Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Jan 3.
Published in final edited form as: J Med Entomol. 2012 Jul;49(4):843–850. doi: 10.1603/me12038

Identification of Endosymbionts in Ticks by Broad-Range Polymerase Chain Reaction and Electrospray Ionization Mass Spectrometry

MEGAN A ROUNDS 1, CHRISTOPHER D CROWDER 1, HEATHER E MATTHEWS 1, CURTIS A PHILIPSON 1, GLEN A SCOLES 2, DAVID J ECKER 1, STEVEN E SCHUTZER 3, MARK W ESHOO 1,4
PMCID: PMC3535486  NIHMSID: NIHMS429833  PMID: 22897044

Abstract

Many organisms, such as insects, filarial nematodes, and ticks, contain heritable bacterial endosymbionts that are often closely related to transmissible tickborne pathogens. These intracellular bacteria are sometimes unique to the host species, presumably due to isolation and genetic drift. We used a polymerase chain reaction/electrospray ionization-mass spectrometry assay designed to detect a wide range of vectorborne microorganisms to characterize endosymbiont genetic signatures from Amblyomma americanum (L.), Amblyomma maculatum Koch, Dermacentor andersoni Stiles, Dermacentor occidentalis Marx, Dermacentor variabilis (Say), Ixodes scapularis Say, Ixodes pacificus Cooley & Kohls, Ixodes ricinus (L.), and Rhipicephalus sanguineus (Latreille) ticks collected at various sites and of different stages and both sexes. The assay combines the abilities to simultaneously detect pathogens and closely related endosymbionts and to identify tick species via characterization of their respective unique endosymbionts in a single test.

Keywords: endosymbiont, tick, Ixodes, Dermacentor, polymerase chain reaction/electrospray ionization-mass spectrometry

Heritable endosymbiotic bacteria have been identified in such diverse organisms as filarial nematodes (Taylor et al. 2005), sponges (Schmitt et al. 2007), and mollusks (Newton et al. 2007, Kuwahara et al. 2008), but they are perhaps best characterized in arthropods, particularly insects (Moran et al. 2008). In insects, these endosymbionts have been broadly grouped into two classes. The first consists of primary endosymbionts that reside in specialized cells, bacteriocytes, and are necessary for host reproduction (Braendle et al. 2003). Bacteria from the second group are facultative (also called secondary) endosymbionts and not required for host survival, but they may confer benefits to hosts through nutrient production or environmental protection (Haynes et al. 2003). Facultative endosymbionts are unpredictably distributed and are not required for host reproductive fitness (Moran et al. 2008).

The endosymbionts found in ticks (Burgdorfer et al. 1973) are frequently related to pathogenic bacterial species. Often localized to the ovaries and Malpighian tubules (Burgdorfer et al. 1973, Noda et al. 1997), heritable tick endosymbionts are passed to the eggs by transovarial transmission (Niebylski et al. 1997a, Lo et al. 2006, Jasinskas et al. 2007, Klyachko et al. 2007). These endosymbionts have not been found to be transmitted horizontally by tick bites (Niebylski et al. 1997a). The endosymbionts in Amblyomma americanum (L.) confer a fitness advantage to their hosts, possibly by providing them with essential nutrients (Zhong et al. 2007).

In ticks, certain endosymbionts are characteristic for a given species of tick and are found ubiquitously, across all life stages and geographic populations, and therefore may represent primary endosymbionts. For example, Ixodes scapularis Say and Ixodes pacificus Cooley & Kohls each harbor genetically distinguishable Spotted Fever Group Rickettsia endosymbionts (Benson et al. 2004, Moreno et al. 2006, Steiner et al. 2008, Phan et al. 2011). The Ixodes ricinus (L.) endosymbiont Candidatus Midichloria mitochondrii has a unique localization to the mitochondria of I. ricinus ovarian cells (Beninati et al. 2004, Lo et al. 2006, Sassera et al. 2008). Dermacentor ticks (Niebylski et al. 1997a, Sun et al. 2000, Scoles 2004, Goethert and Telford 2005) and Amblyomma maculatum Koch (Scoles 2004) carry Francisella-like endosymbionts, and each species of tick has an endosymbiont with a distinct sequence. Rhipicephalus sanguineus (Latreille) and A. americanum each have unique Coxiella-like endosymbionts (Noda et al. 1997, Jasinskas et al. 2007).

In addition to primary endosymbionts that are found in all ticks of a given species, some endosymbionts have been detected at lower frequencies, are less predictably distributed, and probably represent facultative endosymbionts. For example, Dermacentor andersoni Stiles have been found to harbor Rickettsia peacockii (Niebylski et al. 1997b), in select tick populations and Arsenophonus-type bacteria have been detected in some D. andersoni and Dermacentor variabilis (Say) populations (Grindle et al. 2003, Dergousoff and Chilton 2010). Recent research also has indicated that some R. sanguineus harbor Arsenophonus and Rickettsia endosymbionts (Weller et al. 1998, Clay et al. 2008).

We have used a broad-range polymerase chain reaction (PCR) and electrospray ionization-mass spec-trometry (ESI-MS) technique to study tick endosymbionts. PCR/ESI-MS involves generation of short PCR amplicons, followed by ESI-MS to determine the mass of the amplicon. Based on the amplicon mass, the numbers of each of the four nucleotides in the amplicon, the base composition, can be calculated and compared with a database of base compositions to identify the microorganism. This technique has been used to detect and identify a broad range of vectorborne pathogens to the species level, both singularly and in mixtures. These organisms include species of Anaplasma, Babesia, Bartonella, Borrelia, Coxiella, Ehrlichia, Francisella, Flavivirus, and Rickettsia (Crowder et al. 2010a,b, 2011; Eshoo et al. 2010; Grant-Klein et al. 2010). This same assay also has been used to detect canine heartworm infection (Dirofilaria immitis) by detection of the heartworm-specific bacterial endosymbiont (Crowder et al. 2011).

Because ticks can harbor a wide variety of human pathogens, any screening test must be able to distinguish the pathogens from their closely related endosymbionts. The ability to detect both endosymbionts and pathogens in a single test is important for the identification and confirmation of the vector species based on its endosymbionts. Here, we use this assay to detect and differentiate species-specific tick primary endosymbionts in A. americanum, A. maculatum, D. andersoni, Dermacentor occidentalis Marx, D. variabilis, I. pacificus, I. ricinus, I. scapularis, and R. sanguineus ticks independent of collection site, stage, or sex.

Materials and Methods

Tick Specimens

Ticks were obtained from the Oklahoma State University (OSU) tick-rearing facility (Stillwater, OK) and from field collections in Humboldt County and San Joaquin County, CA; Suffolk County, NY; Fairfield County, CT; Constance, Germany; and South Bohemia, Czech Republic. D. andersoni and D. variabilis ticks were collected at several sites in the northwestern United States (see Table 3). Ticks were collected in the field by flagging or dragging.

Table 3.

Frequency of endosymbiont detection in various tick species

Tick species Endosymbiont Life stage Sexa Sourcea Endosymbiont detection (%)
A. americanum Coxiella-like endosymbiont of A. americanum Adult ND NY 18/24 (75.0)
A. maculatum Francisella endosymbiont of A. maculatum Adult ND LAB 20/20 (100)
D. andersoni Francisella endosymbiont of D. andersoni Adult ND WUS 213/214 (99.5)
D. andersoni Francisella endosymbiont of D. andersoni Adult Female LAB 20/20 (100)
D. andersoni Francisella endosymbiont of D. andersoni Adult Male LAB 20/20 (100)
D. occidentalis Francisella endosymbiont of D. occidentalis Adult ND CA 134/135 (99.3)
D. variabilis Francisella endosymbiont of D. variabilis Adult ND WUS 47/47 (100)
D. variabilis Francisella endosymbiont of D. variabilis Adult Female LAB 20/20 (100)
D. variabilis Francisella endosymbiont of D. variabilis Adult Male LAB 20/20 (100)
I. pacificus Rickettsia endosymbiont of I. pacificus Adult ND CA 55/55 (100)
I. ricinus Ca. M. mitochondrii endosymbiont of I. ricinus Nymph ND CZR 147/207 (71.0)
I. ricinus Ca. M. mitochondrii endosymbiont of I. ricinus Adult ND GER 36/48 (75.0)
I. scapularis Rickettsia endosymbiont of I. scapularis Egg ND LAB 20/20 (100)
I. scapularis Rickettsia endosymbiont of I. scapularis Larva ND LAB 17/21 (81.0)
I. scapularis Rickettsia endosymbiont of I. scapularis Nymph ND CT 57/63 (90.5)
I. scapularis Rickettsia endosymbiont of I. scapularis Adult ND CT 188/212 (88.7)
I. scapularis Rickettsia endosymbiont of I. scapularis Adult Female CT 92/93 (98.9)
I. scapularis Rickettsia endosymbiont of I. scapularis Adult Male CT 77/100 (77.0)
R. sanguineus Coxiella-like endosymbiont of R. sanguineus Adult ND LAB 20/20 (100)
Open in a new tab
a

ND, not determined; LAB, laboratory-reared ticks from OSU; WUS, western United States; CZR, Czech Republic; GER, Germany; CT Connecticut; CA, California; and NY, New York.

Nucleic Acid Extractions

A Virus MinElute kit (QIAGEN, Valencia, CA) with modifications described previously (Crowder et al. 2010b) was used to extract RNA and DNA from ticks of all species except I. ricinus, D. andersoni, and D. variabilis. I. scapularis eggs and larvae were extracted in groups of 1–15; all other samples were extracted individually. Nucleic acids were extracted from I. ricinus ticks collected in Germany as published previously (Crowder et al. 2010a). Total nucleic acids were extracted from field-collected D. variabilis and D. andersoni ticks as described previously (Scoles 2004).

Broad-Range PCR/ESI-MS

Detection of endosymbiont DNA was performed using a PCR/ESI-MS assay that consists of 10 PCR primer pairs targeting various genes and organisms (Table 1). Primer pair BCT2328 was run either singly or in a multiplexed reaction with BCT3511, BCT3517, and INV4855. The remaining primer pairs were run in single-plex PCR reactions. Internal positive controls made from cloned synthetic DNA (BlueHeron Biotechnology, Bothell, WA) were included in each PCR reaction at 20 copies per reaction. The internal controls were designed to be identical to the expected amplicon for one of the primer pairs in the reaction with the exception of a 5-bp deletion to enable the control to be distinguished from the target-derived amplicon. Amplicons ranged in length from 100 to 150 bp.

Table 1.

PCR/ESI/MS primers, gene targets, and bacterial targets

Primer pair Forward (F), reverse (R) Primer sequence (5′ to 3′) Target Target clade/genus
BCT2328 F TGAGGGTTTTATGCTTAAAGTTGGTTTTATTGGTT asd F. tularensis
R TGATTCGATCATACGAGACATTAAAACTGAG
INV4855 F TGAGAGAAATCGTACACATTCAAGCGGG β-tubulin All Babesia spp.
R TCCATGTTCGTCGGAGATGACTTCCCA
INV4443 F TGCGCAAATTACCCAATCCTGACAC 18S rRNA All Babesia spp.
R TCCAGACTTGCCCTCCAATTGGTA
BCT3511 F TGCATTTGAAAGCTTGGCATTGCC gyrB All Borrelia spp.
R TCATTTTAGCACTTCCTCCAGCAGAATC
BCT3514 F TTTGGTACCACAAAGGAATGGGA rpoC All Spirochetes
R TGCGAGCTCTATATGCCCCAT
BCT3517 F TGCTGAAGAGCTTGGAATGCA flagellin All Borrelia spp.
R TACAGCAATTGCTTCATCTTGATTTGC
BCT3518 F TGACGGTATTTTTATTTATATCTTGTAATAATTCAGG ospC All Borrelia spp.
R TTTGCTTATTTCTGTAAGATTAGGCCCTTT
BCT1083 F TAAGAGCGCACCGGTAAGTTGG RNaseP All Rickettsia spp.
R TCAAGCGATCTACCCGCATTACAA
BCT3570 F TGCATGCAGATCATGAACAGAATGC gltA Alphaproteobacteria
R TCCACCATGAGCTGGTCCCCA
BCT3575 F TGCATCACTTGGTTGATGATAAGATACATGC rpoB Alphaproteobacteria
R TCACCAAAACGCTGACCACCAAA
Open in a new tab

PCR was performed in a 50-μl reaction volume containing 750 nM of each primer and 10 μl of nucleic acid extract in a reaction mix as described previously (Crowder et al. 2010a). PCR cycling conditions were the same as those reported previously (Eshoo et al. 2007). ESI-MS and base composition analysis were performed on a PLEX-ID or a T5000 instrument (Abbott Molecular, Des Plaines, IL) as described previously (Eshoo et al. 2010).

PCR and Sequencing the 16S rRNA Gene of Endosymbionts

A portion of the endosymbiont 16S rRNA gene from representative samples of various tick species was amplified, cloned, and sequenced. Extracts from A. americanum, A. maculatum, D. andersoni, D. occidentalis, D. variabilis, D. andersoni, I. pacificus, and I. scapularis were amplified with primers BCT1366 F (5′-TAGAACACCGATGGCGAAGGC-3′) and BCT1403R (5′-TTGACGTCATCCCCACCTTCCTC-3′) and the same PCR mix reported previously (Crowder et al. 2010a). Reactions were amplified on an MJ Dyad 96-well thermocycler (Bio-Rad Laboratories, Hercules, CA) with the following conditions: an initial hold of 95°C for 10 min, followed by 30 cycles of 95°C for 15 s and 66°C for 45 s; a final extension at 72°C for 2 min; and an incubation at 50°C for A-tailing. Reactions containing the ≈445-bp amplicon were ligated and cloned into the pGEM-T Easy Vector System II kit (Promega, Madison, WI). Clones were screened for the desired sequence by amplification with primer pair BCT348 (F: 5′-TTTCGATGCAACGCGAAGAACCT-3′; R: 5′-TACGAGCTGACGACAGCCATG-3′), which targets the 16S rRNA gene, and they were analyzed using the T5000 Biosensor. Clones containing the desired base counts were Sanger sequenced at Retrogen, Inc. (San Diego, CA) by using SP6 and T7 promoter primers. For I. ricinus, an ≈720-bp portion of the 5′ end of the 16S rRNA gene was amplified with primers 4 F (5′-M13 F-TTGGAGAGTTTGATCCTGGCTC-3′ [Petti et al. 2008]; M13 F: 5′-CCCAGTCACGACGTTGTAAAACG-3′ [Eshoo et al. 2007]) and 801R (5′-M13R-GGCGTGGACTTCCAGGGTATCT-3′ [Simmon et al. 2006]; M13R: 5′-AGCGGATAACAATTTCACACAGG-3′ [Eshoo et al. 2007]) by using Platinum Taq High Fidelity (Invitrogen, Carlsbad, CA). Platinum Taq buffer was used with 200 μM of each dNTP, 2 mM MgSO4, and 250 nM of each primer. Reactions were cycled with the following conditions: 95°C for 2 min; 8 cycles of 95°C for 15 s, 50°C for 45 s (increasing 0.6°C per cycle), and 68°C for 90 s; 37 cycles of 95°C for 15 s, 60°C for 15 s, and 68°C for 60 s; followed by 4 min at 68°C. Reactions were ligated and cloned using the ZeroBlunt TOPO PCR Cloning kit (Invitrogen). Clones containing the desired sequence as shown by analysis by PCR/ESI-MS were sequenced at SeqWright (Houston, TX) by using SP6 and T7 promoter primers. Sequences were deposited in GenBank under accessions JQ031629–JQ031634.

Results

Identification of Species-Specific Tick Endosymbionts by Broad-Range PCR/ESI-MS

The ability of the PCR/ESI-MS assay to detect species-specific tick endosymbionts was tested using nucleic acid extracts from each of the species listed in Table 2. Ticks were obtained either by flagging in the field or from the OSU tick-rearing facility (I. scapularis eggs and larvae and A. maculatum and R. sanguineus ticks). Adult ticks of all species were tested. For I. scapularis, all life stages were tested, and for I. ricinus both adults and nymphs were tested. For D. andersoni, D. variabilis, and I. scapularis, adults were segregated by sex and tested. The frequencies of detection were determined for each endosymbiont based on how often the endosymbiont signature was observed (Table 3). A detection was defined as the detection of the endosymbiont by one or more primer pairs.

Table 2.

Endosymbiont basecounts by tick species and primer pair

Tick species Endosymbiont Primer pair
BCT2328 BCT1083 BCT3570 BCT3575
A. americanum Coxiella-like endosymbiont of A. americanum A33G34C28T30
A. maculatum Francisella endosymbiont of A. maculatum A18G23C9T32 A28G31C18T35
I. ricinus Ca. M. mitochondrii endosymbiont of I. ricinus A27G27C21T37
I. pacificus Rickettsia endosymbiont of I. pacificus A42G32C30T31 A28G30C31T36
I. scapularis Rickettsia endosymbiont of I. scapularis A42G32C30T31 A28G30C32T35
D. andersoni Francisella endosymbiont of D. andersoni A17G23C10T32 A28G31C18T35
D. occidentalis Francisella endosymbiont of D. occidentalis A17G23C10T32 A28G31C18T35
D. variabilis Francisella endosymbiont of D. variabilis A17G23C9T33 A27G32C18T35
R. sanguineus Coxiella-like endosymbiont of R. sanguineus A25G37C29T34
Open in a new tab

The PCR/ESI-MS assay differentiated between the endosymbionts of all ticks species tested, with the exception of the Francisella endosymbionts of D. andersoni and D. occidentalis, which share basecount signatures (Table 2). To verify the identities of the endosymbionts, a portion of the bacterial 16S rRNA gene was sequenced for endosymbionts of several tick species in this study. For D. occidentalis, D. andersoni, D. variabilis, I. pacificus, and I. scapularis, an internal ≈443-bp region of the 16S rRNA gene was sequenced; for I. ricinus, the first 724 bp of the 16S rRNA gene was sequenced. The sequence for the Francisella endosymbiont of D. andersoni was identical to GenBank accession FJ468434. The Francisella endosymbiont of D. occidentalis sequence obtained was identical a previously sequenced endosymbiont (AY805304) of this species of tick. The Francisella endosymbiont of D. variabilis sequence shared 99.8% identity with AY805307. The I. scapularis sequence was a 99.8% match to D84558, and the I. ricinus sequence matched AJ566640 perfectly. The I. pacificus 16S sequence was a 99.3% match to EU072493, which is reported to be the endosymbiont of I. pacificus (Phan et al. 2011). The identity of the symbionts from A. americanum, A. maculatum, and R. sanguineus were not confirmed by their 16s rDNA.

The endosymbionts of A. americanum, I. ricinus, and I. scapularis were detected by broad-range PCR/ESI-MS in 75.0, 75.0, and 88.7% of the ticks tested, respectively (Table 3). The endosymbionts for A. maculatum, D. andersoni, D. occidentalis, D. variabilis, I. pacificus, and R. sanguineus were found in >99% of the ticks tested (Table 3). Previous studies have reported that the frequency of endosymbiont detections in I. ricinus ticks varied according to the sex (Lo et al. 2006), and others have reported that the endosymbionts of Dermacentor ticks are restricted to adult females (Niebylski et al. 1997a). To show that the endosymbionts we are detecting are not sex-specific in D. andersoni, D. variabilis, and I. scapularis, we tested adult ticks of both sexes. Using the PCR/ESI-MS assay, the Rickettsia endosymbiont of I. scapularis was detected in 98.9% of the adult female ticks and 77.0% of the adult males (Table 3). For the Dermacentor ticks, the endosymbionts were found in all ticks tested regardless of sex (Table 3). Although the sex of the A. maculatum, A. americanum, D. occidentalis, I. pacificus, and R. sanguineus ticks tested was not determined before testing, detection of the endosymbiont in 75 to 100% of the ticks tested suggests that these endosymbionts are not sex-specific.

Detection of the Rickettsia Endosymbiont of I. scapularis in All Developmental Stages

To show that the endosymbionts are present in all developmental stages of I. scapularis, we tested eggs, larvae, nymphs, and adult ticks. The Rickettsia endosymbiont was detected in all of the I. scapularis egg extracts tested, in 81.0% of the larval extracts, in 90.5% of the nymphal extracts, and in 88.7% of the adult extracts (Table 3).

Simultaneous Differentiation and Detection of Endosymbionts and Pathogens by Broad-Range PCR/ESI-MS

Endosymbionts and pathogenic bacteria can be detected simultaneously using the PCR/ESI-MS assay. For example, both Anaplasma phagocytophilum and the endosymbiont were detected in a single specimen of I. scapularis by using primer pair BCT3570, and both pathogen and species-specific endosymbiont were detected in a single specimen of I. ricinus by using BCT3575 (Fig. 1A and B). Although no Francisella tularensis–infected ticks were detected, we have shown using DNA from cultured F. tularensis that this pathogen can be differentiated from the related but nonpathogenic Francisella endosymbionts of D. andersoni and D. variabilis, suggesting that this pathogen and symbiont combination also could be detected simultaneously (Fig. 1C–E).

Fig. 1.

Fig. 1

Open in a new tab

Simultaneous detections of pathogens and endosymbionts from individual ticks and differentiation of F. tularensis, the Francisella endosymbiont of D. variabilis, and the Francisella endosymbiont of D. andersoni by variations in mass signatures. Total nucleic acid extracts from ticks were analyzed using the PCR/ESI-MS assay. (A) A. phagocytophilum and the Rickettsia endosymbiont were both detected with primer pair BCT3570 in an adult I. scapularis tick from Bridgeport, CT. (B) A. phagocytophilum and the Candidatus Midichloria mitochondrii endosymbiont were both detected with primer pair BCT3575 in a nymphal I. ricinus tick from South Bohemia in the Czech Republic. (C) Extract from cultured F. tularensis was detected by primer pair BCT2328. (D)The Francisella endosymbiont of D.variabilis was detected in a D.variabilis adult with primer pair BCT2328. (E)The Francisella endosymbiont of D. andersoni was detected in a D. andersoni adult from OSU with primer pair BCT2328.

Discussion

The endosymbionts of ticks have been studied far less extensively than those of insects. There is a clear demarcation between those endosymbionts that are detected in all individuals of their host species and those endosymbionts found in only a subset of ticks or whose distributions are population-specific, such as R. peacockii (Burgdorfer et al. 1973, Niebylski et al. 1997a). We propose that the ubiquitous endosymbionts are probably the primary endosymbionts, whereas the more sporadically distributed species are the secondary endosymbionts as described by Moran et al. (2008).

Zhong et al. (2007) suggests that tick endosymbionts may confer a fitness advantage to their hematophagous hosts and that the symbionts may provide them with necessary nutrients as the Wigglesworthia endosymbiont does for the tsetse fly (Zientz et al. 2004). Removal of the ubiquitous Coxiella-like endosymbiont of A. americanum via antibiotic treatment resulted in decreased reproductive fitness of the ticks (Zhong et al. 2007). This evidence, combined with the ubiquity of the endosymbionts, suggests that this Coxiella species is a primary endosymbiont of its host. Our finding of a single specific endosymbiont in each species of tick listed in Table 2 regardless of gender, stage, or field collection site as well as ticks reared in a sterile laboratory environment supports the hypothesis that these endosymbionts represent the species-specific heritable primary tick endosymbionts.

Here, we used a PCR/ESI-MS assay designed to detect a wide range of vectorborne pathogens to identify tick species via detection of their endosymbionts. The assay was able to detect and distinguish the endosymbionts from all the ticks studied with the exception of D. andersoni and D. occidentalis, both of which have a Francisella endosymbiont that produced the same base composition signature in our assay, however; when the 17-kDa lipoprotein gene from the Francisella-like endosymbiont of these two species was sequenced, they could be clearly distinguished from one another (Scoles 2004). Species-specific endosymbionts were detected in most, if not all ticks, although the frequency of detection varied by tick species; these differences may reflect differing extraction efficiencies or lack of sensitivity of our broad-range PCR/ESI-MS assay for certain endosymbionts rather than an absence of the endosymbiont. The Rickettsia endosymbiont of I. scapularis, for example, was less frequently detected than the I. pacificus endosymbiont by our assay. We also detected the Coxiella-like endosymbiont of A. americanum at a lower frequency than endosymbionts from other tick species, despite that others have shown it to be present in all tick stages and both sexes (Jasinskas et al. 2007, Klyachko et al. 2007, Zhong et al. 2007).

Endosymbionts were detected in both male and female I. scapularis, D. andersoni, and D. variabilis ticks. For the other tick species tested, the sex was not determined, but based upon our high frequencies of detection (71–100%) the endosymbionts were present in both sexes. Previous research has indicated that the Francisella endosymbiont of D. andersoni was restricted to females, (Niebylski et al. 1997a), but our data demonstrate that the Francisella endosymbiont is also present in Dermacentor males. For I. scapularis, we detected the endosymbiont in nearly all the females tested (98.9%) and 77.0% of the males ticks tested. A similar sex-dependent differential was reported for the detection of the I. ricinus endosymbiont (Lo et al. 2006). There may be fewer endosymbiotic bacteria within the male ticks, as one of the main sites of the endosymbionts are the ovaries of female ticks (Noda et al. 1997, Beninati et al. 2004, Lo et al. 2006), and this might account for the lower level of detection.

In addition to the primary tick endosymbionts, we detected secondary endosymbionts in a subset of our specimens. For example, in addition to the Francisella endosymbiont of A. maculatum described by Scoles (2004), primer pair BCT1083 detected a second basecount signature consistent with a Spotted Fever Group Rickettsia in all ticks tested (n = 20); further genetic analysis such as 16S rRNA gene sequencing is needed to confirm its identity. We also detected R. peacockii in 67.3% (144/214) of D. andersoni ticks from the western United States but not in laboratory-reared ticks. This finding is consistent with the research of Burgdorfer et al. (1981) who found a population-specific pattern in R. peacockii distribution: The bacteria was detected in D. andersoni ticks from the eastern side of the Bitterroot Valley in Montana but not in those collected on the western side of the valley (Burgdorfer et al. 1981, Niebylski et al. 1997b). Our assay does not, however, detect some of the tick-associated microbes identified in recent studies, such as Arsenophonus-type bacteria (Carpi et al. 2011, Clay et al. 2008); unlike next generation sequencing approaches, our assay uses a more targeted approach, with primers designed to broadly amplify bacterial genera containing vectorborne pathogens. That these genera also comprise the primary endosymbionts of ticks allows us to identify and distinguish both tickborne pathogens and their closely related endosymbionts.

Heritable endosymbiotic bacteria of ticks are often closely related to vectorborne pathogens such as Coxiella burnetii, F. tularensis, and Rickettsia rickettsii (Noda et al. 1997, Weller et al. 1998, Scoles 2004). The PCR/ESI-MS assay used in this study can detect both endosymbiont and closely related pathogens from the same specimen in a single test. Although the assay was able to distinguish species-specific endosymbionts from most ticks tested, there was one exception: The basecount signatures for the Rickettsia endosymbiont of I. scapularis obtained from both primer pairs BCT1083 and BCT3570 were identical to those of the recently identified European tickborne bacteria Rickettsia monacensis (Simser et al. 2002); however, because I. scapularis ticks are confined to North America and R. monacensis has only been found in Europe, the potential for misidentification is low. Thus, this study demonstrated that the PCR/ESI-MS assay can identify and differentiate between tickborne pathogens and closely related endosymbiont species in a single test, as well as determine the species of tick based on the endosymbiont.

Acknowledgments

We thank Scott Campbell (Suffolk County Department of Public Health, New York), Kirby Stafford, III (The Connecticut Agricultural Experiment Station), Jianmin Zhong (California State University Humboldt), and Stacy Berden (San Joaquin Mosquito and Vector Control) for providing ticks and Oliver Nolte (Laboratory of Brunner, Constance, Germany), Libor Grubhoffer, and Václav Hönig (both University of South Bohemia, Czech Republic) for providing tick extracts. We also thank Keith Clay (Indiana University, Bloomington) for review of the manuscript. This work was supported by National Institutes of Health grant 2R44AI077156-02 and the Tami Fund.

Footnotes

M.A.R., C.D.C., H.E.M., C.A.P., D.J.E., and M.W.E. are employees of Abbott Laboratories, which manufactures the PLEX-ID instrument used in this study. G.A.S. is an employee of the USDA.

References Cited

  1. Beninati T, Lo N, Sacchi L, Genchi C, Noda H, Bandi C. A novel alpha-Proteobacterium resides in the mitochondria of ovarian cells of the tick Ixodes ricinus. Appl. Environ. Microbiol. 2004;70:2596–2602. doi: 10.1128/AEM.70.5.2596-2602.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Benson MJ, Gawronski JD, Eveleigh DE, Benson DR. Intracellular symbionts and other bacteria associated with deer ticks (Ixodes scapularis) from Nantucket and Wellfleet, Cape Cod, Massachusetts. Appl. Environ. Microbiol. 2004;70:616–620. doi: 10.1128/AEM.70.1.616-620.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Braendle C, Miura T, Bickel R, Shingleton AW, Kambhampati S, Stern DL. Developmental origin and evolution of bacteriocytes in the aphid-Buchnera symbiosis. PLoS Biol. 2003;1:E21. doi: 10.1371/journal.pbio.0000021. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Burgdorfer W, Brinton LP, Hughes LE. Isolation and characterization of symbiotes from the Rocky Mountain wood tick, Dermacentor andersoni. J. Invertebr. Pathol. 1973;22:424–434. doi: 10.1016/0022-2011(73)90173-0. [DOI] [PubMed] [Google Scholar]
  5. Burgdorfer W, Hayes SF, Mavros AJ. Non-pathogenic rickettsiae in Dermacentor andersoni: a limiting factor for the distribution of Rickettsia rickettsii. In: Burgdorfer W, Anacker RL, editors. Rickettsiae and rickettsial diseases. Academic; New York: 1981. pp. 585–594. [Google Scholar]
  6. Carpi G, Cagnacci F, Wittekindt NE, Zhao F, Qi J, Tomsho LP, Drautz DI, Rizzoli A, Schuster SC. Metagenomic profile of the bacterial communities associated with Ixodes ricinus ticks. PLoS ONE. 2011;6:e25604. doi: 10.1371/journal.pone.0025604. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Clay K, Klyachko O, Grindle N, Civitello D, Oleske D, Fuqua C. Microbial communities and interactions in the lone star tick, Amblyomma americanum. Mol. Ecol. 2008;17:4371–4381. doi: 10.1111/j.1365-294x.2008.03914.x. [DOI] [PubMed] [Google Scholar]
  8. Crowder CD, Matthews HE, Schutzer S, Rounds MA, Luft BJ, Nolte O, Campbell SR, Phillipson CA, Li F, Sampath R, Ecker DJ, Eshoo MW. Genotypic variation and mixtures of Lyme Borrelia in Ixodes ticks from North America and Europe. PLoS ONE. 2010a;5:e10650. doi: 10.1371/journal.pone.0010650. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Crowder CD, Rounds MA, Phillipson CA, Picuri JM, Matthews HE, Halverson J, Schutzer SE, Ecker DJ, Eshoo MW. Extraction of total nucleic acids from ticks for the detection of bacterial and viral pathogens. J. Med. Entomol. 2010b;47:89–94. doi: 10.1603/033.047.0112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Crowder CD, Matthews H, Rounds MA, Li F, Schutzer SE, Sampath R, Hofstadler SA, Ecker DJ, Eshoo MW. Detection of heartworm infection from canine blood by PCR and electrospray ionization mass spectrometry. J. Am. Vet. Res. 2011;73:854–859. doi: 10.2460/ajvr.73.6.854. [DOI] [PubMed] [Google Scholar]
  11. Dergousoff SJ, Chilton NB. Detection of a new Arsenophonus-type bacterium in Canadian populations of the Rocky Mountain wood tick, Dermacentor andersoni. Exp. Appl. Acarol. 2010;52:85–91. doi: 10.1007/s10493-010-9340-5. [DOI] [PubMed] [Google Scholar]
  12. Eshoo MW, Crowder CD, Li H, Matthews HE, Meng S, Sefers SE, Sampath R, Stratton CW, Blyn LB, Ecker DJ, et al. Detection and identification of Ehrlichia species in blood by use of PCR and electrospray ionization mass spectrometry. J. Clin. Microbiol. 2010;48:472–478. doi: 10.1128/JCM.01669-09. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Eshoo MW, Whitehouse CA, Zoll ST, Massire C, Pennella TT, Blyn LB, Sampath R, Hall TA, Ecker JA, Desai A, et al. Direct broad-range detection of alphaviruses in mosquito extracts. Virology. 2007;368:286–295. doi: 10.1016/j.virol.2007.06.016. [DOI] [PubMed] [Google Scholar]
  14. Goethert HK, Telford SR., III A new Francisella (Beggiatiales: Francisellaceae) inquiline within Dermacentor variabilis Say (Acari: Ixodidae). J. Med. Entomol. 2005;42:502–505. doi: 10.1093/jmedent/42.3.502. [DOI] [PubMed] [Google Scholar]
  15. Grant-Klein RJ, Baldwin CD, Turell MJ, Rossi CA, Li F, Lovari R, Crowder CD, Matthews HE, Rounds MA, Eshoo MW, et al. Rapid identification of vector-borne flaviviruses by mass spectrometry. Mol. Cell. Probes. 2010;24:219–228. doi: 10.1016/j.mcp.2010.04.003. [DOI] [PubMed] [Google Scholar]
  16. Grindle N, Tyner JJ, Clay K, Fuqua C. Identification of Arsenophonus-type bacteria from the dog tick Dermacentor variabilis. J. Invertebr. Pathol. 2003;83:264–266. doi: 10.1016/s0022-2011(03)00080-6. [DOI] [PubMed] [Google Scholar]
  17. Haynes S, Darby AC, Daniell TJ, Webster G, Van Veen FJ, Godfray HC, Prosser JI, Douglas AE. Diversity of bacteria associated with natural aphid populations. Appl. Environ. Microbiol. 2003;69:7216–7223. doi: 10.1128/AEM.69.12.7216-7223.2003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Jasinskas A, Zhong J, Barbour AG. Highly prevalent Coxiella sp. bacterium in the tick vector Amblyomma americanum. Appl Environ Microbiol. 2007;73:334–336. doi: 10.1128/AEM.02009-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Klyachko O, Stein BD, Grindle N, Clay K, Fuqua C. Localization and visualization of a Coxiella-type symbiont within the lone star tick, Amblyomma americanum. Appl. Environ. Microbiol. 2007;73:6584–6594. doi: 10.1128/AEM.00537-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Kuwahara H, Takaki Y, Yoshida T, Shimamura S, Takishita K, Reimer JD, Kato C, Maruyama T. Reductive genome evolution in chemoautotrophic intra-cellular symbionts of deep-sea Calyptogena clams. Extremophiles. 2008;12:365–374. doi: 10.1007/s00792-008-0141-2. [DOI] [PubMed] [Google Scholar]
  21. Lo N, Beninati T, Sassera D, Bouman EA, Santagati S, Gern L, Sambri V, Masuzawa T, Gray JS, Jaenson TG, et al. Widespread distribution and high prevalence of an alpha-proteobacterial symbiont in the tick Ixodes ricinus. Environ. Microbiol. 2006;8:1280–1287. doi: 10.1111/j.1462-2920.2006.01024.x. [DOI] [PubMed] [Google Scholar]
  22. Moran NA, McCutcheon JP, Nakabachi A. Genomics and evolution of heritable bacterial symbionts. Annu. Rev. Genet. 2008;42:165–190. doi: 10.1146/annurev.genet.41.110306.130119. [DOI] [PubMed] [Google Scholar]
  23. Moreno CX, Moy F, Daniels TJ, Godfrey HP, Cabello FC. Molecular analysis of microbial communities identified in different developmental stages of Ix-odes scapularis ticks from Westchester and Dutchess Counties, New York. Environ. Microbiol. 2006;8:761–772. doi: 10.1111/j.1462-2920.2005.00955.x. [DOI] [PubMed] [Google Scholar]
  24. Newton IL, Woyke T, Auchtung TA, Dilly GF, Dutton RJ, Fisher MC, Fontanez KM, Lau E, Stewart FJ, Richardson PM, et al. The Calyptogena magnifica chemoautotrophic symbiont genome. Science. 2007;315:998–1000. doi: 10.1126/science.1138438. [DOI] [PubMed] [Google Scholar]
  25. Niebylski ML, Peacock MG, Fischer ER, Porcella SF, Schwan TG. Characterization of an endosymbiont infecting wood ticks, Dermacentor andersoni, as a member of the genus Francisella. Appl. Environ. Microbiol. 1997a;63:3933–3940. doi: 10.1128/aem.63.10.3933-3940.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Niebylski ML, Schrumpf ME, Burgdorfer W, Fischer ER, Gage KL, Schwan TG. Rickettsia peacockii sp. nov., a new species infecting wood ticks, Dermacentor andersoni, in western Montana. Int. J. Syst. Bacteriol. 1997b;47:446–452. doi: 10.1099/00207713-47-2-446. [DOI] [PubMed] [Google Scholar]
  27. Noda H, Munderloh UG, Kurtti TJ. Endosymbionts of ticks and their relationship to Wolbachia spp. and tick-borne pathogens of humans and animals. Appl. Environ. Microbiol. 1997;63:3926–3932. doi: 10.1128/aem.63.10.3926-3932.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Petti CA, Simmon KE, Miro JM, Hoen B, Marco F, Chu VH, Athan E, Bukovski S, Bouza E, Bradley S, et al. Genotypic diversity of coagulase-negative staphylococci causing endocarditis: a global perspective. J. Clin. Microbiol. 2008;46:1780–1784. doi: 10.1128/JCM.02405-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Phan JN, Lu CR, Bender WG, Smoak RM, Zhong J. Molecular detection and identification of Rickettsia species in Ixodes pacificus in California. Vector Borne Zoonotic Dis. 2011;11:957–961. doi: 10.1089/vbz.2010.0077. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Sassera D, Lo N, Bouman EA, Epis S, Mortarino M, Bandi C. “Candidatus Midichloria” endosymbionts bloom after the blood meal of the host, the hard tick Ixodes ricinus. Appl. Environ. Microbiol. 2008;74:6138–6140. doi: 10.1128/AEM.00248-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Schmitt S, Weisz JB, Lindquist N, Hentschel U. Vertical transmission of a phylogenetically complex microbial consortium in the viviparous sponge Ircinia felix. Appl. Environ. Microbiol. 2007;73:2067–2078. doi: 10.1128/AEM.01944-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Scoles GA. Phylogenetic analysis of the Francisella-like endosymbionts of Dermacentor ticks. J. Med. Entomol. 2004;41:277–286. doi: 10.1603/0022-2585-41.3.277. [DOI] [PubMed] [Google Scholar]
  33. Simmon KE, Croft AC, Petti CA. Application of SmartGene IDNS software to partial 16S rRNA gene sequences for a diverse group of bacteria in a clinical laboratory. J. Clin. Microbiol. 2006;44:4400–4406. doi: 10.1128/JCM.01364-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Simser JA, Palmer AT, Fingerle V, Wilske B, Kurtti TJ, Munderloh UG. Rickettsia monacensis sp. nov., a spotted fever group Rickettsia, from ticks (Ixodes ricinus) collected in a European city park. Appl. Environ. Microbiol. 2002;68:4559–4566. doi: 10.1128/AEM.68.9.4559-4566.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Steiner FE, Pinger RR, Vann CN, Grindle N, Civitello D, Clay K, Fuqua C. Infection and co-infection rates of Anaplasma phagocytophilum variants, Babesia spp., Borrelia burgdorferi, and the rickettsial endosymbiont in Ixodes scapularis (Acari: Ixodidae) from sites in Indiana, Maine, Pennsylvania, and Wisconsin. J. Med. Entomol. 2008;45:289–297. doi: 10.1603/0022-2585(2008)45[289:iacroa]2.0.co;2. [DOI] [PubMed] [Google Scholar]
  36. Sun LV, Scoles GA, Fish D, O'Neill SL. Francisella-like endosymbionts of ticks. J. Invertebr. Pathol. 2000;76:301–303. doi: 10.1006/jipa.2000.4983. [DOI] [PubMed] [Google Scholar]
  37. Taylor MJ, Bandi C, Hoerauf A. Wolbachia bacterial endosymbionts of filarial nematodes. Adv. Parasitol. 2005;60:245–284. doi: 10.1016/S0065-308X(05)60004-8. [DOI] [PubMed] [Google Scholar]
  38. Weller SJ, Baldridge GD, Munderloh UG, Noda H, Simser J, Kurtti TJ. Phylogenetic placement of rickettsiae from the ticks Amblyomma americanum and Ixodes scapularis. J. Clin. Microbiol. 1998;36:1305–1317. doi: 10.1128/jcm.36.5.1305-1317.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Zhong J, Jasinskas A, Barbour AG. Antibiotic treatment of the tick vector Amblyomma americanum reduced reproductive fitness. PLoS ONE. 2007;2:e405. doi: 10.1371/journal.pone.0000405. [DOI] [PMC free article] [PubMed] [Google Scholar]
  40. Zientz E, Dandekar T, Gross R. Metabolic interdependence of obligate intracellular bacteria and their insect hosts. Microbiol. Mol. Biol. Rev. 2004;68:745–770. doi: 10.1128/MMBR.68.4.745-770.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]

RESOURCES