Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2013 Jan;57(1):603–605. doi: 10.1128/AAC.01243-12

Innate Aminoglycoside Resistance of Achromobacter xylosoxidans Is Due to AxyXY-OprZ, an RND-Type Multidrug Efflux Pump

Julien Bador 1, Lucie Amoureux 1, Emmanuel Blanc 1, Catherine Neuwirth 1,
PMCID: PMC3535963  PMID: 23089757

Abstract

Achromobacter xylosoxidans is an innately multidrug-resistant pathogen which is emerging in cystic fibrosis (CF) patients. We characterized a new resistance-nodulation-cell division (RND)-type multidrug efflux pump, AxyXY-OprZ. This system is responsible for the intrinsic high-level resistance of A. xylosoxidans to aminoglycosides (tobramycin, amikacin, and gentamicin). Furthermore, it can extrude cefepime, carbapenems, some fluoroquinolones, tetracyclines, and erythromycin. Some of the AxyXY-OprZ substrates are major components widely used to treat pulmonary infections in CF patients.

TEXT

Achromobacter xylosoxidans is an opportunistic human pathogen (1, 2) that is increasingly isolated from the respiratory tract of cystic fibrosis (CF) patients (35). Recent studies underscore its probable involvement in the inflammatory response and in the decline of the lung function (6, 7). This species exhibits innate resistance to many antibiotics, including cephalosporins (except ceftazidime), aztreonam, and aminoglycosides (1, 810). Clinical strains frequently harbor acquired resistances, especially to ceftazidime, ciprofloxacin, and carbapenems. We have recently described the first resistance-nodulation-cell division (RND)-type multidrug efflux pump in A. xylosoxidans, AxyABM (11). This system shares some properties with the Pseudomonas aeruginosa MexAB-OprM efflux pump: AxyABM can extrude cephalosporins (except cefepime), fluoroquinolones, and chloramphenicol. Moreover, AxyABM plays a major role in the innate resistance to aztreonam. Nevertheless, the mechanism(s) leading to aminoglycoside and cefepime resistance remain(s) unknown. It is likely that other efflux systems contribute to the antibiotic resistance of A. xylosoxidans, since the use of reserpine, an efflux pump inhibitor, leads to decreased MICs of tetracyclines, which are not substrates of AxyABM (11).

We have determined the whole-genome shotgun sequence of the A. xylosoxidans AXX-A strain (GenBank accession number AFRQ01000000). We examined this sequence looking for homology with mexX and mexY from P. aeruginosa, given that the MexXY/OprM efflux system has been shown to extrude aminoglycosides, cefepime, tetracyclines, fluoroquinolones, macrolides, and chloramphenicol (1215). The MexY RND transporter from P. aeruginosa interacts with the periplasmic protein MexX and the outer membrane channel OprM that is encoded by the mexAB-oprM multidrug efflux operon. The expression of mexXY is complex and governed by several regulatory mechanisms. One of them is negative regulation by the product of the mexZ gene located upstream from mexX (12, 16). By using the BLAST program (http://blast.ncbi.nlm.nih.gov/Blast.cgi), we detected 3 putative genes in the AXX-A genome (contig 71, GenBank accession number AFRQ01000061.1), designated axyZ, axyX, and axyY, sharing 67, 67, and 77% nucleotide similarity with mexZ, mexX, and mexY, respectively. Downstream from axyY, we found another open reading frame (ORF), oprZ, encoding a probable outer membrane protein. The aim of our study was to evaluate the involvement of this putative RND-type efflux pump in the multidrug resistance of A. xylosoxidans.

In this work, we studied three clinical isolates of A. xylosoxidans: AXX-A, AXX-D, and AXX-H. The strains were identified by using the API20NE system (bioMérieux, Marcy l'Etoile, France) and by sequencing of the rrs gene. Susceptibility testing was performed by Etest (bioMérieux, Marcy l'Etoile, France) and interpreted according to the breakpoints defined by the European Committee on Antimicrobial Susceptibility Testing (http://www.eucast.org/clinical_breakpoints/). AXX-A harbors a wild-type antibiotic resistance phenotype, AXX-D an acquired resistance to ceftazidime and fluoroquinolones, and AXX-H an acquired resistance to ceftazidime, fluoroquinolones, and carbapenems (Table 1). In these strains, we have inactivated axyY, encoding the transporter component. For this purpose, the primers INA-axyY-F and INA-axyY-R (Table 2) were designed to amplify a 755-bp region of axyY (nucleotide positions from 1696 to 2450). The PCR product was cloned into the pUC19 vector by using the In-Fusion HD cloning kit (Clontech Laboratories, Mountain View, CA) as recommended by the manufacturer. Newly constructed plasmids (pINA-axyY-AXX-A, pINA-axyY-AXX-D, and pINA-axyY-AXX-H) were used as suicide vectors. They were introduced into each strain by electroporation. Recombinant clones (axyY::Tic) named AXX-A-ΔY, AXX-D-ΔY, and AXX-H-ΔY were selected on Mueller-Hinton agar plates containing 50 μg/ml of ticarcillin. The disruption of axyY in each strain was confirmed by PCR and DNA sequencing (primer pairs V-INA-axyY-F/M14R and M14F/V-INA-axyY-R).

Table 1.

MICs of 22 antibiotics for clinical strains and axyY::Tic mutants

Antibiotic MIC (μg/ml) for straina:
AXX-A AXX-A-ΔY AXX-D AXX-D-ΔY AXX-H AXX-H-ΔY
Ticarcillinb 0.25 >256 0.25 >256 0.25 >256
Tobramycin 16 1.5 (10) 24 0.5 (48) 32 1 (32)
Amikacin 256 2 (128) 96 0.25 (384) >256 3 (>85)
Netilmicin 32 2 (16) 64 0.75 (85) 192 1 (192)
Gentamicin 48 1 (48) 12 0.094 (127) 48 0.75 (64)
Kanamycin 32 2 (16) >256 3 (>85) >256 12 (>21)
Ceftazidime 4 2 (2) 48 24 (2) 48 24 (2)
Cefepime 16 8 (2) >256 24 (>10) >256 >256
Imipenem 1 0.5 (2) 1.5 1 (1.5) 4 1 (4)
Meropenem 0.094 0.047 (2) 0.064 0.032 (2) 12 2 (6)
Doripenem 0.19 0.047 (4) 0.25 0.19 (1.3) 16 1.5 (10)
Tetracycline 48 12 (4) >256 32 (>8) >256 >256
Doxycycline 8 3 (2.7) 48 12 (4) 128 24 (5)
Tigecycline 4 0.75 (5.3) 8 1 (8) 6 2 (3)
Nalidixic Acid 24 12 (2) >256 >256 >256 >256
Norfloxacin 8 4 (2) >256 24 (>10) >256 128 (>2)
Ofloxacin 2 1.5 (1.3) >32 24 (>1.3) >32 >32
Levofloxacin 0.75 0.75 (1) 16 4 (4) >32 8 (>4)
Moxifloxacin 1.5 1 (1.5) >32 2 (>16) >32 24 (>1.3)
Ciprofloxacin 0.75 0.5 (1.5) >32 3 (>10) >32 8 (>4)
Chloramphenicol 12 8 (1.5) >256 >256 >256 192 (>1.3)
Erythromycin 64 16 (4) >256 6 (>42) >256 >256
a

Values in parentheses represent the relative MIC decreases (ratio of the MIC for the parent strain to the MIC for the mutant strain).

b

The ticarcillin resistance observed in the mutants is caused by the production of the penicillinase encoded by the bla gene from the pUC19 vector.

Table 2.

Primers used in the study

Primer Nucleotide sequence (5′–3′)
INA-axyY-F CGGTACCCGGGGATCCAGGGCAGCTTCATGGCCATa
INA-axyY-R CGACTCTAGAGGATCGGGAAGCCGTTGTAGCGGTTa
V-INA-axyY-F CGCCTGACCACGCGCTATA
M14Fb CCAGGGTTTTCCCAGTCACGA
M14Rb GCGGATAACAATTTCACACAGGA
V-INA-axyY-R CGGACAGCCGCTCTTCGTA
oprZ-F CACGCTCAAGCTGACCCA
oprZ-R CCTCCAGCATCTCCAGGT
a

Underlined sequences comprise 15 bases of homology with the ends of the linearized vector pUC19.

b

M14F and M14R are primers designed in suicide plasmids.

The axyY inactivation led to decreased MICs of aminoglycosides, carbapenems, cefepime, some fluoroquinolones, tetracyclines, erythromycin, and to a lesser extent, ceftazidime (Table 1). The activities of all aminoglycosides tested were substantially enhanced. Susceptibility to tobramycin, amikacin, netilmicin, and gentamicin was restored for all strains. The activities of carbapenems were slightly enhanced in the mutants AXX-A-ΔY and AXX-D-ΔY compared with their activities in the original strains, AXX-A and AXX-D. Interestingly, the MICs of meropenem and doripenem were decreased 6-fold and 10-fold, respectively, after axyY disruption in the carbapenem-resistant strain AXX-H. This suggests that AxyXY-OprZ might lead to acquired resistance to carbapenems. Nevertheless, the MIC values of meropenem and doripenem for AXX-H-ΔY, 2 and 1.5 μg/ml, respectively, were still more elevated than those for AXX-A and AXX-D. It is likely that other mechanisms are involved in the residual carbapenem resistance of AXX-H-ΔY. Concerning the cephalosporins, we observed that axyY inactivation resulted in a 2-fold decrease of the ceftazidime MIC, whatever the resistance level in parent strains. The activity of cefepime was partially restored in AXX-D-ΔY but not in AXX-H-ΔY, suggesting the association of various mechanisms of resistance. Finally, AxyXY-OprZ can also extrude tetracyclines, some fluoroquinolones, and erythromycin, which are also substrates of MexXY/OprM. The restoration of the original drug resistance phenotypes was observed in spontaneous revertants obtained by culturing mutant strains without ticarcillin.

AxyXY-OprZ from A. xylosoxidans and MexXY/OprM from P. aeruginosa have common substrates. This is consistent with the high amino acid sequence similarity observed between the transporters AxyY and MexY (73%), the transporter component being responsible for substrate recognition of the RND-type efflux systems (17). Nevertheless, AxyXY-OprZ confers a much higher level of resistance to aminoglycosides than MexXY-OprM in wild strains. It has recently been reported for some aminoglycoside-resistant strains of P. aeruginosa that mexX and mexY are linked to the oprA gene in the same operon and that MexXY can utilize either OprM or OprA to form drug efflux complexes (18). Such an operon, including an oprA gene, has been also described in Burkholderia pseudomallei, a species intrinsically highly resistant to aminoglycosides due to expression of the AmrAB-OprA efflux pump (19). The oprZ gene that we detected in the three strains studied (primers oprZ-F and oprZ-R) seems to be a homologue of the oprA genes from P. aeruginosa and B. pseudomallei (71% nucleotide identity and 57% amino acid identity). We plan to assess the contribution of OprZ to the high level of resistance to aminoglycosides.

In conclusion, we have demonstrated that AxyXY-OprZ confers on A. xylosoxidans a broad spectrum of antimicrobial agent resistance. The most interesting finding is that AxyXY-OprZ confers on A. xylosoxidans its intrinsic high level of resistance to aminoglycosides. Our results suggest the involvement of AxyXY-OprZ in acquired resistance to carbapenems and fluoroquinolones that are major antimicrobial components for the treatment of pulmonary infections in CF patients. This will be supported by further studies that will include more clinical isolates.

ACKNOWLEDGMENT

We acknowledge the contribution of Gael Belliot for revising the manuscript.

Footnotes

Published ahead of print 22 October 2012

REFERENCES

  • 1. Aisenberg G, Rolston KV, Safdar A. 2004. Bacteremia caused by Achromobacter and Alcaligenes species in 46 patients with cancer (1989-2003). Cancer 101:2134–2140 [DOI] [PubMed] [Google Scholar]
  • 2. Tena D, Gonzalez-Praetorius A, Perez-Balsalobre M, Sancho O, Bisquert J. 2008. Urinary tract infection due to Achromobacter xylosoxidans: report of 9 cases. Scand. J. Infect. Dis. 40:84–87 [DOI] [PubMed] [Google Scholar]
  • 3. De Baets F, Schelstraete P, Van Daele S, Haerynck F, Vaneechoutte M. 2007. Achromobacter xylosoxidans in cystic fibrosis: prevalence and clinical relevance. J. Cyst. Fibros. 6:75–78 [DOI] [PubMed] [Google Scholar]
  • 4. Razvi S, Quittell L, Sewall A, Quinton H, Marshall B, Saiman L. 2009. Respiratory microbiology of patients with cystic fibrosis in the United States, 1995 to 2005. Chest 136:1554–1560 [DOI] [PubMed] [Google Scholar]
  • 5. Ridderberg W, Bendstrup KE, Olesen HV, Jensen-Fangel S, Norskov-Lauritsen N. 2011. Marked increase in incidence of Achromobacter xylosoxidans infections caused by sporadic acquisition from the environment. J. Cyst. Fibros. 10:466–469 [DOI] [PubMed] [Google Scholar]
  • 6. Hansen CR, Pressler T, Nielsen KG, Jensen PO, Bjarnsholt T, Hoiby N. 2010. Inflammation in Achromobacter xylosoxidans infected cystic fibrosis patients. J. Cyst. Fibros. 9:51–58 [DOI] [PubMed] [Google Scholar]
  • 7. Mantovani RP, Levy CE, Yano T. 2012. A heat-stable cytotoxic factor produced by Achromobacter xylosoxidans isolated from Brazilian patients with CF is associated with in vitro increased proinflammatory cytokines. J. Cyst. Fibros. 11:305–311 [DOI] [PubMed] [Google Scholar]
  • 8. Almuzara M, Limansky A, Ballerini V, Galanternik L, Famiglietti A, Vay C. 2010. In vitro susceptibility of Achromobacter spp. isolates: comparison of disk diffusion, Etest and agar dilution methods. Int. J. Antimicrob. Agents 35:68–71 [DOI] [PubMed] [Google Scholar]
  • 9. Glupczynski Y, Hansen W, Freney J, Yourassowsky E. 1988. In vitro susceptibility of Alcaligenes denitrificans subsp. xylosoxidans to 24 antimicrobial agents. Antimicrob. Agents Chemother. 32:276–278 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Saiman L, Chen Y, Tabibi S, San Gabriel P, Zhou J, Liu Z, Lai L, Whittier S. 2001. Identification and antimicrobial susceptibility of Alcaligenes xylosoxidans isolated from patients with cystic fibrosis. J. Clin. Microbiol. 39:3942–3945 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Bador J, Amoureux L, Duez JM, Drabowicz A, Siebor E, Llanes C, Neuwirth C. 2011. First description of an RND-type multidrug efflux pump in Achromobacter xylosoxidans, AxyABM. Antimicrob. Agents Chemother. 55:4912–4914 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Aires JR, Kohler T, Nikaido H, Plesiat P. 1999. Involvement of an active efflux system in the natural resistance of Pseudomonas aeruginosa to aminoglycosides. Antimicrob. Agents Chemother. 43:2624–2628 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Masuda N, Sakagawa E, Ohya S, Gotoh N, Tsujimoto H, Nishino T. 2000. Substrate specificities of MexAB-OprM, MexCD-OprJ, and MexXY-oprM efflux pumps in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 44:3322–3327 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Mine T, Morita Y, Kataoka A, Mizushima T, Tsuchiya T. 1999. Expression in Escherichia coli of a new multidrug efflux pump, MexXY, from Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 43:415–417 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Muller C, Plesiat P, Jeannot K. 2011. A two-component regulatory system interconnects resistance to polymyxins, aminoglycosides, fluoroquinolones, and beta-lactams in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 55:1211–1221 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Matsuo Y, Eda S, Gotoh N, Yoshihara E, Nakae T. 2004. MexZ-mediated regulation of mexXY multidrug efflux pump expression in Pseudomonas aeruginosa by binding on the mexZ-mexX intergenic DNA. FEMS Microbiol. Lett. 238:23–28 [DOI] [PubMed] [Google Scholar]
  • 17. Mao W, Warren MS, Black DS, Satou T, Murata T, Nishino T, Gotoh N, Lomovskaya O. 2002. On the mechanism of substrate specificity by resistance nodulation division (RND)-type multidrug resistance pumps: the large periplasmic loops of MexD from Pseudomonas aeruginosa are involved in substrate recognition. Mol. Microbiol. 46:889–901 [DOI] [PubMed] [Google Scholar]
  • 18. Morita Y, Tomida J, Kawamura Y. 2012. Primary mechanisms mediating aminoglycoside resistance in the multidrug-resistant Pseudomonas aeruginosa clinical isolate PA7. Microbiology 158:1071–1083 [DOI] [PubMed] [Google Scholar]
  • 19. Moore RA, DeShazer D, Reckseidler S, Weissman A, Woods DE. 1999. Efflux-mediated aminoglycoside and macrolide resistance in Burkholderia pseudomallei. Antimicrob. Agents Chemother. 43:465–470 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES