Committee for Clinical Laboratory Standards methodology (18) with the modifications described by Trinh et al. (27). The antimicrobial agents to be tested were diluted in a doubling-dilution pattern at concentrations ranging from 0.06 to 2,048 μg/ml in the wells of sterile, 96-well, round-bottom microtiter plates in 50-μl volumes. The MIC was read visually as the lowest concentration of the antimicrobial agent to prevent growth (turbidity) compared with the growth of the control (no antimicrobial agent added). Each isolate was tested in duplicate on two separate occasions, and the end points for each antimicrobial agent did not differ. To determine the MICs following induction, the A. pyogenes isolates were grown on BHI agar containing 5% bovine blood and 1 μg of the appropriate antimicrobial agent/ml prior to MIC determination, as described above.
Nucleotide sequence accession number
The nucleotide sequence of the erm(B) gene and associated sequences were submitted to the GenBank database under accession number AY334073.
RESULTS AND DISCUSSION
Identification and prevalence of erm(B) in A. pyogenes
Of 110 A. pyogenes isolates tested, there were 32 (29.1%) for which the tylosin MIC was ≥64 μg/ml (27; data not shown). Of these 32 resistant isolates, 23 (71.9%) carried the erm(X) gene, as determined by DNA hybridization with an erm(X)-specific probe (12; data not shown), indicating that the remaining isolates carried another mechanism of tylosin resistance. As erm(B) and erm(C) are predominant Erm determinants found in a wide variety of bacterial species (21), PCR primers were designed for conserved regions of erm(B) (GenBank accession no. M36722) and erm(C) (GenBank accession no. J01755). In addition, these primers also amplify erm(T) (GenBank accession no. AF310974). PCRs were performed on the 32 tylosin-resistant A. pyogenes isolates by using primers ermBCTF and ermBCTR (Table 1; Fig. 1A), and a product of 404 bp was obtained from 10 isolates. Sequencing of the PCR product from A. pyogenes strain OX-7 revealed that it had 100% nucleotide sequence identity with several erm(B) genes (e.g., GenBank accession no. M36722). To confirm the presence of erm(B) in the other isolates, DNA hybridization with an erm(B)-specific probe was performed. The 404-bp probe spanned bases 103 to 506 of the erm(B) open reading frame (ORF) and was hybridized under high-stringency conditions to genomic DNA from the 10 PCR-positive isolates. All of these isolates, but not BBR1 or 98-4277-2, which carries erm(X) (12), hybridized to the erm(B) probe, indicating the presence of the erm(B) gene (data not shown). Therefore, the prevalence of erm(B) in A. pyogenes isolates is 9.1% (n = 110), and this gene is present in 31.2% of tylosin-resistant isolates. One isolate, JGS496, carries both the erm(B) and erm(X) genes.
Cloning and nucleotide sequence determination of erm(B)
A BamHI library of A. pyogenes OX-7 genomic DNA was prepared in pBC KS (Stratagene) and introduced into E. coli DH5αMCR by electroporation. As erm(B) genes also confer resistance to EM, for convenience, experiments with E. coli were performed using EM. EM-resistant colonies were selected by growth on LB agar containing chloramphenicol and EM. Plasmid DNA from one of these recombinants, pJGS579, contained an approximately 7-kb insert, encompassing the entire erm(B) gene region, and the nucleotide sequence of this region was deduced from pJGS579 and its overlapping subclones.
Comparative analysis of the erm(B) element
The erm(B) gene carried by OX-7 has substantial DNA identity with other erm(B) genes, such as that from the Clostridium perfringens plasmid pIP402 (GenBank accession no. U18931; 100% identity), the Enterococcus faecalis plasmid pRE25 (GenBank accession no. X92945; 99.6% identity), and the Clostridium difficile transposon Tn5398 (GenBank accession no. AF109075; 99.1% identity). Like the erm(B) gene product from pIP402 (3), the A. pyogenes erm(B) gene product lacked a leader peptide, which is in contrast to the pRE25 (23) and Tn5398 (9) erm(B) gene products.
The A. pyogenes erm(B) element had a novel genetic organization, containing genes and gene fragments from two known erm(B) elements, pIP402 and pRE25 (Fig. 1B). Overall, the A. pyogenes erm(B) element displayed the highest DNA identity with that carried on pIP402 (3). Identity with this element begins 51 bp upstream of the start of the A. pyogenes erm(B) gene, equivalent to base 1460 of the pIP402 sequence (GenBank accession no. U18931). The two elements displayed 100% DNA identity over a 1,205-bp span, ending at base 2664 of pIP402. This region encompasses the −10 box of the putative erm(B) promoter, erm(B), orf3, a partial orfγ, and part of direct repeat DR2. At this point, the A. pyogenes erm(B) element contains a 947-bp deletion, and DNA identity resumes at base 3612 of the pIP402 sequence. The A. pyogenes erm(B) element has 98.3% DNA identity with the remaining 518 bp of the available pIP402 sequence. This region downstream of the deletion carries the 3′ ends of orf298, palB, and orfω and the 5′ end of orfɛ. orfω and orfɛ are not annotated in the pIP402 sequence, and these ORFs were identified by their similarity to genes carried by pRE25, orf16, and orf17, respectively (23). It is not known if the DNA identity between the erm(B) elements from A. pyogenes and C. perfringens extends past the available pIP402 sequence, but this information may provide clues regarding the evolution of these elements.
The DR elements identified in the C. perfringens (3) and C. difficile (8, 9, 24) erm(B) elements consist of fragments of ORFs, probably from a pRE25-like plasmid. The 5′ end of the DR is homologous to the 3′ end of orfγ, a type I topoisomerase gene of pRE25; the central portion contains orf298, encoding an ATPase involved in plasmid partitioning (23); and the 3′ end contains the start of orfω, a gene encoding a transcriptional repressor responsible for plasmid maintenance (7).
The 66 bp of orf298 encoded by the A. pyogenes erm(B) element is 100% identical to that from pIP402 (GenBank accession no. U18931) and 97.0% identical to orf16 from pRE25 (GenBank accession no. X92945). Immediately downstream of the orf298 stop codon is the 49-bp palB sequence, which, with palA, is a palindrome found flanking orf298 in erm(B) elements from pIP402 (3), pRE25 (23), and C. difficile (9). orfω carried by the A. pyogenes erm(B) element is 97.8% identical to that from pIP402 (GenBank accession no. U18931) and 96.7% identical to orf17 from pRE25 (GenBank accession no. X92945). The A. pyogenes erm(B) element contains a complete copy of orfɛ, which has 83.9% DNA identity with orf18 of pRE25. A 194-bp fragment of orfζ starts 1 bp downstream of orfɛ. This partial gene has 77.8% DNA identity with the appropriate region of orf19 from pRE25. orfɛ and orfζ encode an addiction system involved in plasmid maintenance, with ζ acting as a toxin and ɛ acting as its corresponding antidote (6).
The A. pyogenes element has DNA identity with that of pIP402 51 bp upstream of the erm(B) gene, which includes the −10 box of the putative erm(B) promoter. At this point, there is a 162-bp internal fragment of trsK (orf33), a gene encoding a conjugal transfer protein, which is also found in pRE25 (23) but which has not been identified in clostridial erm(B) elements. The region of trsK present in the A. pyogenes erm(B) element has 99.4% DNA identity with bases 486 to 647 of the 1,656-bp pRE25 gene (23). The fusion of the trsK fragment with the erm(B) upstream sequence resulted in the formation of a putative hybrid promoter with the −35 box (TTGTTA) contributed by the trsK sequence, presumably allowing expression of the erm(B) gene.
The entire A. pyogenes erm(B) element, delineated by the trsK gene fragment at the 5′ end and the truncated orfζ at the 3′ end, is 2,224 bp in length with a G+C content of 33.6%. The average G+C content of known A. pyogenes housekeeping genes is 62.5% (our unpublished data), and the reduced G+C content of the erm(B) element more closely resembles those of genes from Clostridium or Enterococcus spp., from which this element is hypothesized to have originated. Indeed, while erm(B) is a widespread gene, it is not commonly found in bacterial species with high G+C contents (21).
The evolution of the A. pyogenes erm(B) element is unclear, but the DNA identity with pIP402 suggests that this, or a similar plasmid, was the original source. The acquisition of the trsK fragment probably occurred before the element inserted into A. pyogenes, as the target gene orfY (see below) is intact in non-erm(B)-containing strains and lacks trsK sequences (data not shown). The sequences that make up the pIP402 erm(B) element appear to have arisen from the duplication, deletion, and/or recombination of a pRE25-like plasmid. While the sequence of the erm(B) element from pIP402 lacks trsK, it is as yet unknown whether this plasmid carries a trsK homologue.
It is not known whether this element is mobile in A. pyogenes. Furthermore, any mechanisms of mobility and/or insertion for this element are unknown. No entire genes involved in transposition or conjugal transfer were found associated with the erm(B) determinant, and there are no apparent direct or indirect repeats at either end of this element.
In A. pyogenes OX-7, the erm(B) element has inserted into orfY
Insertion of the erm(B) element in A. pyogenes strain OX-7 resulted in fusion of the trsK sequences with the first 638 bp of orfY, a gene of unknown function. The G+C content of orfY (37.3%) is substantially different than that of other A. pyogenes genes, and the translated product of this gene has 48.8% identity and 73.4% similarity to OrfY from the Tn5405-like transposon of Staphylococcus intermedius (GenBank accession no. AF299292). However, there is no significant DNA identity with the orfY harbored on this transposon, suggesting that in A. pyogenes, orfY was not acquired from this source. Interestingly, in this S. intermedius strain, the transposon is inserted immediately downstream of a region of DNA containing erm(B) and orf3 (5).
orf181, which encodes a protein with 42.0% identity and 68.0% similarity to a hypothetical protein of unknown function from Sinorhizobium meliloti (GenBank accession no. NC_003047), is 96 bp upstream of the orfY-trsK fusion. Like orfY, orf181 has a reduced G+C content of 40.3%, and this region of the A. pyogenes OX-7 genome may be part of a larger region acquired by horizontal transfer, probably prior to the acquisition of the erm(B) element. orfY exists uninterrupted and is adjacent to orf181 in the genome of the tylosin-susceptible A. pyogenes strain OX-9 (S. J. Billington, unpublished data), suggesting a subsequent insertion of the erm(B) element. The insertion of the erm(B) element in strain OX-7 resulted in a partial duplication of orfY, as the partial orfζ is fused to the last 673 bp of orfY. The 5′ orfY is truncated by 94 bp from the end of the 732-bp gene, while the 3′ orfY is truncated 59 bp from the start. Thus, the erm(B) element is flanked by 579-bp DRs composed of sequences internal to orfY.
The erm(B) element inserts in a site-specific manner in the A. pyogenes genome
An initial experiment was performed to determine whether the insertion point for the erm(B) element was random. A. pyogenes genomic DNA from the 10 erm(B) strains was digested with BamHI-XbaI, and Southern blotting was performed. The blots were hybridized under high-stringency conditions with either the erm(B)-specific probe or an orfY-specific probe (spanning bases 271 to 658 of orfY). The orfY probe was amplified from A. pyogenes strain OX-9 by using primers tetW43 and tetW47 (Table 1; Fig. 1A). In all erm(B)-containing isolates, the erm(B) and orfY probes hybridized to DNA fragments of the same size (Fig. 2), indicating that erm(B) and orfY are linked and that integration of the erm(B) element is most likely site specific. The sizes of the hybridizing bands differed between isolates (Fig. 2), probably as a result of restriction fragment length polymorphism. To further delineate the insertion point, PCR was used to amplify sequences between erm(B) and orfY. The initial PCR experiment to amplify sequences 5′ from erm(B) used primers tetW43 and ermBCTR (Table 1; Fig. 1A), but a product was amplified from only three strains, including strain OX-7 (Fig. 3A), somewhat contradicting the Southern blot data. However, a PCR using primers ermBCTF and ermB6 (Table 1; Fig. 1A) amplified a product of 1,847 bp, including orfY sequences 3′ from erm(B), from all 10 isolates (Fig. 3B). It appears that erm(B) insertion is indeed site specific in A. pyogenes, but in three isolates, including OX-7, this insertion resulted in a partial duplication of orfY such that internal portions of orfY flanked the erm(B) element insertion point. There is no correlation between the strains carrying a duplicated orfY and the size of the erm(B)- and orfY-hybridizing band detected by Southern blotting (Fig. 2).
FIG. 2.
Southern blot of BamHI-XbaI-digested A. pyogenes genomic DNA with digoxigenin-labeled probes specific for orfY or erm(B). Lanes: 1, OX-1; 2, OX-7; 3, JGS496; 4, JGS573; 5, JGS574; 6, JGS597; 7, JGS598; 8, JGS599; 9, 01-4195; 10, D9509363; 11, BBR1 [erm(B) negative and erm(X) negative]; 12, 98-4277-2 [erm(B) negative and erm(X) positive]. The specific probe used is indicated under each Southern blot. DNA size standards in kilobases are shown to the left of the blots.
FIG. 3.
The A. pyogenes erm(B) element inserts in a site-specific manner. The erm(B)-orfY gene region was amplified by PCR, and the amplicons were visualized following electrophoresis in a 1% agarose gel. Lanes: 1, λ HindIII standards; 2, OX-1; 3, OX-7; 4, JGS496; 5, JGS573; 6, JGS574; 7, JGS597; 8, JGS598; 9, JGS599; 10, 01-4195; 11, D9509363; 12, no-template control. The sizes of DNA standards in kilobases are shown to the left of the gels. (A) Primers tetW43 and ermBCTR (Table 1; Fig. 1A) were used. The 1,087-bp product is indicated by an arrow. (B) Primers ermBCTF and ermB6 (Table 1; Fig. 1A) were used. The 1,847-bp product is indicated by an arrow.
Interestingly, DNA hybridization experiments with the orfY-specific probe indicated that orfY was present in 100% of the strains containing erm(B) (Fig. 2). In contrast, this gene was present in only 8.7% of erm(B)-negative A. pyogenes strains (n = 46; data not shown). This finding provides further evidence for site-specific integration. orfY is probably not associated with the erm(B) element, as it is present in A. pyogenes strains that lack erm(B). However, its reduced G+C content suggests that orfY may have also been acquired by horizontal transfer and may be part of an additional element.
In order to determine if erm(B) was plasmid encoded, PFGE was performed on genomic DNA from the 10 erm(B)-containing isolates. PFGE conditions were chosen such that episomal DNA would be resolved in the gel, leaving undigested genomic DNA in the gel wells. Southern blotting was performed under high-stringency conditions with the erm(B) probe, and the presence of hybridization in only the well region suggested that the erm(B) elements appear to be chromosomally associated in all isolates (data not shown).
Determination of MICs and inducibility
The MICs of tylosin were determined for the 10 erm(B)-containing isolates, with and without induction. The MICs of tylosin for the isolates of porcine origin, which included OX-7, were 128 μg/ml, which did not increase following induction (Table 2), indicating constitutive expression of erm(B). This finding is not unexpected given that the product of the A. pyogenes erm(B) gene does not possess a leader peptide, which is responsible for the inducible expression of some erm genes (31). Somewhat surprisingly, the MICs of tylosin for all the bovine isolates were >2,048 μg/ml (Table 2). Although bovine isolates were also tested following induction, the uninduced MICs were so high that any increase would not have been detected. These results suggested that there was some difference in the determinants of tylosin resistance in erm(B)-containing A. pyogenes strains isolated from different animal hosts. Such differences could be due to either differential expression of erm(B) or the presence of an additional tylosin resistance determinant. The MICs of clindamycin and EM were also determined for these 10 strains. As expected, A. pyogenes strains carrying erm(B) also displayed resistance to these antimicrobial agents (Table 2).
TABLE 2.
MICs of tylosin for A. pyogenes strains, determined with and without induction
| Strain | Animal species of isolation | MIC (μg/ml)
|
|||
|---|---|---|---|---|---|
| Tylosin | Tylosin after inductiona | Clindamycin | EM | ||
| BBR1b | Bovine | ≤0.06 | NDc | ≤0.06 | ≤0.06 |
| 01-4195 | Bovine | >2,048 | >2,048 | 512 | 1,024 |
| D9509363 | Bovine | >2,048 | >2,048 | 512 | 1,024 |
| JGS496 | Bovine | >2,048 | >2,048 | 512 | 1,024 |
| JGS573 | Bovine | >2,048 | >2,048 | 512 | 1,024 |
| JGS574 | Bovine | >2,048 | >2,048 | 512 | 1,024 |
| JGS597 | Porcine | 128 | 128 | 256 | 256 |
| JGS598 | Porcine | 128 | 128 | 256 | 256 |
| JGS599 | Porcine | 128 | 128 | 256 | 256 |
| OX-1 | Porcine | 128 | 128 | 256 | 256 |
| OX-7 | Porcine | 128 | 128 | 256 | 256 |
| JGS6000 | ≤0.06 | >2,048 | |||
| JGS6001 | ≤0.06 | >2,048 | |||
Induction involved 1 μg of tylosin per ml.
BBR1 is a tylosin-susceptible strain whose results are shown for comparison.
ND, not determined (as A. pyogenes strain BBR1 will not grow with 1 μg of tylosin/ml).
The bovine isolate JGS574 carries an additional tylosin resistance determinant
To determine whether nucleotide changes within erm(B) or its promoter region were responsible for the increased MICs for bovine isolates, the orfY-erm(B) region of strain JGS573 was amplified with primers tetW43 and ermBCTR (Table 1; Fig. 1A). JGS573 was chosen as this was the only bovine isolate in which the orfY duplication had occurred, enabling the amplification of the start of the erm(B) element with existing primers. There were no differences between the OX-7 and JGS573 sequences (data not shown), suggesting that there may be an additional determinant of tylosin resistance carried by bovine A. pyogenes isolates. To confirm this hypothesis, inactivation of the erm(B) gene was undertaken. A 404-bp fragment of erm(B) was amplified by PCR with primers ermBCTF and ermBCTR. The ends were blunted with T4 DNA polymerase, and the fragment was cloned into SmaI-digested pHSS19 (19). This plasmid, which was unable to replicate in A. pyogenes, was used to transform JGS574, another bovine isolate, to KM resistance by the insertion of the plasmid via a single crossover event (data not shown). JGS574 was used in the knockout experiment instead of JGS573, as it was subsequently determined that JGS573 was resistant to KM. The MICs of tylosin for two independently derived erm(B) mutants, JGS6000 and JGS6001, were determined with and without induction. In the absence of induction, the MICs of tylosin for both erm(B) knockout mutants were, in contrast to that for the parental strain JGS574, ≤0.06 μg/ml (Table 2). However, when induction with tylosin was performed, the MICs for the two mutants were >2,048 μg/ml (Table 2). These data suggest the presence of an inducible tylosin resistance determinant in JGS574, and it is possible that this, or another, determinant is present in the other bovine isolates. While this second determinant is inducible and erm(B) is not, the MIC of tylosin for strain JGS574 is >2,048 μg/ml in the absence of induction. This is most likely due to the presence of erm(B) allowing the nonlethal uptake of tylosin, which subsequently induces expression of the other tylosin resistance determinant. The result is a high level of apparently noninducible tylosin resistance.
Hybridization with a Staphylococcus aureus erm(C)-derived probe (GenBank accession no. V01278) and PCR experiments with primers for conserved regions of the macrolide efflux genes mefA and mefE (14) suggest that none of these genes are responsible for the additional tylosin resistance observed in bovine erm(B) isolates (data not shown). While it would be interesting to identify this additional tylosin resistance determinant, it was beyond the scope of the present investigation.
Conclusions
The A. pyogenes erm(B) element is most likely derived from an element similar to that carried on the C. perfringens plasmid pIP402. However, at least one component of the A. pyogenes element is similar to a region of pRE25, suggesting the occurrence of some recombination event during its evolution. While erm(B) is widespread (21), its presence in bacterial species with high G+C contents is uncommon. The A. pyogenes erm(B) element appears to be similar for all strains, in contrast to those identified for C. difficile, which differ considerably (9, 24). Insertion of the erm(B) element in A. pyogenes appears to be restricted to isolates carrying another horizontally acquired gene, orfY. This may explain why the prevalence of erm(B) is lower than that of erm(X), which is carried by 71.9% of tylosin-resistant A. pyogenes isolates (12; data not shown).
While tylosin is not used for humans, it is still able to select for bacterial cross-resistance to drugs used in human therapy, such as EM and clindamycin, through determinants like Erm B and Erm X. Surveillance studies have reported an increase in the incidence of antibiotic resistance among pathogenic and commensal bacteria as a result of the veterinary use of these drugs (25), contributing to selective pressure for microbial resistance and resulting in the generation of resistance reservoirs. The presence of multiple macrolide-lincosamide-streptogramin B resistance determinants in the commensal organism A. pyogenes, possibly as a result of exposure to tylosin, is consistent with this hypothesis.
Acknowledgments
Partial support for this work was provided by USDA/NRICGP award 99-35204-7818.
We thank Dawn M. Bueschel for excellent technical assistance, Wayne L. Nicholson, University of Arizona, for providing the erm(C)-containing plasmid pWN197, and David S. Stephens, Emory University, for providing the Streptococcus pneumoniae mefE-carrying strain GA3488.
REFERENCES
- 1.Altschul, S. F., T. L. Madden, A. A. Schäffer, J. Zhang, Z. Zhang, W. Miller, and D. J. Lipman. 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25:3389-3402. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, and K. Struhl (ed.). 1994. Current protocols in molecular biology, vol. 1. John Wiley and Sons, Inc., New York, N.Y.
- 3.Berryman, D. I., and J. I. Rood. 1995. The closely related ermB-ermAM genes from Clostridium perfringens, Enterococcus faecalis (pAMβ1), and Streptococcus agalactiae (pIP501) are flanked by variants of a directly repeated sequence. Antimicrob. Agents Chemother. 39:1830-1834. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Billington, S. J., E. U. Wieckowski, M. R. Sarker, D. Bueschel, J. G. Songer, and B. A. McClane. 1998. Clostridium perfringens type E animal enteritis isolates with highly conserved, silent enterotoxin gene sequences. Infect. Immun. 66:4531-4535. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 5.Boerlin, P., A. Burnens, J. Frey, P. Kuhnert, and J. Nicolet. 2001. Molecular epidemiology and genetic linkage of macrolide and aminoglycoside resistance in Staphylococcus intermedius of canine origin. Vet. Microbiol. 79:155-169. [DOI] [PubMed] [Google Scholar]
- 6.Camacho, A. G., R. Misselwitz, J. Behlke, S. Ayora, K. Welfle, A. Meinhart, B. Lara, W. Saenger, H. Welfle, and J. C. Alonso. 2002. In vitro and in vivo stability of the epsilon2zeta2 protein complex of the broad host-range Streptococcus pyogenes pSM19035 addiction system. Biol. Chem. 383:1701-1713. [DOI] [PubMed] [Google Scholar]
- 7.de la Hoz, A. B., S. Ayora, I. Sitkiewicz, S. Fernández, R. Pankiewicz, J. C. Alonso, and P. Ceglowski. 2000. Plasmid copy-number control and better-than-random segregation genes of pSM19035 share a common regulator. Proc. Natl. Acad. Sci. USA 97:728-733. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Farrow, K. A., D. Lyras, and J. I. Rood. 2000. The macrolide-lincosamide-streptogramin B resistance determinant from Clostridium difficile 630 contains two erm(B) genes. Antimicrob. Agents Chemother. 44:411-413. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Farrow, K. A., D. Lyras, and J. I. Rood. 2001. Genomic analysis of the erythromycin resistance element Tn5398 from Clostridium difficile. Microbiology 147:2717-2728. [DOI] [PubMed] [Google Scholar]
- 10.Guérin-Faublée, V., J. P. Flandrois, E. Broye, F. Tupin, and Y. Richard. 1993. Actinomyces pyogenes: susceptibility of 103 clinical animal isolates to 22 antimicrobial agents. Vet. Res. 24:251-259. [PubMed] [Google Scholar]
- 11.Høie, S., K. Falk, and B. M. Lium. 1991. An abattoir survey of pneumonia and pleuritis in slaughter weight swine from 9 selected herds. IV. Bacteriological findings in chronic pneumonic lesions. Acta Vet. Scand. 32:395-402. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Jost, B. H., A. C. Field, H. T. Trinh, J. G. Songer, and S. J. Billington. 2003. Tylosin resistance in Arcanobacterium pyogenes is encoded by an Erm X determinant. Antimicrob. Agents Chemother. 47:3519-3524. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Lechtenberg, K. F., T. G. Nagaraja, H. W. Leipold, and M. M. Chengappa. 1988. Bacteriologic and histologic studies of hepatic abscesses in cattle. Am. J. Vet. Res. 49:58-62. [PubMed] [Google Scholar]
- 14.Luna, V. A., P. Coates, E. A. Eady, J. H. Cove, T. T. H. Nguyen, and M. C. Roberts. 1999. A variety of Gram-positive bacteria carry mobile mef genes. J. Antimicrob. Chemother. 44:19-25. [DOI] [PubMed] [Google Scholar]
- 15.Nagaraja, T. G., A. B. Beharka, M. M. Chengappa, L. H. Carroll, A. P. Raun, S. B. Laudert, and J. C. Parrott. 1999. Bacterial flora of liver abscesses in feedlot cattle fed tylosin or no tylosin. J. Anim. Sci. 77:973-978. [DOI] [PubMed] [Google Scholar]
- 16.Nagaraja, T. G., S. B. Laudert, and J. C. Parrott. 1996. Liver abscesses in feedlot cattle. Part II. Incidence, economic importance, and prevention. Compend. Contin. Edu. Pract. Vet. 18:S264-S273. [Google Scholar]
- 17.Narayanan, S., T. G. Nagaraja, N. Wallace, J. Staats, M. M. Chengappa, and R. D. Oberst. 1998. Biochemical and ribotypic comparison of Actinomyces pyogenes and A. pyogenes-like organisms from liver abscesses, ruminal wall, and ruminal contents of cattle. Am. J. Vet. Res. 59:271-276. [PubMed] [Google Scholar]
- 18.National Committee for Clinical Laboratory Standards. 1999. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals. Approved standard M31-A. National Committee for Clinical and Laboratory Standards, Wayne, Pa.
- 19.Nickoloff, J. A., and R. J. Reynolds. 1991. Subcloning with new ampicillin- and kanamycin-resistant analogs of pUC19. BioTechniques 10:469-472. [PubMed] [Google Scholar]
- 20.Pospiech, A., and B. Neumann. 1995. A versatile quick-prep of genomic DNA from gram-positive bacteria. Trends Genet. 11:217-218. [DOI] [PubMed] [Google Scholar]
- 21.Roberts, M. C., J. Sutcliffe, P. Courvalin, L. B. Jensen, J. Rood, and H. Seppala. 1999. Nomenclature for macrolide and macrolide-lincosamide-streptogramin B resistance determinants. Antimicrob. Agents Chemother. 43:2823-2830. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.Scanlan, C. M., and T. L. Hathcock. 1983. Bovine rumenitis-liver abscess complex: a bacteriological review. Cornell Vet. 73:288-297. [PubMed] [Google Scholar]
- 23.Schwarz, F. V., V. Perreten, and M. Teuber. 2001. Sequence of the 50-kb conjugative multiresistance plasmid pRE25 from Enterococcus faecalis RE25. Plasmid 46:170-187. [DOI] [PubMed] [Google Scholar]
- 24.Spigaglia, P., and P. Mastrantonio. 2002. Analysis of macrolide-lincosamide-streptogramin B (MLSB) resistance determinant in strains of Clostridium difficile. Microb. Drug Resist. 8:45-53. [DOI] [PubMed] [Google Scholar]
- 25.Teuber, M. 2001. Veterinary use and antibiotic resistance. Curr. Opin. Microbiol. 4:493-499. [DOI] [PubMed] [Google Scholar]
- 26.Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:4673-4680. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Trinh, H. T., S. J. Billington, A. C. Field, J. G. Songer, and B. H. Jost. 2002. Susceptibility of Arcanobacterium pyogenes to tetracyclines, macrolides and lincosamides. Vet. Microbiol. 85:353-359. [DOI] [PubMed] [Google Scholar]
- 28.Turner, G. V. 1982. A microbiological study of polyarthritis in slaughter pigs. J. S. Afr. Vet. Assoc. 53:99-101. [PubMed] [Google Scholar]
- 29.U.S. Department of Agriculture. 2000. Part III: health management and biosecurity in U.S. feedlots, 1999. USDA:APHIS:VS, CEAH, report no. N336.1200. National Animal Health Monitoring System, Fort Collins, Colo.
- 30.Vogel, G. J., and S. B. Laudert. 1994. The influence of Tylan on liver abscess control and animal performance: a 40 trial summary. J. Anim. Sci. 72(Suppl. 1):293. [Google Scholar]
- 31.Weisblum, B. 1995. Insights into erythromycin action from studies of its activity as inducer of resistance. Antimicrob. Agents Chemother. 39:797-805. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Yoshimura, H., A. Kojima, and M. Ishimaru. 2000. Antimicrobial susceptibility of Arcanobacterium pyogenes isolated from cattle and pigs. J. Vet. Med. B 47:139-143. [DOI] [PubMed] [Google Scholar]