Abstract
Fifty-eight multidrug-resistant Salmonella enterica strains of 20 serotypes, isolated from animal sources in Italy, were analyzed for tet(A) and strA-strB, conferring tetracycline and streptomycin resistance, respectively. The strA and strB genes were highly prevalent in Salmonella strains of our collection, being detected in 84% of the streptomycin-resistant strains. In many strains, the strA and strB genes were linked to a particular Tn5393-derivative transposon characterized by the presence of the insertion sequence IS1133, previously identified only in the plant pathogen Erwinia amylovora. Sixty-eight percent of the tetracycline-resistant strains were tet(A) positive, indicating that this gene is widely diffused in Salmonella strains circulating in animals in Italy. Most of the tet(A) genes were localized within a deleted Tn1721 transposon variant. Two prevalent repN and repI1 resistance plasmids were identified in Salmonella isolates of our collection.
Tetracyclines are broad-spectrum agents, exhibiting activity against a wide range of gram-positive and gram-negative bacteria, and are currently used for therapy and prophylaxis for human infections and for the prevention and control of bacterial infections in veterinary medicine (17, 18, 21). Tetracyclines are also used in aquaculture and sprayed onto fruit trees and other plants to control bacterial infection (5). Streptomycin has only limited current usage in clinical medicine, but this antibiotic remains important for therapy of and growth promotion in animals and for bacterial disease control in plants (27).
The increasing incidence of resistance to streptomycin and tetracyclines in Salmonella spp. of human and animal origins has been reported worldwide (10, 31). Genes conferring streptomycin and tetracycline resistance in Salmonella enterica serotype Typhimurium definitive type 104 (DT104) have been extensively studied (3, 6), but little information on the mechanism responsible for the wide diffusion of these resistances in other phage types and serotypes is available.
Several different tet genes have been described as conferring resistance to tetracyclines in Salmonella. The most frequent types of tet genes belong to classes A, B, C, D, and G (5, 8). The tet(G) gene has been identified in salmonella genomic island 1, located within the S. enterica serotype Typhimurium DT104 chromosome (3, 6). The tet gene of class A was found on plasmids as well as on the chromosome, whereas the genes tet(B), tet(C), and tet(D) were detected on the chromosomes of S. enterica bacteria of different serotypes, including Typhimurium, Enteritidis, Hadar, Saintpaul, and Choleraesuis (10). The tet(A) gene is often part of transposon Tn1721, and a truncated version of Tn1721 lacking a portion of the left arm has also been described to occur in Salmonella (1, 8, 9, 21). Recently, a new allele of tet(A), designated tet(A)-1, was identified on the pSSTA-1 plasmid in Shigella spp. (12).
A large number of genes can confer streptomycin resistance (22). Among them, the phosphotransferase aph(6)-Ia gene (also named strA) and the aph(6)-Id gene (also named strB) appear to be widely distributed in Salmonella and other gram-negative bacteria. strA-strB has been identified in bacteria circulating in humans, animals, and plants (4, 22, 25, 27, 28). These genes have been described as being part of transposon Tn5393 and are frequently located on plasmids (26).
Integron-borne gene cassettes conferring resistance to aminoglycosides are also very diffused in gram-negative bacteria, and integrons have frequently been associated with the widely distributed transposon Tn21 (15). The Tn21 transposon encodes genes and sites required for transposition (including tnpA, tnpR, tnpM, res, and inverted repeats), and integrons are located in the left arm, adjacent to the tnpM gene. The Tn21-associated integrons often carry the aadA1 gene cassette, known to confer resistance to streptomycin and spectinomycin (15).
In this study, we have examined the prevalence of the strA, strB, and tet(A) resistance genes and integrons conferring streptomycin and tetracycline resistance in a collection of unrelated multidrug-resistant S. enterica strains of different serotypes, isolated in Italy during the years 2000 and 2001.
MATERIALS AND METHODS
Bacterial strains
Totals of 392 and 386 multidrug-resistant S. enterica strains were isolated from animals and foods of animal origin at the Istituto Zooprofilattico Sperimentale delle Venezie (IZSVE), located in northern Italy, during routine surveillance activity in 2000 and 2001, respectively. Fifty-seven multidrug-resistant strains were isolated at the Istituto Zooprofilattico Sperimentale dell'Abruzzo e Molise (IZSAM), located in central Italy, in 2001. Antibiotic susceptibility was established by the disk diffusion method (19, 20) by using 16 different antimicrobial drugs: colistin (10 μg), nalidixic acid (30 μg), ampicillin (10 μg), cefotaxime (30 μg), ciprofloxacin (5 μg), enrofloxacin (5 μg), chloramphenicol (30 μg), gentamicin (10 μg), kanamycin (30 μg), streptomycin (10 μg), sulfonamides (300 μg), tetracycline (30 μg), a combination of trimethoprim and sulfamethoxazole (1.25 and 23.75 μg, respectively), amoxicillin-clavulanic acid (30 μg), cephalothin (30 μg), and neomycin (30 μg). Neomycin breakpoints were defined according to the instructions of the manufacturer of the disk (BBL Sensi-Disk; Becton Dickinson).
All strains were serotyped by agglutination tests with specific O and H antisera (Staten Serum Institute, Copenhagen, Denmark) and classified according to the Kauffman-White scheme. Strains of serotype Typhimurium were phage typed according to a standard procedure (2).
Fifty-eight isolates were chosen from among the 835 multidrug-resistant strains of the collection by using the following criteria. To be included in the study, strains had to be resistant to at least three antimicrobial drugs from among aminoglycosides, tetracyclines, sulfonamides, trimethoprim, and β-lactams, and they had to be from different animal sources, representing both frequent and rare serotypes. Moreover, Salmonella serotype Typhimurium DT104 isolates were excluded, as were repeat isolates of the same serotype obtained in the course of an investigation or during monitoring activities.
The sources of isolation, serotypes, and patterns of resistance of the Salmonella strains analyzed in this study are shown in Table 1.
TABLE 1.
Characteristics of S. enterica isolates tested in this study
| Isolatea | Source | Serotype | Resistancesb | Assay result forc:
|
||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| tet(A) | Tn1721R | Tn1721L | strA- strB | strA IS1133 | Integron- borne gene cassette(s) | Tn21 | repN | repI | ||||
| 17/24 | Animal | Agona | Smr Ter SxTr | + | + | − | + | − | dfrA12-aadA2 | + | − | − |
| 17/22* | Swine | Agona | Smr Ter SxTr | − | − | − | + | − | − | − | − | + |
| 27/28* | Turkey liver | Agona | Smr Ter Apr SxTr Gmr Kmr | + | + | − | + | + | dfrA1-aadA1 | + | + | + |
| 27/14 | Food | Anatum | Smr Ter SxTr Gmr Kmr Nar Cmr | + | + | + | + | − | dfrA1-aadA1 | + | − | − |
| 17/20 | Bovine meat | Anatum | Smr Ter SxTr Nar Gmr | + | + | + | + | − | dfrA1-aadA2 | + | − | − |
| 17/7* | Turkey | Blockley | Smr Ter Apr Amcr Kmr Nar Nmr Enr | + | + | − | + | − | − | − | + | − |
| 17/17 | Turkey | Blockley | Smr Ter Kmr Nar Nmr Cfr | + | + | − | + | − | − | − | + | − |
| 17/18* | Turkey stool | Blockley | Smr Ter Kmr Nar Nmr Enr | + | + | − | + | − | − | − | + | − |
| 17/34* | Meat food | Blockley | Smr Ter Kmr Nar Nmr | + | + | − | + | − | − | − | + | − |
| 17/5 | Guinea fowl | Blockley | Smr Ter Kmr Nmr | + | + | − | + | − | − | − | + | − |
| 17/41 | Swine meat | Blockley | Smr Ter Kmr Nmr | + | + | − | + | − | − | − | − | − |
| 27/7 | Chicken | Bredeney | Smr Ter Apr Amcr Cfr | + | + | − | + | − | − | − | − | − |
| 17/8* | Turkey | Bredeney | Smr Ter Apr Amcr SxTr Nar Cmr Cfr Enr | + | + | + | + | + | dfrA1-aadA1 | + | − | + |
| 17/3 | Dog stool | Bredeney | Smr Ter Sur Kmr Nmr | − | − | − | + | − | − | − | − | − |
| 27/5* | Swine | Colorado | Smr Ter Apr Amcr Cmr Cfr | + | + | − | − | − | − | − | + | − |
| 27/8 | Chicken | Derby | Smr Ter Apr SxTr | − | − | − | + | − | − | − | − | − |
| 27/1* | Pork sausage | Derby | Smr Ter Apr SxTr Cpr | − | − | − | + | − | − | − | − | − |
| 17/11 | Food | Derby | Smr Ter Sur | + | + | − | + | − | aadA2 | − | − | + |
| 17/10 | Swine | Derby | Smr Ter Sur Kmr Nar Nmr | − | − | − | + | − | − | − | + | − |
| 17/14* | Swine | Derby | Smr Ter Sur Kmr Nmr | − | − | − | + | − | − | − | + | − |
| 27/25* | Chicken | Enteritidis | Ter Apr SxTr Gmr Kmr | + | + | − | − | − | dfrA1-aadA1 | + | − | − |
| 27/27* | Chicken | Enteritidis | Ter Apr SxTr Gmr Kmr | + | − | − | − | − | dfrA1-aadA1 | + | − | − |
| 27/30* | Pork sausage | Give | Smr Ter Apr SxTr | + | + | − | + | + | aadA1, dfrA1- aadA1 | + | − | + |
| 27/4 | Chicken | Hadar | Smr Ter Apr Cfr | + | + | − | + | − | − | − | − | − |
| 27/9* | Chicken | Hadar | Smr Ter Apr Amcr Cfr | − | − | − | − | − | − | − | − | − |
| 27/11 | Chicken | Hadar | Smr Ter Apr Amcr Cfr | + | + | − | + | + | − | − | − | − |
| 27/17* | Chicken | Hadar | Smr Ter Apr Amcr Cfr | + | + | − | + | + | − | − | − | − |
| 27/19 | Chicken | Hadar | Smr Ter Apr Amcr | + | + | − | + | + | − | − | − | − |
| 17/16* | Duck | Hadar | Smr Ter Apr Amcr Kmr Nmr Cfr | + | + | − | + | + | − | − | − | − |
| 17/36 | Chicken | Hadar | Smr Ter Apr Nar Cfr Enr | + | + | − | + | + | − | − | − | − |
| 17/37 | Chicken | Hadar | Smr Ter Apr Nar Cfr Enr | + | + | − | + | + | − | − | + | − |
| 17/2* | Duck | Hadar | Smr Ter Apr Amcr Nar Cfr Enr | − | − | − | + | − | − | − | − | − |
| 17/35 | Chicken | Hadar | Smr Ter Apr Amcr Nar Cfr Enr | + | + | − | + | + | − | − | − | − |
| 17/15 | Chicken | Hadar | Smr Ter Apr Amcr Nar Kmr Cfr Enr | + | + | − | + | + | − | − | − | − |
| 17/9 | Duck | Hadar | Smr Ter Apr SxTr Nmr | + | + | − | + | + | − | − | − | − |
| 17/1* | Turkey | Heidelberg | Smr Ter Apr Amcr Gmr Kmr Nar Nmr Cfr Enr | + | + | − | + | + | − | − | + | − |
| 17/4 | Turkey | Heidelberg | Smr Ter Apr Amcr Nar | + | + | − | + | − | − | − | + | − |
| 17/19* | Food | Heidelberg | Smr Ter Apr Sur Nar Gmr Kmr Cfr | + | + | − | + | + | aadA1 | + | + | − |
| 17/29 | Swine meat | Heidelberg | Smr Ter Apr SxTr Cfr | + | + | − | − | − | − | − | + | − |
| 17/32* | Turkey | Heidelberg | Smr Ter Sur Kmr Nar Gmr | − | − | − | + | − | aadB-aadA2 | + | − | + |
| 17/6 | Swine | Heidelberg | Smr Ter SxTr Gmr Kmr Cmr Nmr | + | + | + | − | − | dfrA1-aadA1 | + | − | − |
| 17/23* | Chicken | Infantis | Smr Ter Sur Nar Enr | + | + | − | − | − | aadA1 | − | − | + |
| 27/24 | Minced meat | Kisii | Smr Ter Apr Kmr | − | − | − | − | − | − | − | − | − |
| 27/12 | Chicken | Livingstone | Smr Ter Nar Cfr | − | − | − | − | − | − | − | − | − |
| 17/40 | Chicken | London | Smr Ter Apr Amcr Sur Nar Cfr Enr | + | + | − | + | + | − | − | − | − |
| 17/31* | Swine | London | Smr Ter Sur | +d | − | − | + | − | − | − | − | − |
| 27/22* | Pork sausage | Panama | Smr Ter Apr Amcr Gmr Cmr Clr Cfr | − | − | − | − | − | − | − | − | − |
| 17/25* | Turkey | Saintpaul | Smr Ter Apr Amcr Sur Gmr Kmr Nar Nmr Cfr | − | − | − | + | − | aadB-aadA2 | − | − | + |
| 17/27* | Turkey | Saintpaul | Smr Ter Apr Amcr Sur Gmr Kmr Nar Nmr Cfr | − | − | − | + | − | aadB-aadA2 | − | − | − |
| 17/21* | Turkey | Saintpaul | Smr Ter Apr Amcr SxTr Gmr Kmr Nar Nmr Cfr Enr | − | − | − | + | − | aadB-aadA2 | − | − | − |
| 17/13 | Chicken | Senftenberg | Smr Apr Amcr SxTr Ctxr Clr Cfr | − | − | − | + | − | − | − | − | − |
| 17/26* | Chicken | Senftenberg | Smr Ter Apr Amcr SxTr Nar Cpr Cfr Enr | + | + | − | + | − | − | − | + | − |
| 27/18 | Chicken | Tshiongwe | Smr Ter Apr Amcr | + | + | − | + | + | − | − | − | − |
| 27/2 | Pork sausage | Typhimurium | Smr Ter Apr Amcr Gmr Cmr Clr Cfr | − | − | − | − | − | aadA1 | + | − | − |
| 27/21 | Swine | Typhimurium | Smr Ter Apr Gmr Cmr | + | + | − | + | − | − | + | − | − |
| 27/6 | Swine | Typhimurium | Smr Ter Apr SxTr Cfr | + | + | − | + | − | − | − | − | − |
| 27/13 | Pork sausage | Typhimurium | Smr Ter SxTr | − | − | − | + | − | − | − | − | − |
| 17/12* | Hen egg | Virchow | Ter Sur Kmr Nar Nmr Enr | − | − | − | − | − | − | − | − | − |
Strains with asterisks were chosen for conjugation experiments.
AP, ampicillin; Amc, amoxicillin-clavulanic acid; Cf, cephalothin; Cl, colistin; Cm, chloramphenicol; Cp, ciprofloxacin; En, enrofloxacin; Sm, streptomycin; Su, sulfonamides; Te, tetracycline; SxT, trimethoprim-sulfamethoxazole; Km, kanamycin; Gm, gentamicin; Na, nalidixic acid; Nm, neomycin; Ctx, cefotaxime. Strains showing both Sur and SxTr phenotypes are reported as SxTr.
Tn1721R and Tn1721L, right and left arms of Tn1721, respectively;. +, present; −, absent.
tet(A)-1 gene variant (12).
Resistance plasmids
Salmonella strains were tested by conjugation with the use of E. coli CSH26RifR as the recipient strain (16). Pellets of overnight broth cultures of the donor and recipient strains were mixed at a ratio of 1:4 and incubated for 6 h at 37°C in nutrient agar. Transconjugants were cultured by plating bacteria on Luria-Bertani agar plates containing rifampin (100 μg/ml) along with streptomycin (30 μg/ml), tetracycline (30 μg/ml), or ampicillin (50 μg/ml). Transconjugant colonies were further purified by plating on selective agar media and tested for antimicrobial resistance patterns.
PCR amplification
Standard PCR amplifications were performed with the primer pairs listed in Table 2 and 2.5 U of Taq DNA polymerase (Roche Diagnostic, Mannheim, Germany) according to the manufacturer's recommendations. The tet(A) gene was searched by using the TAF-TAR, TAF-TetAR3, and TAF-TetAR2 primer pairs (Table 2). Primers TAF and TetAR2 are specific to the tet(A)-1 gene variant described as occurring in the pSSTA-1 plasmid (12). All PCR amplifications consisted of a hot start cycle of 94°C for 5 min, followed by 30 cycles of a denaturation step at 94°C for 30 s, an annealing step at various temperatures for 1 min, and a polymerization step at 72°C for 1 min.
TABLE 2.
Primers used in PCR amplification and DNA sequencing
| Primer | DNA sequence (5′ to 3′) | Target gene(s) | Nucleotide positions | EMBL accession no. | Amplicon size (bp) | Reference |
|---|---|---|---|---|---|---|
| TAF | GTAATTCTGAGCACTGTCGC | tet(A) | 6718-6737 | X61367 | 33 | |
| TAR | CTGCCTGGACAACATTGCTT | tet(A) | 7674-7655 | X61367 | 956 | 33 |
| TetAR3 | GGCATAGGCCTATCGTTTCCA | tet(A) of Tn1721 | 7917-7897 | X61367 | 1,199 | 12 |
| TetAR2 | GTGCAACGGGAATTTGAAG | tet(A)-1 in pSSTA-1 | 2255-2237 | AF502943 | 1,168 | 12 |
| SAF | AGCAGAGCGCGCCTTCGCTG | strA of RSF1010 | 761-780 | NC_001740 | 4 | |
| SBR | CCAAAGCCCACTTCACCGAC | strB of RSF1010 | 1464-1445 | NC_001740 | 703 | 4 |
| LAF | GTTCGGGTCAGCAGCTTTGAC | Left arm of Tn1721 (tnpR) | 2101-2121 | X61367 | This study | |
| LAR | GAGGGTTTCCCGGCTGATGT | Left arm of Tn1721 (tnpR) | 2591-2610 | X61367 | 509 | This study |
| 5′ CS | GGCATCCAAGCAGCAAG | Integron variable region | 1190-1206 | M73819 | Varied | 15 |
| 3′ CS | AAGCAGACTTGACCTGA | Integron variable region | 1342-1326 | M73819 | 15 | |
| TnpMF | TCAACCTGACGGCGGCGA | tnpM of Tn21 | 3689-3706 | AF071413 | 348 | 32 |
| TnpMR | GGAGGTGGTAGCCGAGG | tnpM of Tn21 | 4037-4021 | AF071413 | 32 | |
| N1 | AGTTCACCACCTACTCGCTCCG | IncN repA | 32164-32185 | AY046276 | 163 | 11 |
| N2 | CAAGTTCTTCTGTTGGGATTCCG | IncN repA | 32327-32305 | AY046276 | 11 | |
| 11 | CGGGACAGGATGTGCAA | IncI oriT | 66951-66967 | AP005147 | 97 | This study |
| 12 | ACTTCAGGCTCCTTACGGG | IncI oriT | 67048-67031 | AP005147 | This study | |
| IS1133F | GATTGGCTGGGCAACAGGTGA | tnpA of IS1133 | 4465-4486 | M95402 | 715 | This study |
| smAR | TCCTCCTGCCAGTTGATCAC | strA of Tn5393 | 5180-5161 | M95402 | This study | |
| 17/1Fa | GCCCACTGGGACGACATCC | ΔtnpA of Tn1721 | 10570-10588 | X61367 | This study | |
| 17/1Ra | CGATCCCCAATACATTGAATA | strA of RF1010 | 804-784 | NC_001740 | This study | |
| smBFa | GCGGCCGCGATCAAGCAGGT | strB of Tn5393 | 6561-6580 | M95402 | This study |
Primer used for DNA sequencing.
Replicon typing by PCR was performed for the repN and repI1 replicons by using the N1-N2 and I1-I2 primer pairs, respectively (Table 2).
The possibility of the presence of class 1 integrons was investigated by PCR amplification with the 5′CS and 3′CS primers as previously described (Table 2) (14). 5′CS-3′CS amplicons were purified with a PCR purification kit (QIAGEN, Milan, Italy) and sequenced by the dideoxy chain termination method with external primers. Plasmid DNA from the 17/1 and 17/19 strains were prepared with a Concert high-purity plasmid kit (Life Technologies, Milan, Italy) and directly sequenced by using primers 17/1F, 17/1R, smBF, and smAR (Table 2). DNA sequences were determined by using fluorescent-dye-labeled dideoxynucleotides and a model 373 automatic DNA sequencer (Perkin-Elmer, Foster City, Calif.).
Comparative analysis of nucleotide sequences was performed by using the advanced BLAST search program, version 2.0, within the QBLAST system at the National Center for Biotechnology Information site (www.ncbi.nlm.nih.gov/blast/).
RESULTS
Streptomycin and tetracycline resistance genes and transposons
Fifty-eight multidrug-resistant S. enterica strains were analyzed for the presence of genetic determinants conferring streptomycin and tetracycline resistance. Thirty-six strains were obtained from the IZSVE collection (Table 1, strains beginning with “17”), and 22 strains were obtained from the IZSAM collection (Table 1, strains beginning with “27”). Twenty different serotypes were represented in the resulting collection. The serotypes occurring most frequently were Hadar (20.7%), Blockley (10.3%), Heidelberg (10.3%), Derby (8.6%), and Typhimurium (7.0%) (Table 1). Salmonella serotype Typhimurium DT104 was not included in the collection.
All strains showed resistance to at least three different antimicrobials; 98 and 95% of the strains were resistant to tetracycline and streptomycin, respectively. The prevalent (60%) resistance pattern in the collection was Smr Ter Amr (Table 1).
Strains were analyzed by PCR amplification for the presence of tet(A) and strA-strB.
Of the tetracycline-resistant strains, 68% tested positive for the tet(A) gene, indicating that this gene is widely diffused in Salmonella strains circulating in animals in both northern and southern Italy (Table 1). Thirty-seven of 39 tet(A) genes were found to be located within the Tn1721 transposon by PCR with primers TAF and TetAR3 (12) (Table 2). Since a Tn1721 deleted version (ΔTn1721) has been described previously (9), a different primer pair (LAF-LAR [Table 2]) was used to identify the left arm of the transposon. Only four strains were positive by this PCR assay, indicating that the deletion of the Tn1721 transposon was found widely among the Salmonella strains of our collection (Table 1). Only two tet(A)-positive strains (isolates 17/31 and 27/27) were negative for Tn1721. One of them, an S. enterica London strain (isolate 17/31), carried the tet(A)-1 gene variant, previously described to occur only on the Shigella spp. pSSTA-1 plasmid (12).
The strA and strB genes were also highly prevalent in Salmonella strains of our collection, being detected in 46 of 55 (84%) streptomycin-resistant strains.
Streptomycin resistance genes were also detected as cassette-borne genes within class 1 integrons. Seventeen (29%) strains were positive for integrons (Table 1). Six different integrons carrying one or a combination of two of the gene cassettes dfrA12 and dfrA1 (conferring resistance to trimethoprim) and aadA1, aadA2, and aadB (conferring aminoglycoside resistance) were observed. Twelve of the 17 integron-positive strains were positive for Tn21 by PCR amplification with primers designed for the tnpM gene in the left arm of Tn21 (Table 2).
Resistance plasmids
To better characterize strA-strB and tet(A), conjugation experiments were performed on 27 of 58 isolates from our collection (selected strains are indicated in Table 1). These strains represented 15 different serotypes and included integron-, strA-strB-, and tet(A)-positive and -negative strains. Nine (33%) transconjugants were obtained, and their features are shown in Table 3.
TABLE 3.
Characteristics of transconjugants
| Strain | Resistancea | Trans- conjugant | Transferred resistance(s)a | Assay result forb:
|
||||
|---|---|---|---|---|---|---|---|---|
| Transferred strA-strB | Transferred tet(A) | Transferred integron | repN | repI | ||||
| 27/28 | Smr Ter Apr SxTr Gmr Kmr | T27/28 | Smr Ter Apr SxTr | + | + | dfrA1-aadA1 | + | + |
| 17/25 | Smr Ter Apr Amcr Sur Gmr Kmr Nar Nmr Cfr | T17/25 | Smr Ter Apr Sur Gmr Kmr Nmr | − | − | aadB-aadA2 | − | + |
| 17/32 | Smr Ter Sur Gmr Kmr Nar | T17/32 | Smr Sur Gmr Kmr | + | − | aadB-aadA2 | − | + |
| 27/30 | Smr Ter Apr SxTr | T27/30 | Smr SxTr | + | − | dfrA1-aadA1 | − | + |
| 17/1 | Smr Ter Apr Amcr Gmr Kmr Nar Nmr Cfr Enr | T17/1 | Smr Ter Apr Gmr Kmr Nmr | + | + | − | + | − |
| 17/14 | Smr Ter Sur Kmr Nmr | T17/14 | Smr Ter Sur Kmr Nmr | + | − | − | + | − |
| 17/19 | Smr Ter Apr Sur Nar Gmr Kmr Cfr | T17/19 | Smr Ter Apr | + | + | − | + | − |
| 17/22 | Smr Ter SxTr | T17/22 | Smr | + | − | − | − | + |
| 17/31 | Smr Ter Sur | T17/31 | Smr Ter Sur | + | +c | − | − | − |
Plasmid DNA was purified from the transconjugants and analyzed by EcoRI and SalI restriction and Southern blot hybridization (23), using the tet(A) and strA-strB PCR products as probes (data not shown). This analysis revealed the presence of a common plasmid in these strains; the 27/30, 17/32, 17/22, and 17/14 transconjugants carried very similar plasmids, positive by strA-strB hybridization, while strains 17/1 and 17/19 carried a different plasmid, producing a single fragment of ca. 20 kb by EcoRI digestion that was positive by both strA-strB and tet(A) gene hybridization. Strain 27/28 shows the simultaneous presence of the two plasmids observed in the 17/1 and 27/30 strains, respectively. Replicon typing of the resistance plasmids from the 17/1, 17/19, and 27/30 transconjugants was then performed by hybridization with each clone of the inc/rep plasmid bank, specific for the major incompatibility groups, as previously described (7). Plasmids from both the 17/1 and the 17/19 transconjugants were positive for the repN replicon, while a plasmid from the 27/30 transconjugant was positive for the repI1 replicon (data not shown).
Specific replicon PCR assays were then applied for the detection of repN and repI1 replicons. repN typing was accomplished by PCR amplification with the N1-N2 primer pair as previously described (11). repI1 typing was performed with the I1-I2 primer pair, designed on the basis of the origin of replication (oriT) of the P64 plasmid, belonging to incompatibility group I1 (IncI1) (EMBL accession no. AP005147). The specificity of the repI1 PCR was tested by using R144 and JR66a IncI1 as reference plasmids (7) and the TP114 (IncI2), R16 (IncB/O), and R387 (IncK) plasmids as negative controls. All transconjugants and their relative Salmonella donor strains were tested by both repN and repI1 PCR assays. Strains 17/14, 17/1, and 17/19 were repN positive, and strains 17/25, 17/32, 17/22, and 27/30 were repI1 positive (Table 3). The simultaneous presence of two plasmids in the 27/28 transconjugant was confirmed, as this transconjugant tested positive in both the repN and the repI1 PCR assays. The 17/31 transconjugant was negative for the two replicon systems tested (Table 3).
The repN and repI PCR assays were then performed with total DNA extracted from all of the Salmonella strains in our collection. It was interesting that repN and repI1 replicons were identified in 15 and 7 Salmonella strains from our collection, respectively (Table 1). In particular, five of six S. enterica serotype Blockley strains and four of six serotype Heidelberg strains carried repN-positive plasmids, suggesting the frequent presence of this kind of plasmid in these Salmonella serotypes (Table 1).
The geographical distribution of the plasmids revealed that most (18 of 22) of the repN- and repI1-positive strains were from the IZSVE, suggesting that these plasmids were largely distributed in Salmonella strains from northern Italy.
It is interesting that all of the repI1-positive strains were also integron positive but that the repN-positive strains were not associated with the presence of integrons (the integron found in strain 17/19 was not transferred by conjugation with the repN plasmid [Table 3]).
Characterization of the repN plasmid
Since the repN replicons, diffused in the isolates of our collection, were difficult to analyze by restriction fragment length polymorphism analysis, plasmids purified from the 17/1 and 17/19 transconjugants were further analyzed by DNA sequencing of regions flanking strA-strB and tet(A). The results of this analysis confirmed the presence of the ΔTn1721 plasmid in both the 17/1 and the 17/19 strains and demonstrated that strA-strB was located within a particular Tn5393-derived transposon, previously identified only in the plant pathogen Erwinia amylovora (97% homology to the DNA sequence released under EMBL accession no. M95402). In this transposon variant, the strA gene is located adjacent to the insertion sequence IS1133 (24). A PCR assay specific for the detection of the strA gene linked to the IS1133 element was then used to identify the prevalence of this resistance determinant in the isolates from our collection (Table 2, primers IS1133F and smAR). Sixteen strains were positive for the Tn5393-IS1133::strA-strB transposon, but only four strains (strains 17/1, 17/19, 17/37, and 27/28) carried a repN plasmid; furthermore, most of the strains carrying this element were also negative in the repI1 PCR assay.
The Tn5393-IS1133::strA-strB transposon was found in Salmonella strains of different serotypes, including serotypes Hadar, Agona, Bredeney, Give, Heidelberg, London, and Tshiongwe (Table 1).
DISCUSSION
A wide diffusion of the strA-strB and tet(A) resistance genes was observed in epidemiologically unrelated Salmonella strains of animal origin isolated in Italy.
Most of the tet(A) genes were located within the truncated version of transposon Tn1721. This variant was previously described to occur in two isolates of Salmonella choleraesuis and S. enterica serotype Typhimurium variant Copenhagen isolated from animals in Germany (9, 10). Many strains also carried integrons encoding resistance to trimethoprim, kanamycin, sulfonamides, and streptomycin, with most of these integrons being associated with the Tn21 transposon. Recurrent repN- and repI1-positive plasmids were identified in Salmonella strains of different serotypes isolated from distant geographical areas.
The strA-strB gene pair has previously been described for bacteria isolated from humans and animals. These genes are often located on small broad-host-range nonconjugative plasmids, such as RSF1010 and pBP1, while in isolates of vegetable origin they are carried on large conjugative plasmids characterized by the presence of transposon Tn5393 (24, 25, 26, 27, 29). In the Tn5393 transposon, the strA and strB genes are located downstream of the tnpA (transposase) and tnpR (resolvase) genes. This transposon has been described to occur in the apple tree pathogen E. amylovora; in Aeromonas salmonicida, a fish pathogen bacterium, in Norway (13); in Campylobacter jejuni and Pseudomonas aeruginosa (24); and in a multiresistance plasmid, pTP10, from Corynebacterium striatum (30). It is important to note that the two Tn5393 variants containing the insertion sequences IS1133 and IS6100 were described for the plant pathogens E. amylovora and Xanthomonas campestris, respectively (26). The insertion of these IS elements within the transposon has the consequence of increasing the expression of the strA and strB genes (29). In particular, the IS1133 variant was previously described only for E. amylovora strains from plant sources. Our findings demonstrate the presence of the IS1133 variant in several Salmonella strains of animal origin. Most of the strains carrying the Tn5393::IS1133 element were from poultry sources (chicken, duck, and turkey). This genetic determinant was localized on repN- and repI1-positive plasmids, but it was also detected in several strains that did not transfer the resistance by conjugation, suggesting a chromosomal localization of the transposon. To our knowledge, this is the first time that this resistance determinant has been identified in Salmonella isolates. The identification of the Tn5393::IS1133 element in Salmonella isolates suggests novel scenarios of resistance transmission among zoonotic and plant pathogens; it may be hypothesized that Salmonella imported this genetic element from plant pathogens, probably through the contamination of animal feeds.
Since tetracycline and streptomycin are among the most used antimicrobials in veterinary medicine in the European Union (European Federation for Animal Health data, available at http://www.fedesa.be/Europe/Topics/antibio/Kit3.htm), the extensive use of such drugs may have contributed to the successful spread of these genetic determinants in zoonotic pathogens.
Acknowledgments
We are grateful to Laura Villa for helpful discussion and her critical reading of the manuscript. We thank Alessia Bertini for replicon typing and Fabio Riccobono for DNA sequencing.
This work was supported by grants from the Istituto Superiore di Sanità (article 502, project no. 1012/RI; article 524, project no. 2012/RI) and from the Italian Ministry of Health (Ricerca Corrente 2000).
REFERENCES
- 1.Allmeier, H., B. Cresnar, M. Greck, and R. Schmitt. 1992. Complete nucleotide sequence of Tn1721: gene organization and a novel gene product with features of a chemotaxis protein. Gene 111:11-20. [DOI] [PubMed] [Google Scholar]
- 2.Anderson, E. S., L. R. Ward, M. J. de Saxe, and J. D. H. de Sa. 1977. Bacteriophage-typing designations of Salmonella typhimurium. J. Hyg. Camb. 78:297-300. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Boyd, D., G. A. Peters, A. Cloeckaert, K. S. Boumedine, E. Chaslus-Dancla, H. Imberechts, and M. R. Mulvey. 2001. Complete nucleotide sequence of a 43-kilobase genomic island associated with the multidrug resistance region of Salmonella enterica serovar Typhimurium DT104 and its identification in phage type DT120 and serovar Agona. J. Bacteriol. 183:5725-5732. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Carattoli, A., E. Filetici, L. Villa, A. M. Dionisi, A. Ricci, and I. Luzzi. 2002. Antibiotic resistance genes and Salmonella genomic island 1 in Salmonella enterica serovar Typhimurium isolated in Italy. Antimicrob. Agents Chemother. 46:2821-2828. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Chopra, I., and M. Roberts. 2001. Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol. Mol. Biol. Rev. 65:232-260. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Cloeckaert, A., and S. Schwarz. 2001. Molecular characterization, spread and evolution of multidrug resistance in Salmonella enterica Typhimurium DT104. Vet. Res. 32:301-310. [DOI] [PubMed] [Google Scholar]
- 7.Couturier, M., F. Bex, P. L. Bergquist, and W. K. Maas. 1988. Identification and classification of bacterial plasmids. Microbiol. Rev. 52:375-395. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Frech, G., and S. Schwarz. 1998. Tetracycline resistance in Salmonella enterica subsp. enterica serovar Dublin. Antimicrob. Agents Chemother. 42:1288-1289. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Frech, G., and S. Schwarz. 1999. Plasmid-encoded tetracycline resistance in Salmonella enterica subsp. enterica serovars choleraesuis and typhimurium: identification of complete and truncated Tn1721 elements. FEMS Microbiol. Lett. 176:97-103. [DOI] [PubMed] [Google Scholar]
- 10.Frech, G., and S. Schwarz. 2000. Molecular analysis of tetracycline resistance in Salmonella enterica subsp. enterica serovars Typhimurium, Enteritidis, Dublin, Cholerasuis, Hadar and Saintpaul: construction and application of specific gene probes. J. Appl. Microbiol. 89:633-641. [DOI] [PubMed] [Google Scholar]
- 11.Götz, A., R. Pukall, E. Smit, E. Tietze, R. Prager, H. Tschäpe, J. D. van Elsas, and K. Smalla. 1996. Detection and characterization of broad-host-range plasmids in environmental bacteria by PCR. Appl. Environ. Microbiol. 62:2621-2628. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Hartman, A. B., I. I. Essiet, D. W. Isenbarger, and L. E. Lindler. 2003. Epidemiology of tetracycline resistance determinants in Shigella spp. and enteroinvasive Escherichia coli: characterization and dissemination of tet(A)-1. J. Clin. Microbiol. 41:1023-1032. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.L'Abee-Lund, T. M., and H. Sørum. 2000. Functional Tn5393-like transposon in the R plasmid pRAS2 from the fish pathogen Aeromonas salmonicida subspecies salmonicida isolated in Norway. Appl. Environ. Microbiol. 66:5533-5535. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Lévesque, C., L. Piché, C. Larose, and P. Roy. 1995. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob. Agents Chemother. 39:185-191. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Liebert, C. A., R. M. Hall, and A. O. Summers. 1999. Transposon Tn21, flagship of the floating genome. Microbiol. Mol. Biol. Rev. 63:507-522. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Maimone, F., B. Colonna, P. Bazzicalupo, B. Oliva, M. Nicoletti, and M. Casalino. 1979. Plasmids and transposable elements involved in Salmonella wien. J. Bacteriol. 139:369-375. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.McManus, P. S., V. O. Stockwell, G. W. Sundin, and A. L. Jones. 2002. Antibiotic use in plant agriculture. Annu. Rev. Phytopathol. 40:443-465. [DOI] [PubMed] [Google Scholar]
- 18.Miranda, C. D., C. Kehrenberg, C. Ulep, S. Schwarz, and M. C. Roberts. 2003. Diversity of tetracycline resistance genes in bacteria from Chilean salmon farms. Antimicrob. Agents Chemother. 47:883-888. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.National Committee for Clinical Laboratory Standards. 2002. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals, 2nd ed. Approved standard M31-A2. National Committee for Clinical Laboratory Standards, Wayne, Pa.
- 20.National Committee for Clinical Laboratory Standards. 2003. Performance standards for antimicrobial disk susceptibility tests, 8th ed. Approved standard M2-A8. National Committee for Clinical Laboratory Standards, Wayne, Pa.
- 21.Roberts, M. C. 1996. Tetracycline resistance determinants: mechanism of action, regulation of expression, genetic mobility, and distribution. FEMS Microbiol. Rev. 19:1-24. [DOI] [PubMed] [Google Scholar]
- 22.Shaw, K. J., P. N. Rather, R. S. Hare, and G. H. Miller. 1993. Molecular genetics of aminoglycoside resistance genes and familial relationships of the aminoglycoside-modifying enzymes. Microbiol. Rev. 57:138-163. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Southern, E. M. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. Mol. Biol. 98:503-517. [DOI] [PubMed] [Google Scholar]
- 24.Sundin, G. W. 2000. Examination of base pair variants of the strA-strB streptomycin resistance genes from bacterial pathogens of humans, animals and plants. J. Antimicrob. Chemother. 46:848-849. [DOI] [PubMed] [Google Scholar]
- 25.Sundin, G. W. 2002. Distinct recent lineages of the strA-strB streptomycin-resistance genes in clinical and environmental bacteria. Curr. Microbiol. 45:63-69. [DOI] [PubMed] [Google Scholar]
- 26.Sundin, G. W., and C. L. Bender. 1995. Expression of the strA-strB streptomycin-resistance genes in Pseudomonas syringae and Xanthomonas campestris and characterization of IS6100 in X. campestris. Appl. Environ. Microbiol. 61:2891-2897. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Sundin, G. W., and C. L. Bender. 1996. Dissemination of the strA-strB streptomycin-resistance genes among commensal and pathogenic bacteria from humans, animals and plants. Mol. Ecol. 5:133-143. [DOI] [PubMed] [Google Scholar]
- 28.Sundin, G. W., and C. L. Bender. 1996. Molecular genetics and ecology of transposon-encoded streptomycin resistance in plant pathogenic bacteria. ACS Symp. Ser. 645:198-208. [Google Scholar]
- 29.Sundin, G. W., D. E. Monks, and C. L. Bender. 1995. Distribution of the streptomycin-resistance transposon Tn5393 among philloplane and soil bacteria from managed agricultural habitats. Can. J. Microbiol. 41:792-799. [DOI] [PubMed] [Google Scholar]
- 30.Tauch, A., S. Krieft, J. Kalinowski, and A. Pulher. 2000. The 51,409-bp R-plasmid pTP10 from the multiresistent clinical isolate Corynebacterium striatum M82B is composed of DNA segments initially identified in soil bacteria and in plant, animal, and human pathogens. Mol. Gen. Genet. 263:1-11. [DOI] [PubMed] [Google Scholar]
- 31.Threlfall, E. J. 2002. Antimicrobial drug resistance in Salmonella: problems and perspectives in food- and water-borne infection. FEMS Microbiol. Rev. 26:141-148. [DOI] [PubMed] [Google Scholar]
- 32.Villa, L., P. Visca, F. Tosini, C. Pezzella, and A. Carattoli. 2002. Composite integron array generated by insertion of an ORF341-type integron within a Tn21-like element. Microb. Drug Resist. 8:1-7. [DOI] [PubMed] [Google Scholar]
- 33.Waters, S. H. P., P. Rogowsky, J. Grinsted, J. Altenbuchner, and R. Schmitt. 1983. The tetracycline resistance determinants of RP1 and Tn1721: nucleotide sequence analysis. Nucleic Acids Res. 11:6089-6105. [DOI] [PMC free article] [PubMed] [Google Scholar]