Skip to main content
Bioinformation logoLink to Bioinformation
. 2012 Dec 19;8(25):1271–1276. doi: 10.6026/97320630081271

Genetic relationship of Sardinella lemuru from lombok strait with fish rich in omega-3 fatty acid

Mahrus 1,4, Sutiman Bambang Sumitro 2, Didik Huswo Utomo 2, Aida Sartimbul 3, Abdul Hamid Toha 2,5, Nashi Widodo 2,*
PMCID: PMC3532013  PMID: 23275733

Abstract

Lombok Strait has abundance of Sardine, Sardinella lemuru, which contains such high amount of omega-3 fatty acid (omega-3). However, the genetic relationship of S. lemuru with other commercial fish rich in omega-3 has not been widely studied yet. Studies on genetic proximity of S. lemuru with the other marine fish using 12S rRNA gene is very important in order to obtain genetic information of the Sardine to develop an appropriate strategy for future conservation of the fish in Lombok Strait. The aim of this study was to find out the genetic relationship of Sardinella lemuru living in Lombok Strait with the economically valuable fish and its correlation with omega-3 production. Sardinella lemuru were collected from Lombok Strait, the phylogenetic tree was done based on 12S rRNA gene through a neighbor-joining method to identify the relationship of Sardines and fish rich in omega-3 fatty acid. The phylogenetic tree showed that Sardinella lemuru is similar to Sardinella aurita and has a close similarity with Sardinella maderensis. However, the relationship did not correspond to omega-3 production. Based on the results of the study, it is suggested that the production of omega-3 is not specifically based on the proximity of the species, but it is more associated with conserved domain of Δ6-desaturase. Nevertheless, detailed mechanisms still need to be elucidated.

Keywords: Δ6 desaturase, conserved domains, Sardinella lemuru, omega-3, Lombok Strait

Background

Omega-3 functions in preventing coronary heart disease, diabetes, cancer, and also plays an important role in the nervous system, brain and eyes [1–3]. The main and the best source of omega-3 food is marine fish [4], i.e. Sardinella lemuru that is abundant in Indonesia. Lombok Strait has a variety of Sardinella lemuru rich in omega-3 fatty acid. It is indicated that Lombok Strait is very fertile and is appropriate for S. lemuru to live and breed. However, the genetic kinship of S. lemuru with other marine fish rich in omega-3 has not been widely studied yet. Therefore, we analyzed the genetic relationship of Sardinella lemuru from the srait with the economically valuable fish using 12S rRNA gene. The research provided basic information on genetic proximity of S. lemuru with other marine fish, and the information is considered very important for future conservation of main sources of omega-3 in Lombok Strait.

Production levels of omega-3 in various marine fish species are different. Some research reports explained that omega-3 content on fish was affected by the food consumed by the fish [2, 3], the genetic factors, and the environmental characteristics [5]. The other studies reported that the concentration of omega-3 in fish is determined by the activity of groups of desaturase and elongase enzymes [6–12]. A desaturase is a group of enzyme which removes two hydrogen atoms from an organic compound, creating carbon double bonds [13]. The desaturase enzyme is known to be involved in synthesizing of omega-3 [14], the Δ5 and Δ6-desaturases (D5D and D6D) are encoded by fatty acid desaturase 1 (FADS1) and 2 (FADS2) genes, respectively; and they are key enzymes in the metabolism of omega-3 fatty acids.

The Δ6-desaturase (D6D) has an important role in the synthesis of poly unsaturated fatty acids (PUFAs), including omega-3, in microorganisms and also in higher animals [15]. A previous study reported that a factor which determines the activity of enzyme to synthesize omega-3 is in the active site [16]. The active site usually lies within a domain that shows a high degree of similarity among protein families or groups [17]. Hence, conserve domain containing active site of Δ6-desaturase might have an important role in biosynthesis of omega-3. Furthermore, we examine the correlation between either genetic proximity or Δ6-desaturase conserved domain with omega-3 productions on economically valuable fish.

Methodology

Sardinella lemuru was collected from Lombok Strait. DNA isolation and other analyses were conducted at Molecular Biology, and Bioinformatics Laboratories, Faculty of Sciences, Brawijaya University, from January to September 2012.

DNA Isolation and Sequencing:

DNA was isolated using DNeasy Blood & Tissue Kit (Qiagene). The DNA was used as a template to amplify 12S rRNA gene by using a pair of primers, the 5´GCTTGGTCCTGACTTTAGTA as a forward primer and 5´CTTACCATGTTACGACTTGC as a reverse primer. PCR composition consisted of sterile water 2µl, 5µl PCR mix, 1µl forward primer, 1µl reverse primer, and 1µl DNA samples. The PCR condition was denaturation at 94° C for 1 minute, then 35 cycles of denaturation at 94° C for 1 minute, annealing at 54° C for 30 seconds, and extension at 72° C for 1 minute. The last extension was performed at 72° C for 10 minutes, and followed by sequencing (First Base, Singapore).

Phylogenetics Construction:

The phylogenetic trees were constructed based on 12S rDNA and sequences of Δ6-desaturase. The nucleutide sequence of 12S rRNA of S. lemuru was obtained by sequencing and other sequences were obtained from GeneBank (www.ncbi.nm.nih.gov). The whole amino acid sequences of Δ6-desaturase were retrieved from GeneBank (www.ncbi.nm.nih.gov). The alignments were done separately for 12S rRNA gene and sequences of Δ6-desaturase. The alignment processes were performed through Clustal-W using MEGA5.05 software, and then followed by construction of phylogenetic trees through a neighbor-joining method.

Conserved Domain Analysis:

The conserved domains of Δ6-desaturase from 11 kinds of fish were identified by using Conserved Domain Databases (CDD) search. CDD is a software to annotate Conserved Domains within a protein sequence based on a sequence homology with conserved domain database in GeneBank (www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) [18].

Construction of 3D Model of Δ6-desaturase:

The tertiary structure of Δ6-desaturase protein from the 11 fish were not available yet in the protein databases, then the 3D structures were predicted by threading modeling provided by ITASSER [19]. The 3D models were aligned to determine structure differences among the proteins. The 3D aligment were done by a super impose method using PyMol software.

Results

We have utilized 12S rDNA sequences to analyze the phylogenetic relationships among the marine fish that were considered economically important or contained high amount of omega-3. The phylogenetic tree showed that Sardinella lemuru is similar to Sardinella aurita and has a close similarity with Sardinella maderensis. The Sardinella is more closely related to Salmon and Oncorhypchus than to other species (Figure 1). The data indicated that S. lemuru shares genetic similarities with S. aurita, and the two probably belong to the same species. Moreover, all of the species were clustered into three groups that did not correspond to omega-3 content. Thunnus has an ability to produce high amount of omega-3 and so does Sardinella. However, Thunnus were clustered with Siganus, which has low content of omega-3. The productions level of omega-3 among the 12 economically important marine fish were different, ranged from 1.9% to 32.9%. The difference in omega-3 contents are caused by multifactor i.e. food, species, genetic, climate, enzyme activity, geography and environmental characteristics [1, 2, 20]. Because the concentration of omega-3 is determined by different kind of factors, we just took the minimum levels of omega-3 for each species to eliminate bias from those factors in order to analyze the relationship between genetic kinship with omega-3 concentration levels (Tabel 1). The minimum level of omega-3 production for Tunnus and Sardinella were over than 20% of their tissue. The data indicated that among the species, Tunnus and Sardinella contained the higest amount of omega-3 that warrant them as a main source of omega-3 from marine environment.

Figure 1.

Figure 1

Phylogenetic tree of marine fish by using 12S rRNA gene. The S. lemuru from Lombok Strait has some similarities with S. aurita and is closely related to S. maderensis.

Discussion

The similarity in 12S rRNA gene between S. lemuru with S. aurita indicated that the two kinds of fish might still belong to the same species; since the polymorphism only occurs in 3 bases along 575 of the gene (Figure 2). Both of the fish share similar genetic factors, characteristics, behaviors and suceptibility to some certain environment factors. The genetic similarity of the two kinds of fish would allow for cross-breeding, that will improve the genetic diversity of Sardinella. This information is very beneficial in order to rectify the genetic quality of Sardinella and especially to promote a strategy to conserve S. lemuru in Lombok Strait. Even though the morphology varity of S. lemuru in Bali Strait is diverse, it does not reflect such a high genetic variation. Furthermore, the data on genetic diversity of S. lemuru in Lombok Strait is needed to be elucidated to portrait its genetic variation.

Figure 2.

Figure 2

Homology 12S rRNA gene between S. aurita and S. lemuru. The polymorphism accours only in 3 bases along 575 bases of the gene. Squence numbering accordings to S. aurita 12S rRNA gene (DQ912032.1)

The relationship based on 12S rRNA gene among the fish did not correspond with omega-3 productions. Therefore, we analyzed the relationship between omega-3 production with the conserved domain of Δ6-desaturase among the fish. The results showed that the similarities in the coserved domains were clustered into 6 groups associated with omega-3 content (Figure 3). According to the phylogenetic tree of Δ6-desaturase, Thunnus thynnus and Salmo salar has a closed similarity, which corresponded to their omega-3 production level. Hence, the genetic distance between Thunnus thynnus and Salmo salar was far, based on 12S rRNA gene (species relationship). Based on the results, we suggest that the production of omega-3 is not specified based on the proximity of the species, but is associated with conserved domain of Δ6-desaturase. The phenomenon indicated that activity of Δ6-desaturase is very influential on fish ability to produce omega-3.

Figure 3.

Figure 3

Phylogenetic tree of marine fish by using Δ6-desaturase protein. The fish were clustered into 6 groups associated with omega-3 content. Groups 1-3 contain higher amount of omega-3 (over than 10%) compared to the other three groups. Active sites were indicated by red color.

Generally, the ability of marine fish to synthesize long-chain HUFA, including omega-3 from C18 precursors, is very low. It is caused by the occurrence of various splicing variants of Δ6- desaturase mRNA [21]. The variants caused different activity of Δ6-desaturase to bind with the substrate. The aligment of the conserved domain of Δ6-desaturase from 11 kinds of marine fish species has revealed three conserved sites located at position 180-185; 217-221 and 362-367—these results are similar with the results from the previous report [22]. We also have analyzed the 3D structure of Δ6-desaturase, residues 40-450, which showed that the active site (red color) is located in residues 362-367, that is same in all of the species, although they have different amino acids composition (Figure 3). The 3D model demonstrated that all fish have similar backbones in terms of the enzyme structure, but they are different in their surface. These data suggested that the residues formed conserved structure to maintain their ability to bind with substrates. It corresponds with the previous study showing that binding sites of protein are conserved to maintain competence for binding with ligands/substrates [23].

Therefore, we have classified the fish into 6 groups according to 3D model and motif of active site of Δ6-desaturase, namely: group 1 consists of O. masou, O. mykiss and S. salar (active site, HERHQ); group 2 consists of G. morhua (HEKQQ); group 3 consists of T. thynnus and T. maccoyii (HEKHQ); group 4 consists S. canalicuatus (YENHN); group 5 consists of Rachycentron canadum (HEKHR) and S. maximus(HEKHK); and group 6 consists of D. labrax and S. aurata (HEKHH). Groups 1, 2 and 3 contain higher amount of omega-3 (over than 10%) compared to the other three groups. The variation of the active site and protein surface might be involved in determining the ability of the enzyme to bind and catalyze a substrate. The active site motif indicated to have a relationship with the production of omega-3. The last amino acid of the active site motif might be a crucial factor to support catalytic activity of the enzyme. Sifting from Q to other amino acids might decrease the activity of the enzyme as indicated by the decreasing omega-3 production levels. However, detailed mechanisms are still needed to be elucidated.

Conclusion

Sardinella lemuru from Lombok Strait possesses some similarities with S. aurita. The relationship based on 12S rRNA gene among the fish did not correspond to the omega-3 productions. The similarity found in the coserved domains indicated a relationship with omega-3 content. However, further study is needed to elucidate the mechanism of Δ6- desaturase activity and other parameters that correlated with omega-3 production of marine fish.

Supplementary material

Data 1
97320630081271S1.pdf (16.9KB, pdf)

Acknowledgments

The authors would like to thank the Directorate General of Higher Education, Ministry of Education and Culture of Indonesia for providing the funding to carry out this study. Thanks to Brian Rahardi as the Head of Bioinformatics Laboratory, Biology Department, Brawijaya University, for providing the facilities to conduct this study.

Footnotes

Citation:Mahrus et al, Bioinformation 8(25): 1271-1276 (2012)

References

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Data 1
97320630081271S1.pdf (16.9KB, pdf)

Articles from Bioinformation are provided here courtesy of Biomedical Informatics Publishing Group

RESOURCES