Abstract
The bacterial cell division protein FtsZ is an attractive target for small-molecule antibacterial drug discovery. Derivatives of 3-methoxybenzamide, including compound PC190723, have been reported to be potent and selective antistaphylococcal agents which exert their effects through the disruption of intracellular FtsZ function. Here, we report the further optimization of 3-methoxybenzamide derivatives towards a drug candidate. The in vitro and in vivo characterization of a more advanced lead compound, designated compound 1, is described. Compound 1 was potently antibacterial, with an average MIC of 0.12 μg/ml against all staphylococcal species, including methicillin- and multidrug-resistant Staphylococcus aureus and Staphylococcus epidermidis. Compound 1 inhibited an S. aureus strain carrying the G196A mutation in FtsZ, which confers resistance to PC190723. Like PC190723, compound 1 acted on whole bacterial cells by blocking cytokinesis. No interactions between compound 1 and a diverse panel of antibiotics were measured in checkerboard experiments. Compound 1 displayed suitable in vitro pharmaceutical properties and a favorable in vivo pharmacokinetic profile following intravenous and oral administration, with a calculated bioavailability of 82.0% in mice. Compound 1 demonstrated efficacy in a murine model of systemic S. aureus infection and caused a significant decrease in the bacterial load in the thigh infection model. A greater reduction in the number of S. aureus cells recovered from infected thighs, equivalent to 3.68 log units, than in those recovered from controls was achieved using a succinate prodrug of compound 1, which was designated compound 2. In summary, optimized derivatives of 3-methoxybenzamide may yield a first-in-class FtsZ inhibitor for the treatment of antibiotic-resistant staphylococcal infections.
INTRODUCTION
The development of antibiotic resistance among human bacterial pathogens is a major global public health concern (1, 2). One of the most significant threats is the emergence and spread of drug-resistant staphylococci, such as methicillin-resistant Staphylococcus aureus (MRSA), vancomycin-resistant S. aureus (VRSA), and multidrug-resistant S. aureus (MDRSA) (3, 4). The problem of antibiotic resistance is compounded by the small number of new therapeutic agents that have been approved or developed in recent years (5–7). In the past 30 years, only four new classes of antibacterial compounds, i.e., the oxazolidinones, lipopeptides, pleuromutilins, and macrolactones, have been approved. One potential solution to this problem of increasing drug resistance is to develop new therapies that inhibit cellular processes that are not targeted by antibacterial agents in current clinical use.
The process of bacterial cell division is a novel and attractive target for new antibacterial drug discovery (8–13). FtsZ is considered to be the major protein of the bacterial cell division machinery (divisome) (14, 15). FtsZ is the first protein to be localized to the site of incipient division, and the orderly recruitment of the other cell division proteins is dependent upon this event. FtsZ is a GTPase, and monomers undergo GTP-dependent polymerization to form protofilaments that aggregate into a macromolecular structure, termed the Z ring, at the division site. Other cell division proteins are then recruited to the Z ring, and a new septum is synthesized, which enables the daughter cells to separate to complete a successful division event (15). FtsZ is an appealing target for new antibacterial drug discovery for several key reasons. First, it is an essential protein for bacterial viability (16–18). Second, FtsZ is a potentially broad-spectrum antibacterial target. The protein is highly conserved, and FtsZ proteins have been identified in most bacteria. Third, FtsZ is not present in higher eukaryotes, which suggests that FtsZ inhibitors should not be toxic to human cells. Fourth, although FtsZ lacks strong primary sequence similarity to mammalian β-tubulin, it has structural and functional homology to mammalian β-tubulin, which has been successfully exploited for cancer therapy (19–21); this suggests that FtsZ may be amenable to inhibitor development. Finally, because cell division proteins are not targeted by any licensed antibiotics, it is anticipated that there would not be cross-resistance within existing drug-resistant bacterial populations, as is widespread for other classes of antibiotics, such as the β-lactams.
There have been several reports of chemical entities that inhibit the function of FtsZ or the interactions of FtsZ with its partner proteins. Several approaches have been used to identify such inhibitors. The screening of natural-product and small-molecule libraries against FtsZ activity in vitro or in cell-based assays has identified several different chemical classes of inhibitors (22–24). Two groups used a targeted approach by synthesizing and evaluating close analogues of GTP, the natural substrate of FtsZ, to identify inhibitors of the enzyme's GTPase and polymerization activities (25, 26). FtsZ interacts with a number of other proteins in vivo. The interaction of FtsZ in Gram-negative organisms with one of those other proteins, called ZipA, has been exploited. Structural information was used to design inhibitors of this interaction (27–29). These inhibitors prompted the filamentation of Escherichia coli cells in vitro but for the most part exhibited weak antibacterial activity.
We previously described the development and characterization of a novel small-molecule inhibitor of FtsZ, which we designated PC190723 (30). PC190723 inhibited the proliferation of S. aureus in vitro with an MIC of 1 μg/ml. Biochemical, cytological, genetic, and crystallographic data have confirmed that PC190723 and its analogues block bacterial cell division by targeting FtsZ (30–33). In one study, a 30-mg/kg dose of PC190723 completely protected mice inoculated with a lethal dose of S. aureus. This was the first reported demonstration of in vivo efficacy for an FtsZ inhibitor (30).
PC190723 was one of a number of synthetic analogues of 3-methoxybenzamide (3-MBA) that were designed and evaluated during the exploration of the structure-activity relationships of early 3-MBA derivatives (34, 35). 3-MBA was originally described as a weak inhibitor of cell division in Bacillus subtilis through interaction with FtsZ (36). In this study, we describe the in vitro and in vivo characterization of a more advanced derivative of 3-MBA, designated compound 1. The chemical structure of compound 1 is shown in Fig. 1. In this molecule, a substituted phenyl bromo-oxazole moiety replaces the bicyclic thiazolopyridine moiety of PC190723. Compound 1 also has an alcohol substitution on the linker. The benzamide moiety is unchanged relative to PC190723. In the context of optimization of this chemical series towards a drug candidate, compound 1 displays superior antibacterial potency, an improved resistance profile, favorable in vitro and in vivo pharmacokinetic properties, and efficacy in the murine thigh model of S. aureus infection. These findings support the potential of 3-MBA derivatives to yield a novel antistaphylococcal drug candidate.
Fig 1.
Chemical structures of PC190723, compound 1, and its succinate prodrug, compound 2.
MATERIALS AND METHODS
Bacterial strains.
Bacterial strains used in this study were obtained from the American Type Culture Collection (LGC Promochem, Teddington, United Kingdom) or the Biota Europe Ltd. laboratory collection and were propagated using standard microbiological procedures. Müller-Hinton (MH) agar or MH broth (Oxoid Ltd., Basingstoke, United Kingdom) was used for the routine growth of Staphylococcus spp., Bacillus spp., Escherichia coli, and Pseudomonas aeruginosa. These strains were grown at 37°C in an ambient atmosphere. Brain heart infusion (BHI) agar and broth (Oxoid Ltd., Basingstoke, United Kingdom), supplemented with 5% (vol/vol) horse serum and NAD as necessary, were used to culture Haemophilus influenzae, Streptococcus pneumoniae, and Streptococcus pyogenes. H. influenzae, S. pneumoniae, and S. pyogenes were grown at 37°C in an atmosphere containing 5% CO2.
Chemicals.
Compounds 1 and 2 were synthesized at Jubilant Chemsys Ltd. (Noida, India) and at Biota Scientific Management Pty. Ltd. (Melbourne, Australia), as described (D. J. Haydon, L. G. Czaplewski, N. R. Stokes, D. Davies, I. Collins, J. T. Palmer, J. P. Mitchell, G. R. W. Pitt, and D. Offermann, international patent application PCT/AU2012/000416). Powder aliquots were dissolved in dimethyl sulfoxide (DMSO) at a stock concentration of 32 mg/ml and stored at −20°C. All other chemicals, including commercially available antimicrobials, were purchased from Sigma-Aldrich (Poole, United Kingdom).
Antimicrobial susceptibility testing.
MICs were determined with the broth microdilution method, according to the recommendations of the Clinical and Laboratory Standards Institute (37). Large-scale MIC testing of panels of drug-resistant clinical isolates of S. aureus and Staphylococcus epidermidis was performed by Euprotec Ltd. (Manchester, United Kingdom). Antimicrobial combination MICs were determined using the checkerboard method (38). Interpretation of the fractional inhibitory concentration index (FICI) was as described by Odds (39).
Cell division phenotype assays.
Phenotype assays were performed essentially as described previously (23, 30). Briefly, cultures were grown overnight in MH broth at 30°C. The cultures were diluted to an optical density at 600 nm (OD600) of approximately 0.06, and 10-μl aliquots were added to transparent 96-well microtiter plates (BD Falcon) containing dilutions of compound in 100-μl volumes of medium. After incubation for approximately 2 to 3 h at 37°C, 20-μl culture samples were transferred to poly-l-lysine–coated slides for microscopy. Cell morphology was assessed through phase-contrast light microscopy or staining with 4′,6-diamidino-2-phenylindole (DAPI) and examined using fluorescence microscopy with a Zeiss Axiovert 200 M inverted microscope equipped with a Sony CoolSNAP HQ cooled charge-coupled-device camera (Roper Scientific) and MetaMorph 6.1 software.
Isolation and characterization of compound-resistant mutants.
Cells of S. aureus were grown to late-exponential phase (OD600 = 0.9 ± 0.01; approximately 109 CFU/ml) and spread on MH agar containing compound 1 at the concentrations indicated. To determine the numbers of viable cells in the inocula, cultures were serially diluted and plated on compound-free MH agar. Plates were incubated at 37°C for 48 h, and the colonies were enumerated. Putative resistant mutants were patched onto plates with the same concentrations of compound. The frequency of resistance (FOR) was calculated by dividing the number of resistant colonies by the number of CFU in the inoculum. Chromosomal DNA was purified from putative compound-resistant isolates through phenol-chloroform extraction. The ftsZ gene was amplified by PCR using oligonucleotides SAZF (GGAATTCCATATGTTAGAATTTGAACAAGG) and SAZR (CACGGATCCGTCCTTCTACATGTTCTAAA). DNA fragments were purified and sequenced (GATC Biotech, London, United Kingdom).
Determination of bacterial fitness.
Fitness costs conferred on S. aureus by specific mutations were measured in vitro in pairwise competition assays with the mutants and the wild-type progenitor strain, as described previously (40). Briefly, the densities of separate overnight cultures of the mutant strains and strain ATCC 29213 were adjusted to OD600 values of 1.0 ± 0.1. The adjusted cultures were then combined at a 1:1 ratio through 1:200 dilution of each culture in fresh MH broth. The mixed cultures were incubated for 24 h at 37°C with shaking. At the start and end of the experiment, samples were removed for enumeration of total and mutant CFU through serial dilution and plating on nonselective (MH agar) and selective (MH agar plus compound) media. The fitness index ratio was calculated by dividing the proportion of mutant CFU in the mixed culture at the end of the experiment by the proportion at the beginning.
Chemical and plasma stability assays.
The stability of a 10 μM solution of compound in phosphate-buffered saline (PBS) (pH 7.4) or neat human or mouse plasma (Sera Laboratories International Ltd., Haywards Heath, United Kingdom) was determined by liquid chromatography-mass spectrometry (LC-MS) following 24 h of incubation at 37°C. The final concentration of DMSO was 5% (vol/vol). Compounds were sampled in triplicate. The results are expressed as the percentages remaining, which were determined through comparison of data obtained at 24 h and at time 0.
Microsomal stability assays.
Compounds were tested in duplicate at 10 μM, with a final concentration of 0.1% (vol/vol) DMSO. Microsomes were added to a final protein concentration of 1 mg/ml, and reactions were started by the addition of NADPH to a concentration of 1 mM. Reactions were stopped at 0, 10, 30, and 60 min by the addition of 100 μl of DMSO. Samples were extracted through the addition of acetonitrile and centrifugation, and the supernatants were analyzed by LC-MS. Half-life values were determined from the slopes of the peak areas over time, which were then used to calculate the intrinsic clearance (CL).
Hepatocyte stability assays.
Compounds were tested in duplicate at 10 μM, with a final DMSO concentration of 0.5% (vol/vol), and were incubated with 5 × 104 cryopreserved CD-1 mouse hepatocytes (CellzDirect, Durham, NC) in a 100-μl volume. The assay was stopped by the addition of 100 μl of DMSO at seven time points up to 120 min. Samples were then extracted with acetonitrile and analyzed by LC-MS.
Plasma protein binding assays.
Protein binding was measured by using an ultracentrifugation method with neat mouse plasma (Sera Laboratories International Ltd., Haywards Heath, United Kingdom). The compound was tested at 10 μM, with a final DMSO concentration of 1% (vol/vol), and was allowed to equilibrate at 37°C for 60 min. Duplicate samples were then centrifuged for 260 min at 250,000 × g at 37°C in a Sorvall MTX150 microultracentrifuge fitted with an S80-AT2 rotor (Thermo Scientific, Basingstoke, United Kingdom). Samples were extracted using acetonitrile and centrifugation. Supernatants were analyzed by LC-MS to determine the free compound concentrations through comparison with the samples that had not been centrifuged.
Caco-2 cell permeability assays.
Caco-2 cells (European Collection of Cell Cultures strain 86010202) were seeded in 24- or 96-well Millicell cell culture plate assemblies and differentiated over 21 days. On day 21, the insert plate was transferred to a 24- or 96-well Millicell receiver tray, and transepithelial electric resistance (TEER) measurements were recorded to check for cell confluence. Cells were then dosed apically or basolaterally with 30 μM compound (in triplicate) in Hanks' balanced salt solution (HBSS) (pH 7.4) (Sigma-Aldrich, Poole, United Kingdom) with 20 μM Lucifer yellow (to monitor membrane integrity) in a final DMSO concentration of 1% (vol/vol). Plates were incubated for 2 h at 37°C in 5% CO2. Following incubation, samples were taken from both the apical and basolateral sides for LC-MS permeability assessments (compound) and fluorescence analyses (Lucifer yellow). Apparent permeability (Papp) values were calculated by comparing the concentration of compound in the receiver compartment and the total amount of compound sampled from both compartments at the end of the assay.
Kinetic solubility assays.
The kinetic solubility of the compounds was measured by using a turbidimetric method. A series of doubling dilutions of compounds were prepared in neat DMSO. Five-microliter samples were diluted 20-fold in 95-μl volumes of phosphate-buffered saline (pH 7.4) in microtiter assay plates and were allowed to reach equilibrium at room temperature for 24 h. The absorbance within each well of the plate was recorded spectrophotometrically at a wavelength of 620 nm. A precipitate forms when the maximal aqueous solubility level is exceeded. The values reported represent the highest concentrations at which the compounds were in solution, i.e., no measurable precipitate was present.
Thermodynamic solubility assays.
The thermodynamic solubility of the compounds was measured by preparing them at concentrations up to 20 mg/ml in 100 mM HEPES (pH 7.4). Samples were incubated for 24 h at room temperature, with shaking, and then centrifuged for 15 min at 18,407 × g in a Hettich Mikro 120 centrifuge fitted with a 1242 angle rotor. Duplicate 50-μl samples of supernatants were removed, extracted with acetonitrile, and analyzed by high-performance liquid chromatography (HPLC).
Pharmacokinetics.
Experiments were performed by GVK Biosciences Pvt. Ltd. (Hyderabad, India) in compliance with regulations of the Committee for the Purpose of Control and Supervision of Experiments on Animals, Government of India. Groups of healthy adult female Swiss albino mice received compound through intravenous (i.v.) or oral (p.o.) administration. For compound 1, the vehicle contained 10% DMSO, 40% tetraethylene glycol (TEG), and 10% 2-hydroxypropyl-β-cyclodextrin (HPβCD) in water (final). For compound 2, the vehicle contained 10% DMSO and 1% l-arginine in water (final). At the indicated time points, animals were euthanized, and samples of blood were collected for analysis. Plasma concentrations of the compounds were measured by LC-tandem mass spectrometry (MS/MS), and pharmacokinetic parameters were calculated using WinNonlin.
Efficacy models of infection.
All animal efficacy studies were performed at the University of North Texas Health Science Center (UNTHSC) (Fort Worth, TX) following UNTHSC protocols approved by the institutional animal care and use committee (IACUC). For the systemic infection model, groups of female 5- to 6-week-old CD-1 mice were inoculated intraperitoneally with 2.5 × 105 CFU of the S. aureus Smith strain. Compounds (or the vehicle control) was administered i.v., as a single dose 1 h postinfection. The vehicle contained 10% DMSO, 40% TEG, and 10% HPβCD in water (final). Animals were observed for 5 days after treatment, and twice-daily censuses of survivors were performed. The 50% effective doses (ED50s) at 5 days for the compounds were measured by the survival rates of the vehicle control animals compared to the compound-treated animals. For the thigh infection model, groups of female 5- to 6-week-old CD-1 mice were rendered neutropenic by intraperitoneal injections of cyclophosphamide 4 days (150 mg/kg) and 1 day (100 mg/kg) prior to infection. The S. aureus Smith strain was inoculated intramuscularly into the thighs of the mice. Compounds (or the vehicle control) were administered i.v. at the doses and times indicated. For compound 1, the vehicle contained 10% DMSO, 40% TEG, and 10% HPβCD in water (final). For compound 2, the vehicle contained 10% dimethylacetamide and 0.9% l-arginine in water (final). After 24 h, the animals were euthanized, and their thighs were removed and processed for CFU enumeration through homogenization in sterile saline solution and serial dilution on charcoal-containing plates. The numbers of CFU were determined for each plate following overnight incubation.
RESULTS
In vitro antibacterial properties of compound 1.
The antibacterial activity of compound 1 was determined by assaying the MICs of this compound against a panel of type strains of Gram-positive and Gram-negative bacterial pathogens. The results are summarized in Table 1. Compound 1 inhibited the growth of Bacillus spp. and all staphylococcal species tested, including both coagulase-positive and coagulase-negative representative organisms. This is consistent with the activity of PC190723 (30). Compound 1 was 4- to 32-fold more potent than PC190723 in terms of its MIC against these organisms (Table 1). Compound 1 had little or no activity against other Gram-positive species or any of the Gram-negative pathogens tested. Compound 1 was then evaluated against panels of recent clinical drug-resistant isolates of S. aureus (n = 30) and S. epidermidis (n = 10). Across the sets, these isolates carried resistance to the antibiotics ciprofloxacin, ofloxacin, tetracycline, gentamicin, ceftazidime, penicillin, cefoxitin, chloramphenicol, trimethoprim, linezolid, erythromycin, rifampin, and mupirocin. The MIC90 of compound 1 against this panel of S. aureus isolates was 0.12 μg/ml, with an MIC range of 0.06 to 0.5 μg/ml, compared with an MIC90 of 2 μg/ml and an MIC range of 0.5 to 32 μg/ml for linezolid. For S. epidermidis, the MIC90 of compound 1 was 0.12 μg/ml, with an MIC range of 0.03 to 0.12 μg/ml. These values compared with an MIC90 of 2 μg/ml and an MIC range of ≤0.25 to 2 μg/ml for linezolid.
Table 1.
Antibacterial profiles of compound 1, PC190723, and linezolid
| Organism and strain | MIC (μg/ml) |
||
|---|---|---|---|
| Linezolid | PC190723 | Compound 1 | |
| Staphylococcus aureus ATCC 29213 | 2 | 1 | 0.12 |
| S. aureus ATCC 19636 | 2 | 1 | 0.12 |
| S. aureus ATCC 43300 (MRSA) | 1 | 1 | 0.12 |
| S. aureus ATCC BAA-44 (MDRSA) | 1 | 1 | 0.12 |
| Staphylococcus epidermidis ATCC 12228 | 1 | 1 | 0.12 |
| Staphylococcus haemolyticus ATCC 29970 | 1 | 0.5 | 0.12 |
| Staphylococcus hominis ATCC 27844 | 1 | 1 | 0.12 |
| Staphylococcus lugdunensis ATCC 43809 | 1 | 1 | 0.25 |
| Staphylococcus saprophyticus ATCC 15305 | 2 | 1 | 0.06 |
| Staphylococcus warneri ATCC 49454 | 2 | 1 | 0.25 |
| Bacillus cereus ATCC 14579 | 1 | 1 | 0.12 |
| Bacillus subtilis 168 | 0.5 | 1 | 0.03 |
| Escherichia coli ATCC 25922 | >64 | >64 | >64 |
| Haemophilus influenzae ATCC 49247 | 4 | >64 | >64 |
| Pseudomonas aeruginosa ATCC 27853 | >64 | >64 | >64 |
| Streptococcus pneumoniae ATCC 49619 | 1 | >64 | 64 |
| Streptococcus pyogenes ATCC 51339 | 1 | >64 | >64 |
To determine whether compound 1 exerted its antibacterial effect through the inhibition of cell division, the phenotype of S. aureus ATCC 29213 cells treated with compound 1 was assessed microscopically, as described previously (23, 30). The disruption of septum formation in dividing S. aureus cells through genetic or chemical interference with FtsZ activity results in an enlargement of the coccal cells, which is readily visible through phase-contrast microscopy (18, 30). S. aureus cells incubated in the presence of compound 1 appeared enlarged and multinucleate, compared to the untreated control cells, over a wide concentration range beginning at 0.12 μg/ml. This finding is consistent with the antibacterial effects of compound 1 being mediated through the inhibition of cell division, as described for other 3-MBA derivatives (30, 34, 35).
Activity of compound 1 against an FtsZ mutant.
During the evaluation of PC190723, spontaneous S. aureus-resistant mutants were isolated and characterized (30). All of the PC190723-resistant strains isolated were found to have point mutations in the ftsZ gene resulting in amino acid changes in the corresponding FtsZ protein sequence. Six different mutations were identified in the PC190723-resistant mutants. A mutation that converted the glycine residue at amino acid position 196 of S. aureus FtsZ to an alanine was the most frequently observed change. This alteration rendered the strain insensitive to PC190723 (Table 2) (30). Compound 1 was tested against the S. aureus G196A mutant strain. Although the mutation caused a 32-fold decrease in susceptibility, compound 1 was still able to inhibit the FtsZ G196A mutant with an MIC of 4 μg/ml (Table 2). The G196A mutation did not affect susceptibility to any of the other antibiotics tested, which were from a variety of chemical classes (Table 2).
Table 2.
In vitro activities of compound 1 and other antibiotics against an S. aureus FtsZ G196A mutant and its parental strain
| Compound | MIC (μg/ml) |
|
|---|---|---|
| S. aureus ATCC 29213 | S. aureus FtsZ G196A | |
| PC190723 | 1 | >64 |
| Compound 1 | 0.12 | 4 |
| Ampicillin | 8 | 16 |
| Erythromycin | 0.5 | 0.25 |
| Gentamicin | 1 | 0.5 |
| Ofloxacin | 0.5 | 0.5 |
| Rifampin | ≤0.03 | ≤0.03 |
| Tetracycline | 2 | 2 |
| Trimethoprim | 0.5 | 0.5 |
| Vancomycin | 1 | 1 |
The spontaneous frequency of resistance (FOR) for compound 1 was determined with two different strains of S. aureus. At 8 times the MIC, compound 1 was determined to have a mean FOR of 3.1 × 10−8 against strain ATCC 29213, which is comparable to the FOR of 2.3 × 10−8 reported for PC190723 (30). With the S. aureus Smith strain, the mean FOR was measured as 1.1 × 10−9. With this multiple of the MIC, the majority of the spontaneous S. aureus ATCC 29213-derived mutants carried the G196A mutation in FtsZ. Resistance frequency experiments were also conducted at higher concentrations of compound 1, i.e., above the MIC of compound 1 against the S. aureus FtsZ G196A mutant. At 8 μg/ml (equivalent to 64 times the MIC against wild-type S. aureus ATCC 29213) and 16 μg/ml (equivalent to 128 times the MIC), the S. aureus ATCC 29213 FOR decreased to 4.1 × 10−9 and 1.1 × 10−9, respectively. The ftsZ gene in each of the mutants generated from these experiments at the higher concentrations was sequenced. None of the mutants carried the G196A mutation. The inability of the FtsZ G196A mutant to grow at higher concentrations of compound 1 (Table 2) may account for the reduction in the resistance frequency seen at higher multiples of the MIC. All seven spontaneous mutants isolated from the 64-times-the-MIC experiment carried the G196V mutation. These mutants were compromised with respect to fitness, in that they displayed reduced growth in vitro relative to the parental strain. In an in vitro pairwise competition assay (40) with wild-type S. aureus strain ATCC 29213, an S. aureus FtsZ G196V mutant was measured to have a mean fitness index (FI) ratio of 0.13 ± 0.07 (n = 4), compared to an FI ratio of 1.00 ± 0.07 (n = 4) for the S. aureus G196A mutant. One of the two mutants from the 128-times-the-MIC experiment also carried the G196V mutation. The other mutant carried two single amino acid changes, i.e., I254T and N263I. This “double mutant” was also compromised with respect to in vitro fitness, with lower recorded growth rates than the parental wild-type S. aureus.
Interaction of compound 1 with other antibacterial agents.
To assess the potential for interactions between compound 1 and other antibiotics, a checkerboard MIC experiment was undertaken using S. aureus strain ATCC 29213. The antibacterial activity of compound 1 was tested in the presence of a range of concentrations of 10 antibiotics from different chemical classes with diverse mechanisms of action. Included in this set were agents that inhibit cell wall synthesis (vancomycin, oxacillin, and ceftazidime), protein synthesis (linezolid, erythromycin, tetracycline, and gentamicin), DNA replication (ofloxacin), RNA synthesis (rifampin), and folate metabolism (trimethoprim). Synergistic, antagonistic, or no interactions were assessed by calculating the fractional inhibitory concentration index (FICI) as described previously (38). The presence of other antibiotics had no effects on the MIC of compound 1 and vice versa. The FICI was calculated to be 2.0 for all antibiotics with the exception of rifampin, for which an FICI of 1.5 was measured (Table 3). These scores are indicative of no interactions (39).
Table 3.
Interactions of compound 1 with various antibiotics, as determined in checkerboard assays with S. aureus strain ATCC 29213
| Antibiotic | Class | FICI | Interaction |
|---|---|---|---|
| Vancomycin | Glycopeptides | 2 | None |
| Linezolid | Oxazolidinones | 2 | None |
| Oxacillin | Penicillins | 2 | None |
| Erythromycin | Macrolides | 2 | None |
| Ofloxacin | Fluoroquinolones | 2 | None |
| Tetracycline | Polyketides | 2 | None |
| Trimethoprim | Dihydrofolate reductase inhibitors | 2 | None |
| Gentamicin | Aminoglycosides | 2 | None |
| Rifampin | Rifamycins | 1.5 | None |
| Ceftazidime | Cephalosporins | 2 | None |
In vitro and in vivo pharmacokinetic properties of compounds 1 and 2.
The pharmacokinetic properties of compound 1 were assessed in vitro and in vivo, and the results of those analyses are presented in Table 4. Compound 1 was found to be chemically and metabolically stable. No degradation was observed in aqueous buffer, plasma, or microsomes, and the compound had a long half-life (58.6 min) in mouse hepatocytes. Compound 1 displayed relatively high levels of protein binding, with 98% bound to mouse plasma proteins. The permeability of compound 1 in Caco-2 monolayers was high, with Papp values of >10 × 10−6 cm/s for both the apical-to-basolateral (PappA-B) and basolateral-to-apical (PappB-A) directions and with a calculated efflux ratio of 0.3. These data are consistent with the potential for good oral bioavailability.
Table 4.
In vitro and in vivo pharmacokinetic properties of compound 1
| Parametera | Compound 1 value |
|---|---|
| Chemical stability (% remaining after 24 h) | 99 |
| Human microsomal stability | |
| Half-life (min) | >120 |
| CL (μl/min/mg) | <5.8 |
| Human plasma stability (% remaining after 24 h) | 107 |
| Mouse microsomal stability | |
| Half-life (min) | >120 |
| CL (μl/min/mg) | <5.8 |
| Mouse plasma stability (% remaining after 24 h) | 103 |
| Mouse hepatocyte stability | |
| Half-life (min) | 58.6 |
| CL (μl/min/mg) | 23.6 |
| Plasma protein binding (fraction unbound) | 0.02 |
| Caco-2 cell permeability | |
| Efflux ratio | 0.3 |
| PappA-B (×10−6 cm/s) | 31.2 |
| PappB-A (×10−6 cm/s) | 10.5 |
| Mouse i.v. pharmacokinetic parameters | |
| Dose (mg/kg) | 10 |
| AUC (μg · h/ml) | 10.1 |
| Initial concentration (μg/ml) | 6.2 |
| CL (ml/min/kg) | 13.2 |
| Half-life (min) | 265 |
| Volume of distribution (liter/kg) | 5.1 |
| Mouse p.o. pharmacokinetic parameters | |
| Dose (mg/kg) | 10 |
| AUC (μg · h/ml) | 8.3 |
| Cmax (μg/ml) | 2.1 |
| Time to Cmax (min) | 15 |
| Bioavailability (%) | 82.0 |
CL, clearance; Cmax, maximal concentration.
Consequently, the pharmacokinetic profile and bioavailability of compound 1 in mice were determined. Compound 1 was administered at 10 mg/kg to mice using intravenous (i.v.) and oral (p.o.) dosing. The calculated pharmacokinetic parameters are summarized in Table 4. Compound 1 showed good plasma exposure in mice following i.v. and p.o. dosing. Following i.v. administration at 10 mg/kg, the area under the curve (AUC) was 10.1 μg·h/ml, the clearance (CL) was 13.2 ml/min/kg, and the half-life (t½) was 265 min. The bioavailability following p.o. administration was calculated to be 82.0%. No in vivo enantiomeric conversions of compound 1 to the S-enantiomer in mice were detected (data not shown).
A succinate prodrug of compound 1, designated compound 2 (Fig. 1), was designed and synthesized to increase the solubility of the molecule and to enable in vivo evaluation of the compound at higher concentrations. The solubility of compound 1 was measured as 0.1 mg/ml at pH 7.4 in the kinetic solubility assay. In contrast, the solubility of compound 2 was measured to be ≥1.6 mg/ml with the kinetic solubility method and >20 mg/ml with the thermodynamic solubility method. The stability of compound 2 was investigated in relevant matrices. Compound 2 was stable in aqueous buffer at pH 2.1 and pH 7.4, with half-lives of more than 24 h. Compound 2 was also stable in plasma, with half-lives of >24 h and 16 h in mouse and human plasma, respectively. In contrast, compound 2 was rapidly metabolized to compound 1 in mouse liver microsomes, with a measured half-life of less than 10 min.
The in vivo conversion of compound 2 was investigated in mice. Compound 2 was administered p.o. at 3 mg/kg and i.v. at 3, 10, 30, and 100 mg/kg. The plasma concentrations of compound 1 were then monitored for 24 h. The resulting plasma concentrations are shown in Fig. 2, and the calculated pharmacokinetic parameters are summarized in Table 5. The pharmacokinetic profile of compound 1 following i.v. administration of compound 2 at 10 mg/kg was comparable to that observed when compound 1 was administered directly at that dose (Tables 4 and 5). A strong linear dose-response relationship was measured for the four i.v. doses, with calculated R2 values of 0.990 and 0.996 for the initial concentration and AUC parameters, respectively, across the range. The bioavailability of compound 1 following p.o. administration of compound 2 at 3 mg/kg was calculated to be 78.0%, which was similar to the bioavailability of 82.0% measured following oral administration of compound 1 at 10 mg/kg (Table 4).
Fig 2.
Plasma concentrations of compound 1 following administration of compound 2. The plasma concentrations of compound 1 in mice over 24 h following oral (p.o.) or intravenous (i.v.) administration of compound 2 are shown. ○, 3 mg/kg p.o.; ■, 3 mg/kg i.v.; ▲, 10 mg/kg i.v.; ⧫, 30 mg/kg i.v.; ●, 100 mg/kg i.v.
Table 5.
Pharmacokinetic parameters of compound 1 in mice after administration of compound 2
| Parameter | 3 mg/kg p.o. | 3 mg/kg i.v. | 10 mg/kg i.v. | 30 mg/kg i.v. | 100 mg/kg i.v. |
|---|---|---|---|---|---|
| Initial concentration (μg/ml) | 1.6 | 6.6 | 17.1 | 88.5 | |
| Cmax (μg/ml) | 0.4 | ||||
| AUC (μg·h/ml) | 2.3 | 3.0 | 11.6 | 34.0 | 146.0 |
| Half-life (min) | 234 | 197 | 203 | 193 | |
| Time to Cmax (min) | 5 | ||||
| CL (ml/min/kg) | 16.4 | 14.3 | 14.6 | 11.4 | |
| Volume of distribution (liter/kg) | 5.5 | 4.1 | 4.3 | 3.2 | |
| Bioavailability (%) | 78.0 |
In vivo efficacy of compounds 1 and 2.
One of the objectives of the synthetic optimization program for this series of molecules was to develop an FtsZ inhibitor that is efficacious in the murine S. aureus thigh infection model. To this end, the in vivo efficacy of compound 1 was evaluated in two S. aureus models of infection. Like PC190723, a single i.v. dose of 30 mg/kg compound 1 demonstrated efficacy in the murine septicemia model (data not shown). As a first step toward demonstrating superior efficacy, compound 1 was investigated in the model of staphylococcal thigh infection following a challenge with a relatively low inoculum of S. aureus. The numbers of S. aureus CFU recovered from the infected thighs after 24 h are shown in Fig. 3. Three i.v. doses of 30 mg/kg of compound 1, administered 2, 4, and 6 h postinfection, were sufficient to cause significant decreases in bacterial burden after 24 h compared with results from the untreated control animals. Compound 2 was then investigated in the standard inoculum murine model of staphylococcal thigh infection. The numbers of S. aureus CFU recovered from the infected thighs after 24 h are shown in Fig. 4. Three i.v. doses of 100 mg/kg of compound 2, administered 2, 4, and 6 h postinoculation, caused a statistically significant (P < 0.001) decrease in bacterial burden at the end of the experiment. A 3.68-log reduction in the numbers of S. aureus CFU was measured in the animals that received the prodrug compared with those in the untreated control group.
Fig 3.
Efficacy of compound 1 in an S. aureus murine thigh infection model. Groups of mice were rendered neutropenic, and 1.6 × 103 CFU of the S. aureus Smith strain was injected into their thighs followed by i.v. administration of three 30-mg/kg doses of compound 1 at 2, 4, and 6 h postinfection or one dose of vancomycin (VAN) at 10 mg/kg or 50 mg/kg at 2 h postinfection. The numbers of CFU recovered from the infected thighs after 24 h are shown. Error bars represent standard errors in the CFU measurements. **, all CFU reductions were significant (P < 0.001) relative to those of the untreated control (vehicle).
Fig 4.
Efficacy of compound 2 in an S. aureus murine thigh infection model. Groups of mice were rendered neutropenic, and 7.9 × 104 CFU of the S. aureus Smith strain was injected into their thighs followed by i.v. administration of three 100-mg/kg doses of compound 2 at 2, 4, and 6 h postinfection or one 30-mg/kg dose of vancomycin (VAN) at 2 h postinfection. The numbers of CFU recovered from the infected thighs after 24 h are shown. Error bars represent standard errors in the CFU measurements. **, all CFU reductions were significant (P < 0.001) relative to those of the untreated control (vehicle).
DISCUSSION
Meeting the challenge of antibiotic resistance necessitates the discovery and optimization of new antibacterial agents against novel targets. The development of small-molecule inhibitors of the essential and conserved bacterial cell division protein FtsZ is one option for meeting this challenge. Our previous work (30, 34, 35) reported the discovery and early optimization of 3-MBA derivatives, exemplified by PC190723, as possible first-in-class FtsZ inhibitors with demonstrated efficacy in vivo. In the current study, we have described an improved small-molecule inhibitor of FtsZ, designated compound 1, which, along with its succinate prodrug (compound 2), displayed superior properties in several key dimensions that are important for the development of 3-MBA derivatives as an antistaphylococcal drug candidate.
Compound 1 was generally 4- to 8-fold more potent against staphylococcal species, including the important pathogen MRSA, than PC190723 (Table 1). It was also more potent against S. aureus than other FtsZ inhibitors reported to date (22–24, 28, 41–43) and had lower MICs than linezolid. The increased antibacterial potency of compound 1 was accompanied by a reduction in the lowest concentration at which the phenotype of inhibition of cell division was observed. This indicates that the improved activity of compound 1 is exerted through FtsZ inhibition rather than through non-target-based means. The on-target nature of the activity of compound 1 was also evidenced by the upward shift in the observed MIC against the S. aureus FtsZ G196A mutant. Compound 1 did not show any notable loss of potency against a panel of 40 S. aureus and S. epidermidis clinical isolates with resistance to a wide range of clinically relevant antibiotics. This result is consistent with the absence of FtsZ inhibitors in clinical use, and it validates the strategy of prioritizing unexploited targets for combating drug-resistant pathogens. As expected from our understanding of the sequence of the putative benzamide binding region of FtsZ (30), the improved potency of compound 1 did not lead to any notable inhibition of other Gram-positive or Gram-negative bacterial species.
Understanding the potential for the emergence of resistance, as well as the viability or fitness of spontaneous inhibitor-resistant mutants, is important in a single-enzyme-targeted antibacterial drug discovery program such as ours (44). At 2.3 × 10−8, PC190723 showed an FOR within the predicted range for a single-target inhibitor (45). Although a minority of the spontaneous mutants that were isolated against PC190723 were found to be compromised with respect to fitness, the most prevalent mutation identified (namely, a glycine-for-alanine conversion at residue 196 of the amino acid sequence of S. aureus FtsZ) was robust (30). Significantly, this mutation conferred complete PC190723 insensitivity to S. aureus. One of the objectives of our ongoing lead optimization program has been to improve the resistance profiles of the 3-MBA derivatives by identifying chemical features of ligands that overcome or mitigate the impact of this mutation. This may happen either through reducing the FOR per se or by inhibiting spontaneous FtsZ mutants such as G196A. Towards this goal, compound 1 demonstrated an improved resistance profile compared to others that were studied previously. Compound 1 demonstrated a single-digit MIC against the S. aureus FtsZ G196A mutant (Table 2), suggesting that the chemical substitutions to this molecule are able to partially overcome the impact of the G196A mutation on the interaction between the ligand and the FtsZ target protein. At higher multiples of the MIC, the FOR decreased to ∼10−9 for S. aureus strain ATCC 29213, which is at the low end of the expected range for a single-target inhibitor. Taken together, these results suggest that further improvements in the resistance profiles of 3-MBA derivatives may be achievable through additional chemical optimization of the ligand scaffold. Both types of mutants isolated at the higher concentrations of compound 1 (FtsZ G196V and FtsZ I254T/N263I) were attenuated in vitro. Although the effects of these mutations on virulence have not been evaluated in vivo, the fitness burden imposed by them suggests that these two specific types of mutants are unlikely to be of clinical significance (46).
The absence of any observed interactions between compound 1 and antibiotics from a wide range of antibacterial classes (Table 3) is consistent with the novel mechanism of action of 3-MBA derivatives and the fact that none of the other molecules tested in the checkerboard assays inhibited FtsZ. It further suggests that compound 1 could be used in combination with any other antibiotic with no impact on the intrinsic antibacterial activity of either agent. A similar result was recorded for PC190723 (data not shown). Interestingly, under the experimental conditions reported here, neither compound was found to alter the susceptibility of S. aureus to β-lactam antibiotics, as was recently reported for PC190723 (33). We hypothesize that these divergent results are likely due to variances in the experimental conditions used, most probably the difference in the choice of S. aureus strain. Tan et al. (33) used a mecA-carrying MRSA isolate. In this study, however, strain ATCC 29213 was used for the checkerboard assays; S. aureus ATCC 29213 is a non-mecA-carrying strain. Experiments to clarify the biological basis of the observed differences in interactions between 3-MBA derivatives and β-lactam antibiotics for mecA-positive and -negative isolates of S. aureus are ongoing in our laboratory.
Compound 1 showed no signs of chemical instability under the conditions tested (Table 4). Furthermore, no degradation of the compound was observed in plasma or microsomes. The compound had a long half-life in mouse hepatocytes. These data indicate that compound 1 is chemically and metabolically stable. Compound 1 has favorable in vivo pharmacokinetic properties based on the measured total drug concentrations (Table 4). Following i.v. administration of a single 10-mg/kg dose to mice, compound 1 demonstrated good exposure, a half-life of >4 h, and a large volume of distribution, combined with a relatively low clearance. Bioavailability was high, as reported previously for PC190723 (35). In contrast, compound 2 was rapidly metabolized to compound 1 in vivo. The fast metabolism of compound 2 to compound 1 by mouse microsomes (with a half-life of less than 10 min) suggests that this is likely to be a major component of the rapid conversion that was observed in vivo. The pharmacokinetic profile of compound 1 observed following administration of compound 2 was similar to that observed when compound 1 was administered directly. The plasma exposure parameters following i.v. or p.o. dosing of compound 2 were similar, with the clearance (CL), half-life, area under the curve (AUC), and bioavailability being almost indistinguishable from those of compound 1. These data indicate that the in vivo conversion of the prodrug to the parental compound is swift and that compound 2 is not rapidly cleared before the conversion occurs.
Until the discovery of PC190723, there were no published reports of FtsZ inhibitors demonstrating in vivo efficacy. Compound PC190723 demonstrated excellent efficacy in a murine model of systemic S. aureus infection, with a reported ED50 of 10.2 mg/kg following i.v. administration (30). However, PC190723 was found not to be efficacious in the S. aureus thigh infection model (Biota Europe Ltd., unpublished data). The superior in vitro potency and pharmacokinetic profile of compound 1 prompted an evaluation of this compound in the more challenging thigh infection model. Preliminary experiments with compound 1 in a low-inoculum version of the model with three i.v. doses of 30 mg/kg indicated that compound 1 had the potential to deliver positive efficacy. Because of the intrinsic solubility limitations of compound 1, a prodrug strategy was used to enable the i.v. administration of higher doses of compound. With this approach, i.v. administration of compound 2 at up to 100 mg/kg was possible. Following administration of three 100-mg/kg doses of compound 2, a >99.9% decrease in the number of S. aureus cells recovered in the standard inoculum thigh model was achieved (Fig. 4). The high dose required to achieve this effect may be a function of the relatively high levels of protein binding of compound 1. To our knowledge, this is the first published report of an FtsZ inhibitor demonstrating positive efficacy when administered individually in the S. aureus thigh infection model.
In summary, compound 1 has enhanced potency against drug-resistant staphylococcal isolates, as well as inhibitory activity against a key FtsZ mutant. Compound 1, as well as its succinate prodrug compound 2, displays suitable pharmacokinetics and positive efficacy in two murine models of staphylococcal infection. These superior in vitro and in vivo properties provide evidence that the continued optimization of 3-MBA derivatives offers the potential for first-in-class therapies for the treatment of drug-resistant staphylococcal infections.
ACKNOWLEDGMENTS
This work was funded in part by an investment from The Wellcome Trust under the Seeding Drug Discovery Initiative.
We thank Steve Ruston and Simon Tucker for support and Kristy McCamley for advice during the preparation of the manuscript.
Footnotes
Published ahead of print 31 October 2012
REFERENCES
- 1. Infectious Diseases Society of America 2004. Bad bugs, no drugs: as antibiotic discovery stagnates, a public health crisis brews. Infectious Diseases Society of America, Alexandria, VA [Google Scholar]
- 2. Spellberg B, Guidos R, Gilbert D, Bradley J, Bucher HW, Scheld WM, Bartlett JG, Edwards J., Jr 2008. The epidemic of antibiotic-resistant infections: a call to arms for the medical community from the Infectious Diseases Society of America. Clin. Infect. Dis. 46:155–164 [DOI] [PubMed] [Google Scholar]
- 3. Fischbach MA, Walsh CT. 2009. Antibiotics for emerging pathogens. Science 325:1089–1093 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Rice LB. 2008. Federal funding for the study of antimicrobial resistance in nosocomial pathogens: no ESKAPE. J. Infect. Dis. 197:1079–1081 [DOI] [PubMed] [Google Scholar]
- 5. Boucher HW, Talbot GH, Bradley JS, Edwards JE, Gilbert D, Rice LB, Scheld M, Spellberg B, Bartlett J. 2009. Bad bugs, no drugs: no ESKAPE! An update from the Infectious Diseases Society of America. Clin. Infect. Dis. 48:1–12 [DOI] [PubMed] [Google Scholar]
- 6. Jabes D. 2011. The antibiotic R&D pipeline: an update. Curr. Opin. Microbiol. 14:564–569 [DOI] [PubMed] [Google Scholar]
- 7. Payne DJ, Gwynn MN, Holmes DJ, Pompliano DL. 2007. Drugs for bad bugs: confronting the challenges of antibacterial discovery. Nat. Rev. Drug Disc. 6:29–40 [DOI] [PubMed] [Google Scholar]
- 8. Awasthi D, Kumar K, Ojima I. 2011. Therapeutic potential of FtsZ inhibition: a patent perspective. Expert Opin. Ther. Patents 21:657–679 [DOI] [PubMed] [Google Scholar]
- 9. Czaplewski LG, Stokes NR, Ruston S, Haydon DJ. 2012. Antibacterial inhibitors of the essential cell division protein FtsZ, p 957–968 In Dougherty TJ, Pucci MJ. (ed), Antibiotic discovery and development. Springer, New York, NY [Google Scholar]
- 10. Lock RL, Harry EJ. 2008. Cell-division inhibitors: new insights for future antibiotics. Nat. Rev. Drug Disc. 7:324–338 [DOI] [PubMed] [Google Scholar]
- 11. Ma S, Ma S. 2012. The development of FtsZ inhibitors as potential antibacterial agents. ChemMedChem 7:1161–1172 [DOI] [PubMed] [Google Scholar]
- 12. Schaffner-Barbero C, Martín-Fontecha M, Chacón P, Andreu JM. 2012. Targeting the assembly of bacterial cell division protein FtsZ with small molecules. ACS Chem. Biol. 7:269–277 [DOI] [PubMed] [Google Scholar]
- 13. Vollmer W. 2006. The prokaryotic cytoskeleton: a putative target for inhibitors and antibiotics? Appl. Microbiol. Biotechnol. 73:37–47 [DOI] [PubMed] [Google Scholar]
- 14. Adams DW, Errington J. 2009. Bacterial cell division: assembly, maintenance and disassembly of the Z ring. Nat. Rev. Microbiol. 7:642–653 [DOI] [PubMed] [Google Scholar]
- 15. Errington J, Daniel RA, Scheffers D-J. 2003. Cytokinesis in bacteria. Microbiol. Mol. Biol. Rev. 67:52–65 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Beall B, Lutkenhaus J. 1991. FtsZ in Bacillus subtilis is required for vegetative septation and for asymmetric septation during sporulation. Genes Dev. 5:447–455 [DOI] [PubMed] [Google Scholar]
- 17. Dai K, Lutkenhaus J. 1991. ftsZ is an essential cell division gene in Escherichia coli. J. Bacteriol. 173:3500–3506 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Pinho MG, Errington J. 2003. Dispersed mode of Staphylococcus aureus cell wall synthesis in the absence of the division machinery. Mol. Microbiol. 50:871–881 [DOI] [PubMed] [Google Scholar]
- 19. Downing KH. 2000. Structural basis for the interaction of tubulin with proteins and drugs that affect microtubule dynamics. Annu. Rev. Cell Dev. Biol. 16:89–111 [DOI] [PubMed] [Google Scholar]
- 20. Löwe J, Amos LA. 1998. Crystal structure of the bacterial cell-division protein FtsZ. Nature 391:203–206 [DOI] [PubMed] [Google Scholar]
- 21. Nogales E, Wolf SG, Downing KH. 1998. Structure of the αβ tubulin dimer by electron crystallography. Nature 391:199–203 [DOI] [PubMed] [Google Scholar]
- 22. Margalit DN, Romberg L, Mets RB, Hebert AM, Mitchison TJ, Kirschner MW, RayChaudhuri D. 2004. Targeting cell division: small-molecule inhibitors of FtsZ GTPase perturb cytokinetic ring assembly and induce bacterial lethality. Proc. Natl. Acad. Sci. U. S. A. 101:11821–11826 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Stokes NR, Sievers J, Barker S, Bennett JM, Brown DR, Collins I, Errington VM, Foulger D, Hall M, Halsey R, Johnson H, Rose V, Thomaides HB, Haydon DJ, Czaplewski LG, Errington J. 2005. Novel inhibitors of bacterial cytokinesis identified by a cell-based antibiotic screening assay. J. Biol. Chem. 280:39709–39715 [DOI] [PubMed] [Google Scholar]
- 24. Wang J, Galgoci A, Kodali S, Herath KB, Jayasuriya H, Dorso K, Vicente F, González A, Cully D, Bramhill D, Singh S. 2003. Discovery of a small molecule that inhibits cell division by blocking FtsZ, a novel therapeutic target of antibiotics. J. Biol. Chem. 278:44424–44428 [DOI] [PubMed] [Google Scholar]
- 25. Läppchen T, Hartog AF, Pinas VA, Koomen G-J, den Blaauwen T. 2005. GTP analogue inhibits polymerization and GTPase activity of the bacterial protein FtsZ without affecting its eukaryotic homologue tubulin. Biochemistry 44:7879–7884 [DOI] [PubMed] [Google Scholar]
- 26. Paradis-Bleau C, Beaumont M, Sanschagrin F, Voyer N, Levesque RC. 2007. Parallel solid synthesis of inhibitors of the essential cell division FtsZ enzyme as a new potential class of antibacterials. Bioorg. Med. Chem. 15:1330–1340 [DOI] [PubMed] [Google Scholar]
- 27. Jennings LD, Foreman KW, Rush TS, III, Tsao DH, Mosyak L, Kincaid SL, Sukhdeo MN, Sutherland AG, Ding W, Kenny CH, Sabus CL, Liu H, Dushin EG, Moghazeh SL, Labthavikul P, Petersen PJ, Tuckman M, Haney SA, Ruzin AV. 2004. Combinatorial synthesis of substituted 3-(2-indolyl)piperidines and 2-phenyl indoles as inhibitors of ZipA-FtsZ interaction. Bioorg. Med. Chem. 12:5115–5131 [DOI] [PubMed] [Google Scholar]
- 28. Sutherland AG, Alvarez J, Ding W, Foreman KW, Kenny CH, Labthavikul P, Mosyak L, Petersen PJ, Rush TS, III, Ruzin A, Tsao DH, Wheless KL. 2003. Structure-based design of carboxybiphenylindole inhibitors of the ZipA-FtsZ interaction. Org. Biomol. Chem. 1:4138–4140 [DOI] [PubMed] [Google Scholar]
- 29. Tsao DH, Sutherland AG, Jennings LD, Li Y, Rush TS, III, Alvarez JC, Ding W, Dushin EG, Dushin RG, Haney SA, Kenny CH, Malakian AK, Nilakantan R, Mosyak L. 2006. Discovery of novel inhibitors of the ZipA/FtsZ complex by NMR fragment screening coupled with structure-based design. Bioorg. Med. Chem. 14:7953–7961 [DOI] [PubMed] [Google Scholar]
- 30. Haydon DJ, Stokes NR, Ure R, Galbraith G, Bennett JM, Brown DR, Baker PJ, Barynin VV, Rice DW, Sedelnikova SE, Heal JR, Sheridan JM, Aiwale ST, Chauhan PK, Srivastava A, Taneja A, Collins I, Errington J, Czaplewski LG. 2008. An inhibitor of FtsZ with potent and selective anti-staphylococcal activity. Science 321:1673–1675 [DOI] [PubMed] [Google Scholar]
- 31. Adams DW, Wu LJ, Czaplewski LG, Errington J. 2011. Multiple effects of benzamide antibiotics on FtsZ function. Mol. Microbiol. 80:68–84 [DOI] [PubMed] [Google Scholar]
- 32. Andreu JM, Schaffner-Barbero C, Huecas S, Alonso D, Lopez-Rodriguez ML, Ruiz-Avila LB, Núñez-Ramírez R, Llorca O, Martín-Galiano AJ. 2010. The antibacterial cell division inhibitor PC190723 is an FtsZ polymer-stabilizing agent that induces filament assembly and condensation. J. Biol. Chem. 285:14239–14246 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Tan CM, Therien AG, Lu J, Lee SH, Caron A, Gill CJ, Lebeau-Jacob C, Benton-Perdomo L, Monteiro JM, Pereira PM, Elsen NL, Wu J, Deschamps K, Petcu M, Wong S, Daigneault E, Kramer S, Liang L, Maxwell E, Claveau D, Vaillancourt J, Skorey K, Tam J, Wang H, Meredith TC, Sillaots S, Wang-Jarantow L, Ramtohul Y, Langlois E, Landry F, Reid JC, Parthasarathy G, Sharma S, Baryshnikova A, Lumb KJ, Pinho MG, Soisson SM, Roemer T. 2012. Restoring methicillin-resistant Staphylococcus aureus susceptibility to β-lactam antibiotics. Sci. Transl. Med. 4:126ra35 doi:10.1126/scitranslmed.3003592 [DOI] [PubMed] [Google Scholar]
- 34. Czaplewski LG, Collins I, Boyd EA, Brown D, East SP, Gardiner M, Fletcher R, Haydon DJ, Henstock V, Ingram P, Jones C, Noula C, Kennison L, Rockley C, Rose V, Thomaides-Brears HB, Ure R, Whittaker M, Stokes NR. 2009. Antibacterial alkoxybenzamide inhibitors of the essential bacterial cell division protein FtsZ. Bioorg. Med. Chem. Lett. 19:524–527 [DOI] [PubMed] [Google Scholar]
- 35. Haydon DJ, Bennett JM, Brown D, Collins I, Galbraith G, Lancett P, Macdonald R, Stokes NR, Chauhan PK, Sutariya JK, Nayal N, Srivastava A, Beanland J, Hall R, Henstock V, Noula C, Rockley C, Czaplewski L. 2010. Creating an antibacterial with in vivo efficacy: synthesis and characterization of potent inhibitors of the bacterial cell division protein FtsZ with improved pharmaceutical properties. J. Med. Chem. 53:3927–3936 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Ohashi Y, Chijiiwa Y, Suzuki K, Takahashi K, Nanamiya H, Sato T, Hosoya Y, Ochi K, Kawamura F. 1999. The lethal effect of a benzamide derivative, 3-methoxybenzamide, can be suppressed by mutations within a cell division gene, ftsZ, in Bacillus subtilis. J. Bacteriol. 181:1348–1351 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Clinical and Laboratory Standards Institute 2006. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically: approved standard, 7th ed CLSI document M7-A7. Clinical and Laboratory Standards Institute, Wayne, PA [Google Scholar]
- 38. Pillai SK, Moellering RC, Jr, Eliopoulos GM. 2005. Antimicrobial combinations, p 365–440 In Lorian V. (ed), Antibiotics in laboratory medicine. Lippincott Williams & Wilkins, Philadelphia, PA [Google Scholar]
- 39. Odds FC. 2003. Synergy, antagonism, and what the chequerboard puts between them. J. Antimicrob. Chemother. 52:1. [DOI] [PubMed] [Google Scholar]
- 40. Vickers AA, O'Neill AJ, Chopra I. 2007. Emergence and maintenance of resistance to fluoroquinolones and coumarins in Staphylococcus aureus: predictions from in vitro studies. J. Antimicrob. Chemother. 60:269–273 [DOI] [PubMed] [Google Scholar]
- 41. Domadia P, Swarup S, Bhunia A, Sivaraman J, Dasgupta D. 2007. Inhibition of bacterial cell division protein FtsZ by cinnamaldehyde. Biochem. Pharmacol. 74:831–840 [DOI] [PubMed] [Google Scholar]
- 42. Ito H, Ura A, Oyamada Y, Tanitame A, Yoshida H, Yamada S, Wachi M, Yamagishi J. 2006. A 4-aminofurazan derivative—A189—inhibits assembly of bacterial cell division protein FtsZ in vitro and in vivo. Microbiol. Immunol. 50:759–764 [DOI] [PubMed] [Google Scholar]
- 43. Urgaonkar S, La Pierre HS, Meir I, Lund H, RayChaudhuri D, Shaw JT. 2005. Synthesis of antimicrobial natural products targeting FtsZ: (±)-dichamanetin and (±)-2′″-hydroxy-5″-benzylisouvarinol-B. Org. Lett. 7:5609–5612 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Silver LL. 2011. Challenges of antibacterial discovery. Clin. Microbiol. Rev. 24:71–109 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. O'Neill AJ, Chopra I. 2004. Preclinical evaluation of novel antibacterial agents by microbiological and molecular techniques. Expert Opin. Investig. Drugs 13:1045–1063 [DOI] [PubMed] [Google Scholar]
- 46. Andersson DI, Levin BR. 1999. The biological cost of antibiotic resistance. Curr. Opin. Microbiol. 2:489–493 [DOI] [PubMed] [Google Scholar]