Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Jan 8.
Published in final edited form as: Mol Microbiol. 2011 Mar 3;80(2):455–470. doi: 10.1111/j.1365-2958.2011.07582.x

Two capsular polysaccharides enable Bacillus cereus G9241 to cause anthrax-like disease

So-Young Oh 1,2, Jonathan M Budzik 1, Gabriella Garufi 1,2, Olaf Schneewind 1,2,*
PMCID: PMC3538873  NIHMSID: NIHMS286524  PMID: 21371137

Summary

Bacillus cereus G9241 causes an anthrax-like respiratory illness in humans, however the molecular mechanisms of disease pathogenesis are not known. Genome sequencing identified two putative virulence plasmids proposed to provide for anthrax toxin (pBCXO1) and/or capsule expression (pBC218). We report here that B. cereus G9241 causes anthrax-like disease in immune-competent mice, which is dependent on each of the two virulence plasmids. pBCXO1 encodes pagA1, the homolog of anthrax protective antigen, as well as hasACB, providing for hyaluronic acid capsule formation, two traits that each contribute to disease pathogenesis. pBC218 harbors bpsX-H, Bacillus cereus exo-polysaccharide, which produce a second capsule. During infection, B. cereus G9241 elaborates both hasACB and bpsX-H capsules, which together are essential for the establishment of anthrax-like disease and the resistance of bacilli to phagocytosis. A single nucleotide deletion causes premature termination of hasA translation in B. anthracis, which is known to escape phagocytic killing by its pXO2 encoded poly-D-γ-glutamic acid (PDGA) capsule. Thus, multiple different gene clusters endow pathogenic bacilli with capsular material, provide for escape from innate host immune responses and aid in establishing the pathogenesis of anthrax-like disease.

Introduction

Bacillus cereus and Bacillus anthracis are close relatives and belong to the Bacillus cereus sensu lato group (Jensen et al., 2003). B. anthracis is unique among the B. cereus group due to its ability to cause anthrax in many different animal and human hosts (Koch, 1876). Anthrax is transmitted by introduction of spores into host tissues, which germinate and replicate as vegetative forms throughout many organ systems with some tropism for the spleen (Koch, 1876, Mock & Fouet, 2001). All clinical isolates of B. anthracis harbor two large plasmids, pXO1 and pXO2, that are each required for virulence (Green et al., 1985, Uchida et al., 1986). pXO1 encodes genes for three secreted products, protective antigen (pag) (Vodkin & Leppla, 1983), lethal factor (lef) (Robertson & Leppla, 1986) and edema factor (cya) (Leppla, 1982), that function as anthrax toxins to modulate innate immune responses or promote tissue edema (Leppla, 2000). Once bound to receptors on the surface of host cells (Bradley et al., 2001, Scobie et al., 2003), protective antigen (PA) is cleaved, triggering assembly of a heptameric or octameric pore and initiating transport of lethal factor or edema factor into host cells (Milne et al., 1994, Milne et al., 1995, Young & Collier, 2007, Kintzer et al., 2009). pXO2 provides for expression of the poly-D-γ-glutamic acid (PDGA) capsule (Preisz, 1909, Green et al., 1985), which confers bacterial resistance to opsonophagocytic clearance during infection (Tomcsik & Szongott, 1933, Drysdale et al., 2005). Most B. cereus isolates lack anthrax toxins and PDGA capsule plasmids and cause serious human disease only in immune-compromised individuals or following consumption of contaminated foods (Drobniewski, 1993).

B. cereus G9241 has been isolated from severe human lung infections whose clinical presentation resembled that of inhalational anthrax (wool sorters disease) (Hoffmaster et al., 2006). Of note, these infections occurred in welders, who may be predisposed to B. cereus G9241 infection due to work-related physical lung injuries, i.e. the inhalation of hot or toxic fumes (Hoffmaster et al., 2006). Genome sequencing of B. cereus G9241 revealed the presence of two putative virulence plasmids, pBCXO1 and pBC218 as well as linear episomal DNA encoding prophage (pBClin29) (Hoffmaster et al., 2004). pBCXO1 exhibits high level of synteny with pXO1 and harbors the complete set of genes for anthrax toxins (pagA1, lef1, cya1) and associated regulatory factors (atxA1). pBC218 and pBClin29 are unique and do not display synteny to pXO1, pXO2 or any other known B. cereus group plasmid (Hoffmaster et al., 2004). Similar to B. anthracis, B. cereus G9241 elaborates capsular material, however this structure does not react with PDGA-specific antibodies and pBC218 does not encode capBCDAE, the pXO2 operon responsible for PDGA synthesis in B. anthracis (Hoffmaster et al., 2004, Candela & Fouet, 2006). To date, virulence of B. cereus G9241 has been assessed in immune-compromised A/J mice (Hoffmaster et al., 2004). These animals are defective in complement-mediated phagocytosis and succumb even to challenge with the non-encapsulated anthrax-vaccine strain, B. anthracis Sterne (pXO1+, pXO2-) (Welkos et al., 1986, Welkos et al., 1989, Sterne, 1937).

We show here that B. cereus G9241 causes anthrax-like disease in immune-competent C57BL/6 mice and that the pathogenesis of this disease depends on each of its two plasmids, pBCXO1 as well as pBC218. The contributions of pBCXO1 can be explained by the requirement of anthrax toxin (pagA1) and hyaluronic acid (HA) capsule genes (hasACB) for virulence, that of pBC218 by the B. cereus exo-polysaccharide operon (bpsX-H). During infection, B. cereus elaborates both capsules, HA and BPS, and variants that lack the hasACB and bpsX-H operons appear avirulent. We conclude that multiple types of capsule allow bacilli to escape phagocytic clearance, thereby enabling the pathogenesis of anthrax-like disease.

Results

Bacillus cereus G9241 causes lethal infections in mice

Earlier studies demonstrated the lethality of B. cereus G9241 infection in immune-compromised A/J mice (Hoffmaster et al., 2004). We sought to determine the 50% lethal dose (LD50) of B. cereus G9241 in this animal model. A/J mice were infected by intraperitoneal injection with spores of B. cereus G9241 or the avirulent environmental isolate ATCC 14579 (Ivanova et al., 2003), ranging from 101 to 105 CFU. Depending on the number of spores administered, mice infected with the G9241 strain died as early as day 2 and continued to die as late as day 7 (Fig. 1A). The intraperitoneal LD50 (Reed & Muench, 1938) of B. cereus G9241 spores in A/J mice was 381 spores, which is approximately 10 fold lower than that of B. anthracis strain Sterne (pXO1+, pXO2-) (Gaspar et al., 2005). All organs (spleen, kidney, liver, and lungs) sampled from infected mice carried high numbers of B. cereus G9241 vegetative forms (data not shown).

Fig. 1.

Fig. 1

Open in a new tab

Virulence of B. cereus G9241 in mice.

A. Survival of A/J mice after intraperitoneal (i.p.) injection of either B. cereus G9241 (empty symbols) or B. cereus ATCC14579 (filled symbol). Cohorts of ten mice were infected with each dose of strains denoted in the legend. Animal survival was monitored over 14 days, after which time all mice inoculated with B. cereus ATCC14579 remained alive.

B. Survival of C57BL/6 mice (cohorts of ten mice) following intraperitoneal injection of either the B. cereus G9241 (empty symbols) or B. cereus ATCC14579 strain (filled symbol).

C. The bacterial load in various organ tissues of 8 mice infected with 1×104 spores. Mice found dead or moribund were subjected to necropsy and collected organs were homogenized. Homogenates were serially diluted and plated on agar followed by enumerating colony forming units (CFU). The bars represent the arithmetic mean CFU values.

We evaluated the virulence of B. cereus G9241 spores following intraperitoneal infection of C57BL/6 mice, an inbred strain of immune-competent animals. Depending on the number of spores introduced (1×102, 1×103, 1×104, or 1×105 CFU), mice died as early as day 2 (1×104, 1×105 CFU) or as late as day 6 (1×103 CFU) (Fig. 1B). All animals infected with 1×102 CFU survived the challenge (Fig. 1B). The calculated LD50 was 2,710 spores, a value that is 7 fold higher than the LD50 dose of G9241 in A/J mice (Fig. 1A) and 10 fold higher than the LD50 dose of the fully virulent B. anthracis Ames in C57BL/6 animals (G. Garufi, unpublished observation). Moribund mice remained asymptomatic until approximately 12 to 24 hours prior to death. Most mice developed clinical symptoms, including a gradual decrease in activity, labored gait, loss of abdominal muscle tone tension, and edematous swelling near the site of inoculation (data not shown).

Anthrax-like disease of Bacillus cereus G9241 infected mice

We assessed the ability of 1×104 spores of B. cereus G9241 to disseminate from the site of infection following intraperitoneal injection of mice. Moribund animals were euthanized, necropsied and CFU in lung, liver, spleen and kidney tissues determined. When the spleen or lung tissue homogenates were heated at 68°C for 30 min, CFU decreased by > 5 log10 (data not shown). Bacilli were found in every organ examined, albeit that the loads differed between these tissues (Fig. 1C). The average bacterial load was greatest in the spleen, often exceeding 109 CFU per organ, while the fewest numbers of bacteria were observed in the kidneys (Fig. 1C). Typical necropsy findings included splenic enlargement (Fig. 2A), dense, dark red appearance of splenic and liver tissues, and a gelatinous exsudate in the peritoneal cavity (data not shown). Lungs from infected animals had a reddish hue in contrast to the light pink lungs from uninfected controls (data not shown). Several moribund mice carried multiple dark spots on the lung surface, suggesting hemorrhage in the underlying parenchyma.

Fig. 2.

Fig. 2

Open in a new tab

Histopathology examination of spleen and lung tissues from mice infected with 1×105 spores of B. cereus G9241.

Mice found dead were subjected to necropsy and tissues removed, fixed with formalin, thin sectioned and stained with hematoxylin-eosin. The top images on the left and right represent a low-magnification view, while the lower images display higher magnification of the same sample. Green arrowheads identify leukocytes. Image of spleen homogenate stained with India ink was inserted in E.

A, C, E. Histopathology of spleen tissues from mice infected with B. cereus G9241.

B, D, F. Histopathology of lung tissues from mice infected with B. cereus G9241.

G. Histopathology of spleen tissue from non-infected control mouse.

H. Histopathology of lung tissue from non-infected control mouse.

Histopathological examination of splenic tissues from B. cereus G9241-infected mice revealed depletion of the red pulp and splenomegaly (Fig. 2A). The majority of bacilli in spleen tissues appeared as single or duplex rods surrounded by unstained material (Fig. 2C), which was due to the synthesis of capsule by these bacteria (Fig. 2E, inset). Leukocytes were found surrounding the bacilli (Fig. 2C, E). The lungs of mice infected by intraperitoneal injection exhibited areas of focal inflammation and replication of B. cereus G9241 vegetative forms, suggestive of a secondary pneumonia (Fig. 2B, D). Microcolonies of bacilli were observed in capillaries and occasionally in alveolar spaces but without significant immune cell infiltrates of the parenchyma (Fig. 2D, F). All bacilli observed in spleen or lung tissues were surrounded by capsular material as measured by India ink exclusion (see Fig. 2E for a representative example).

pBCXO1, pBC218 or protective antigen mutants of B. cereus G9241

To assess the contribution of toxins to the pathogenesis of B. cereus G9241, we deleted the protective antigen gene (ΔpagA1) of pBCXO1 (99.7% identity with B. anthracis pagA); a homolog, pagA2 (70% identity to pagA) is located on pBC218 (Hoffmaster et al., 2004). The functional significance of two pagA genes in B. cereus G9241 has not yet been appreciated. During the process of generating the ΔpagA1 deletion via allelic replacement, we also isolated G9241 variants cured of either pBCXO1 (ΔpBCXO1) or pBC218 (ΔpBC218). The presence or absence of pBCXO1 and pBC218 in wild-type and mutant B. cereus strains was verified by PCR analysis using primers specific for genes on either pBCXO1, pBC218 or pBClin29 (Fig. 3A).

Fig. 3.

Fig. 3

Open in a new tab

B. cereus G9241 mutants lacking pBCX01, pBC218 or pagA1.

A. Molecular genetic tools were developed that permitted the deletion of pagA1 from pBCX01 or the loss of pBCX01 and pBC218 from strain G9241, which was confirmed by sequencing PCR products derived with primers specific for the flanking region of pagA1. PCR amplification of two genes on pBCXO1, pBC218 and pBClin29 were performed to assess the presence of plasmids.

B. Immunoblotting was performed to detect PA secretion into the culture medium or BslA and SrtA expression in extracts of bacilli. PA and BslA immune-reactive signals were not detectable without 0.8% bicarbonate induction (data not shown).

C. B. cereus G9241 capsule expression was detected by microscopy of India ink stained samples following bacterial growth in heart infusion broth with 50% fetal bovine serum (HIBFBS) at 37°C for 4 hours. The data are representative of similar results obtained with two independent experiments.

The supernatants of B. cereus cultures grown in the presence of bicarbonate were analyzed by immunoblotting with rabbit antibodies specific for PA. Under these conditions, the wild-type parent strain G9241 and the ΔpBC218 variant, but not the ΔpagA1 and ΔpBCXO1 mutants, were found to produce immune-reactive signals in culture supernatants when probed with PA-specific antisera (Fig. 3B). As a test for the expression of BslA, the anthrax adhesin encoded by pXO1 (Kern & Schneewind, 2008), we subjected extracts of bacilli to immunoblotting with rabbit anti-BslA (Kern & Schneewind, 2009). Wild-type G9241, the ΔpagA1 and ΔpBC218 variants expressed BslA, whereas the ΔpBCXO1 mutant did not (Fig. 3B). As a control, wild-type and mutant B. cereus G9241 express sortase A (SrtA), the chromosomally encoded transpeptidase responsible for protein anchoring to the bacterial cell wall envelope (Gaspar et al., 2005). Taken together, these data confirm our assignment of ΔpBCXO1, ΔpBC218, and ΔpagA1 mutant strains.

To examine capsule production, B. cereus G9241 strains were grown in heart infusion broth (HIB) with 50% FBS (HIBFBS), stained with India ink and analyzed by microscopy (Fig. 3C). Wild-type strain G9241 as well as the ΔpagA1 and ΔpBC218 mutants produced similar amounts of capsule (Fig. 3C). In contrast, the ΔpBCXO1 mutant did not elaborate a capsule (Fig. 3C). This was an unexpected result, as pBC218, not pBCXO1, had been proposed to represent the capsule producing plasmid of B. cereus G9241 (Hoffmaster et al., 2004).

Impact of plasmid or protective antigen loss on B. cereus G9241-mediated anthrax

To assess the effect of B. cereus G9241 toxins, capsule or virulence plasmids on disease pathogenesis, similar doses of spores derived from wild-type or mutant strains were injected into the peritoneal cavity of C57BL/6 mice (30 LD50 equivalents for the wild-type strain). All animals challenged with 1×105 CFU spores of the wild-type G9241 succumbed to infection within 60 hours (Fig. 4A). In contrast, the ΔpBCXO1 mutant failed to cause lethal disease at this dose. Animals that had been infected with 1×105 CFU of ΔpBCXO1 survived over 14 days and were then killed, necropsied and tissue homogenate analyzed for bacterial load. We observed 200-300 CFU of ΔpBCXO1 vegetative forms in tissue homogenates of the spleen and lungs from these animals, but failed to detect bacilli in either the liver or the kidneys (data not shown). Together these data indicate that non-encapsulated, non-toxigenic ΔpBCXO1 G9241 bacilli are cleared by immune responses of C57BL/6 mice.

Fig. 4.

Fig. 4

Open in a new tab

Virulence of non-toxigenic and non-encapsulated B. cereus G9241 variants.

A. Survival of cohorts (n=10) of C57BL/6 mice following intraperitoneal inoculation of spores derived from B. cereus G9241 or ΔpBCXO1, ΔpBC218, or ΔpagA1 mutant strains. Survival curves were compared by the log-rank test and those of ΔpBCXO1, ΔpBC218 as well as ΔpagA1 show significant difference from that of the parent strain (P<0.0001).

B. Bacterial load in the spleen, kidney, liver, or lung of C57BL/6 mice following inoculation of 105 spores of B. cereus G9241 as well as ΔpBC218 or ΔpagA1 mutant strains. Each bar represents the average CFU in organs of 6 mice with lethal anthrax-like disease. Differences in bacterial loads were analyzed with the two-tailed Student’s t-test comparing animals infected with G9241 vs. ΔpBC218 or ΔpagA1 mutant strains. Statistically significant differences are marked with an asterisk (* denotes P<0.02).

C. Encapsulation of bacilli in vivo. B. cereus G9241 or its variants in spleen homogenates were visualized with India ink. The images are representative of bacterial vegetative forms identified in spleen tissues from each of 6 mice analyzed per group.

The ΔpagA1 and ΔpBC218 variants displayed an attenuated phenotype with 60% mortality and delayed time-to-death as compared to the wild-type parent strain (Fig. 4A). Both the ΔpBC218 and ΔpagA1 mutants disseminated from the site of infection to the peripheral tissues: spleen, lung, liver and kidney. The loads of vegetative forms in all organ tissues were decreased by 1.5-2.5 log10 CFU for mice infected with the ΔpagA1 mutant, whereas the ΔpBC218 variant generated bacterial loads that were indistinguishable from those of the wild-type (Fig. 4B). Wild-type G9241, ΔpBC218 or ΔpagA1 bacilli that had been recovered from tissue homogenates of necropsied animals were stained with India ink and viewed by microscopy. Bacilli from all three strains were observed to elaborate a capsule in host tissues (Fig. 4C). Of note, B. anthracis Ames mutants lacking the pagA gene are not attenuated in mouse models of anthrax disease (Heninger et al., 2006, Chand et al., 2009), whereas capsule deficient variants display dramatic defects in virulence (Drysdale et al., 2005, Richter et al., 2009).

To analyze disease patterns between wild-type and mutant B. cereus strains, tissue samples from lungs and spleens that had been removed during necropsy were thin-sectioned and stained with hematoxylin-eosin. As reported above, the red pulp of spleens from mice that had been infected with B. cereus G9241 was replaced with massive amounts of encapsulated vegetative forms (Fig. 2). Large numbers of leukocytes, irregularly scattered throughout the bacterial population, were also associated with these lesions (Fig. 2E). Similar histopathology assessments could be derived from the ΔpBC218 mutant (Fig. 5AB). Thus, although the ΔpBC218 mutant is 20-80 fold less virulent than the wild-type parent, the histopathology of its replication in spleen (Fig. 5A) and lung tissues (Fig. 5B) was indistinguishable from that of the wild-type (Fig. 2). By comparison, the ΔpagA1 mutant failed to multiply to massive numbers in the spleen (Fig. 5C). Isolated, encapsulated bacilli were identified in the white and red pulp (Fig. 5C). In lung sections, only few encapsulated bacteria were detectable, however the most notable observation was the appearance of an amorphous eosinophilic deposit (Fig. 5D). Similar fibrous depositions have been reported for murine lung infections caused by B. anthracis strain Ames (Heninger et al., 2006), however they were not detected during infection with the wild-type parent G9241 (Fig. 2BDF).

Fig. 5.

Fig. 5

Open in a new tab

Histopathology of C57BL/6 mice infected with ΔpBC218 or ΔpagA1 mutant B. cereus G9241 strains.

Animals were infected by intraperitoneal injection with 1×105 spores. Moribund animals were euthanized and necropsied to remove spleen (A and C) and lung (B and D) tissues for fixation with formalin, paraffin embedding, and hematoxylin-eosin staining of thin-sectioned tissues. Green arrowheads identify leukocytes. White arrowheads identify encapsulated bacilli.

A and B. C57BL/6 mice infected with B. cereus G9241 ΔpBC218.

C and D. C57BL/6 mice infected with B. cereus G9241 ΔpagA1.

hasACB, the pBCXO1 operon for hyaluronic acid capsule production

A bioinformatic approach was used to identify genes encoded by pBCXO1 that are responsible for capsule formation of B. cereus G9241. Each open reading frame was analyzed with BLAST searches against the database of microbial genome sequences. pBCXO1_108-110 were identified as homologues of Streptococcus pyogenes hasABC (Ashbaugh et al., 1998, Dougherty & van de Rijn, 1992) (Fig. 6A). Kendall, Heidelberger and Dawson first demonstrated that group A streptococci (GAS) elaborate a hyaluronic capsule [D-glucuronic acid-(ß1-4)-N-acetylglucosamine-(ß1-3)]n (Kendall et al., 1937). Wessels and colleagues used transposon mutagenesis to identify hasABC as the operon for hyaluronic acid capsule production in GAS (Wessels et al., 1991). In contrast to streptococci, the order of genes in the hasABC operon is altered to hasACB on pBCXO1, where HasA is the presumed hyaluronan synthase (DeAngelis & Weigel, 1994), HasB the UDP-glucose dehydrogenase (Crater & van de Rijn, 1995) and HasC the UDP-glucose-pyrophosphorylase (Crater et al., 1985). Allelic replacement was used to delete hasACB from pBCXO1. This abolished capsule formation of G9241 vegetative forms grown in HIBFBS (Fig. 6C). The defect was rescued by transforming the hasACB mutant with a plasmid encoding the wild-type hasACB operon (phasACB) (Fig. 6C).

Fig. 6.

Fig. 6

Open in a new tab

Identification of hyaluronic acid capsule synthesis genes.

A. Genetic organization of hasACB in B. cereus G9241, B. anthracis Ames and S. pyogenes. B. cereus G9241 harbors hasACB at the pBCXO1_0108 to 0110 locus.

B. Encapsulation of bacilli with hyaluronic acid. Bacilli grown overnight were refreshed in HIBFBS, incubated for 4 hours and treated with 200 units of hyaluronidase for 2 hours. Capsule was visualized with India ink staining and microscopy.

C. hasACB is required for encapsulation of bacilli. phasACB restores the capsule production by the ΔhasACB mutant. Cells were grown as described in (B). The data are representative of similar results obtained with two independent experiments.

We sought to ascertain whether pBCXO1 hasACB indeed endows bacilli with the ability to synthesize hyaluronate, a glycosaminoglycan otherwise found in mammalian connective tissues (Meyer & Palmer, 1934). As all mammals synthesize hyaluronic acid, antibodies that specifically recognize this glycosaminoglycan are difficult to obtain (Fillit et al., 1986). Mammalian tissues and bacterial pathogens express hyaluronidases, enzymes that degrade connective tissue hyaluronate during physiological turnover of glycosaminoglycan (Menzel & Farr, 1998). Treatment of B. cereus G9241 vegetative forms with purified hyaluronidase degraded the capsular material of this microbe (Fig. 6B). These data are in agreement with a model whereby the hasACB operon of pBCXO1 provides for hyaluronic acid (HA) synthesis, thereby encapsulating the vegetative forms of bacilli.

Considering the high-level synteny between pXO1 and pBCXO1, we used India ink staining and microscopy experiments to ask whether B. anthracis Sterne also elaborates HA capsule. All attempts to detect capsular material in this strain failed (data not shown). The hasACB operon of B. anthracis pXO1 is virtually identical with that of pBCXO1 with the notable exception of a single nucleotide deletion at position 265 of the hasA open reading frame (Okinaka et al., 1999). This mutation shifts the reading frame and introduces an opal codon (TGA) at position 100 of the 466 codon B. anthracis hasA gene (Fig. 6A). We surmise that this single nucleotide deletion prevents HA synthesis in B. anthracis.

bpsX-H, the pBC218 operon for capsular polysaccharide production

Inoculation of B. cereus G9241 spores into HIBFBS led to the outgrowth of vegetative forms whose capsular material could only be diminished with hyaluronidase treatment, but not completely removed (Fig. 7) This is in contrast to HIBFBS cultures inoculated directly with vegetative forms: the capsular material of these bacilli is removed in its entirety by hyaluronidase (Fig. 6B). Inoculation of hasACB mutant spores into HIBFBS gave rise to vegetative forms with capsules smaller than their wild-type parent (Fig. 7B). The capsules of hasACB mutants were refractory to hyaluronidase treatment (Fig. 7B). Hoffmaster and colleagues noticed that pBC218 harbors genes with homology to known capsular polysaccharide genes (Fig. 7A) (Hoffmaster et al., 2004). We wondered whether these genes, pBC218_059-067, are indeed responsible for the production of the second capsule and used allelic replacement to delete the entire operon in wild-type and hasACB mutant strains. Fig. 7B shows that deletion of the pBC218_059-067 operon abolished the ability of hasACB mutant spores to grow as encapsulated vegetative forms. Deletion of pBC218_059-067 in wild-type strain G9241 did not affect the ability of spores to expand as vegetative forms with large capsules (Fig. 7B). However, treatment of the mutants with hyaluronidase removed their entire capsular material (Fig. 7B). These data are in agreement with the hypothesis that pBC218_059-067 provide for the synthesis of the BPS capsular polysaccharide that is expressed following germination of B. cereus G9241 spores in serum and animal tissues (vide infra). Consequently, we designated genes in this operon bps, for B. cereus G9241 exo-polysaccharide, and propose the following functions due to their homology with known capsule synthesis genes: LytR-type transcriptional activator (BpsX), polysaccharide synthesis chain-length determination factor (BpsA), tyrosine protein kinase (BpsB), UTP-glucose-1-phosphate uridyltransferase (BpsC), glycosyl transferase (BpsD), sialic acid synthase (BpsE), UDP-N-acetylglucosamine 2-epimerase (BpsF), CMP-sialic acid synthetase (BpsG) and polysaccharide translocase (BpsH) (Fig. 7A). The molecular mechanisms and signals controlling the expression of the hasACB and bps gene clusters of B. cereus G9241 are not yet known.

Fig. 7.

Fig. 7

Open in a new tab

Genetic requirement for BPS capsule production in ΔhasACB mutant B. cereus G9241.

A. The BPS capsule synthesis cluster (B. cereus exo-polysaccharide synthesis) on pBC218. The bps locus encompasses 9 genes that are thought to be involved in the regulation of expression and synthesis of BPS capsule with their predicted specific function listed.

B. India ink images of capsule surrounding the vegetative forms of B. cereus G9241 wild-type, ΔhasACB, ΔbpsX-H, and ΔhasACB, bpsX-H mutants. Spores were inoculated into HIBFBS for 4 hours followed by 2 hours treatment with or without 200 units hyaluronidase. Capsules were visualized with India ink staining and microscopy. The data are representative of similar results obtained with two independent experiments.

Capsular polysaccharides and anthrax-like disease

Mice were infected by intraperitoneal injection of 105 spores derived from B. cereus G9241 wild-type as well as ΔhasACB, ΔbpsX-H or ΔhasACB, bpsX-H mutant strains. Animals infected with spores of the wild-type G9241 strain die within 100 hours of inoculation. Animals infected with the ΔhasACB or the ΔbpsX-H mutant spores displayed a reduced time-to-death and caused only 60% or 50% mortality, respectively (Fig. 8A). Spores of the mutant lacking both capsule synthesis operons (ΔhasACB, bpsX-H) appeared to be avirulent in these experiments. Infected animals did not display disease symptoms (ruffled fur, hunched posture or labored gait) and also did not die over 360 hours following inoculation (Fig. 8A). The virulence phenotype of a mutant lacking both capsule synthesis clusters was also observed in a ΔhasACB, bpsAB mutant with deletion of only two genes of the BPS capsule synthesis cluster (Fig. 8A). When the wild-type hasACB operon expressed from a plasmid was introduced into this capsule mutant, its virulence attributes could in part be restored (Fig. 8A). Antibiotic treatment for plasmid maintenance of bacilli in mice was not used in these experiments. Nevertheless, bacilli isolated from tissues of infected mice carried the plasmid phasACB (data not shown). Taken together these data suggest that the virulence defect of ΔhasACB, bpsX-H mutants is attributable to the loss of their polysaccharide capsules.

Fig. 8.

Fig. 8

Open in a new tab

Contribution of capsule production to the virulence of B. cereus G9241.

A. Survival of cohorts (n=10) of C57BL/6 mice following intraperitoneal inoculation of 1 × 105 spores derived from B. cereus G9241 wild-type or its ΔhasACB, ΔbpsX-H, or ΔhasACB, bpsA-H mutant strains. Survival data were analyzed with the log-rank test by comparing G9241 vs. ΔhasACB, bpsX-H (P<0.0001), ΔbpsX-H (P<0.0001) or ΔhasACB (P=0.0003). Survival curve of ΔhasACB, bpsX-H is significantly different from that of ΔbpsX-H (P=0.0040) or ΔhasACB (P=0.0115). Restoration of virulence of ΔhasACB, bpsAB by introduction of a plasmid encoded hasACB operon. Survival of cohorts (n=9) of C57BL/6 mice following intraperitoneal inoculation of 1 × 105 spores derived from B. cereus ΔhasACB, bpsAB or ΔhasACB, bpsAB (phasACB).

B. Immunoblots of extracellular media (αPA) or extracts of vegetative forms from B. cereus G9241 wild-type or ΔhasACB, ΔbpsX-H and ΔhasACB, bpsX-H mutant cultures (αBslA, αSrtA) with antibodies specific for protective antigen (PA), Bacillus anthracis S-layer protein A (BslA) and sortase A (SrtA). Data are representative of similar results obtained with two independent experiments.

C. Production of two types of capsule in the host. Encapsulation of B. cereus G9241 wild-type or variants in vivo was assessed by India ink exclusion of bacilli in spleen homogenates with or without treatment of 1,000 units hyaluronidase for 10 hours. Images are representative of similar images of spleen tissues from each of 2 mice analyzed per group.

The spleens of animals that had succumbed to B. cereus wild-type and mutant spore challenge were removed during necropsy. India ink staining of spleen homogenate was used to characterize capsule production of bacilli in host tissues (Fig. 8C). Vegetative forms of the wild-type strain G9241 formed large capsules. The capsular material could be diminished in size by treatment of spleen homogenate with hyaluronidase (Fig. 8C). In contrast to wild-type bacilli, the capsules of vegetative forms derived from the hasACB mutant spores were smaller in size and refractory to treatment with hyaluronidase. Vegetative forms of the bpsX-H mutant elaborated large amounts of capsular material. This capsule was completely removed by hyaluronidase treatment of spleen homogenates (Fig. 8C). We sought to ascertain whether the ΔhasACB, ΔbpsX-H or ΔhasACB, bpsX-H mutant strains elaborate secreted or envelope virulence factors encoded by the virulence plasmids and the chromosome of bacilli. Vegetative forms of the wild-type and mutant strains secreted protective antigen (PA) (Smith et al., 1953), and harbored B. anthracis S-layer protein A (BslA) (Kern & Schneewind, 2008), and sortase A (SrtA) (Gaspar et al., 2005) in their envelope (Fig. 8B).

Capsular polysaccharides interfere with phagocytosis of bacilli

To evaluate whether the HA or BPS capsule has an impact on the phagocytosis of bacilli by murine macrophages, J774A.1 cell cultures were infected with variable numbers vegetative forms of B. cereus G9241 wild-type or its ΔhasACB, ΔbpsX-H and ΔhasACB, bpsX-H variants that had been germinated in HIBFBS (multiplicity of infection of bacilli/macrophages of 2, 4 or 8). After 30 min, bacilli were quantified in the extracellular medium of J774A.1 cell cultures as well as in extracts of these macrophages to measure phagocytic uptake (Fig. 9AB). Wild-type B. cereus G9241 was not effectively phagocytosed; less than 3% of the inoculum was found associated with macrophages and bacilli replicated in the tissue culture medium (Fig. 9AB). In contrast, more than 68% of the inoculum of non-encapsulated bacilli (ΔhasACB, bpsX-H) was phagocytosed by J774A.1 macrophages with corresponding depletion of vegetative forms from the culture medium (Fig. 9AB). The HA (ΔhasACB, 16% macrophage associated) and BPS (ΔbpsX-H, 5% macrophage associated) mutants displayed intermediate phenotypes, in agreement with the hypothesis that both of these capsular polysaccharides contribute to the escape of G9241 bacilli from innate immune responses (Fig. 9AB).

Fig. 9.

Fig. 9

Open in a new tab

Effect of capsule production on the phagogcytosis of B. cereus G9241 by J774A.1 macrophages.

Spores derived from B. cereus G9241 or ΔhasACB, ΔbpsX-H, as well as ΔhasACB, bpsX-H mutants were grown under capsule-inducing condition for 1 hr and were then used to infect J774A.1 macrophage cultures at variable multiplicity of infection. After 30 min, tissue culture media were removed and macrophages extracted with saponin. Both samples were spread on agar and incubated to enumerate CFU of bacilli in the extracellular medium and associated with J774A.1 macrophages. For the experiments in panel C, B. cereus G9241 (pGFP) and ΔhasACB, bpsAB (pGFP) were used.

A. Number of bacteria as the percent inoculum associated with J774A.1 macrophages.

B. Number of bacteria as the percent inoculum in the extracellular medium of J774A.1 macrophage cultures.

Representative data from 3 independent experiments are shown. All assays were performed in quadruplicate; the error bars represent the standard error of the means. Statistically significant differences are marked with an asterisk (*).

C. Detection of intracellular bacilli in macrophages by confocal microscopy. GFP expressing wild-type or ΔhasACB, bpsAB mutant bacilli were incubated with J774A.1 macrophages and then fixed. Samples were labeled with anti- BslA and Alexa Fluor 647–conjugated anti-rabbit antibodies (red) to detect the BslA surface layer protein on extracellular bacilli. White arrow heads identify green fluorescent extracellular bacilli that had been stained with anti-BslA.

To examine whether mutant bacilli lacking both capsules are actually internalized by macrophages, we used B. cereus G9241 (pGFP) and ΔhasACB, bpsAB (pGFP) strains expressing the green fluorescent protein (GFP) (Fig. 9C). After infection of tissue cultures, media were removed and macrophages with bacilli were fixed. Samples were incubated with anti-BslA and secondary antibody conjugate to Alexa Fluor 647 (red), which detects the surface layer protein BslA of extracellular, but not intracellular bacilli. Samples were then analyzed by confocal microscopy. Green fluorescent B. cereus G9241 was not found inside of J774A.1 macrophages (Fig. 9C). In contrast, many ΔhasACB, bpsAB (pGFP) variants were internalized by macrophages, as these bacilli did not bind BslA-specific antibodies. Arrow heads in the lower left panel of Fig. 9C identify several green-fluorescent bacilli that also stained with anti-BslA, in agreement with the possibility that these bacteria are not completely phagocytosed.

In summary, the vegetative forms of B. cereus G9241 appear to synthesize two different capsular materials, an outer layer of HA and an inner layer of the BPS polysaccharide. Production of these capsule layers requires expression of the hasACB and bpsX-H operons on pBCXO1 and pBC218, respectively. Formation of HA and BPS capsules during infection is a prerequisite for B. cereus G9241 to escape phagocytic clearance and establish anthrax-like disease in mice.

Discussion

Karl Meyer discovered hyaluronic acid as a non-sulfated glycosaminoglycan and characterized its chemical composition as [D-glucuronic acid-(ß1,4)-D-N-acetylglucosamine-(ß1,3)]n, a polymer of up to 25,000 disaccharides with a Mr greater that 1.5 million Da (Meyer & Palmer, 1934, Menzel & Farr, 1998). HA is synthesized at the plasma membrane of epithelial, neuronal and mesenchymal cells by hyaluronate synthases. HA is a major component of extracellular matrix and contributes to cell proliferation and migration, including the progression and metastasis of malignant tumors (Menzel & Farr, 1998). The polysaccharide attaches to and activates a specific receptor, CD44 (Aruffo et al., 1990). CD44 engagement by HA functions as a marker for lymphocyte activation (DeGrendele et al., 1997). CD44 promotes HA uptake and degradation, which leads to proinflammatory signals that direct immune cells to the site of inflammation (DeGrendele et al., 1997). Metabolic cell surface receptors for HA lead to the clearance of this compound from lymph and blood plasma and the degradation of the polymer within lysosomes. HA is also degraded by a family of bacterial and mammalian enzymes designated hyaluronidases (Meyer et al., 1941). Their degradation products exhibit pro-angiogenic properties and stimulate proinflammatory signaling (Menzel & Farr, 1998).

S. pyogenes (group A streptococci) elaborate a hyaluronic acid capsule, thereby endowing the pathogen with resistance to phagocytic killing and preventing the development of adaptive immune responses that could trigger opsonophagocytosis via capsule specific antibodies (Kendall et al., 1937). Streptococcal HA is known to enable pathogen uptake into and across keratinocytes via a mechanism that engages their CD44 surface receptors, eventually leading to invasive skin disease (Cywes & Wessels, 2001, Schrager et al., 1998). The same molecular interactions appear critical for the pathogen’s ability to colonize and invade pharyngeal or tonsillar tissues, events considered crucial for the pathogenesis of GAS pharyngitis (Cywes et al., 2000).

Here we report that B. cereus G9241 pBCXO1 harbors hasACB, the HA capsule operon that contributes to the pathogenesis of anthrax-like disease. Our experiments suggest further that the HA capsule provides for escape of bacilli from phagocytosis of their vegetative forms, analogously to the function of capsule in GAS. The HA capsule could also promote the uptake of bacilli into specific tissues, using a similar mechanism as streptococcal engagement of CD44. Assuming that the HA capsule of bacilli and streptococci is chemically indistinguishable from the glycosaminoglycan of mammalian tissues, one wonders what the impact of seven types of hyaluronidases in mammalian tissues may be on capsule structure and function (Menzel & Farr, 1998). Whatever the molecular and cellular attributes of HA capsules, this structure alone is not sufficient to endow B. cereus G9241 with resistance to innate host defenses. All currently available evidence suggests that B. anthracis isolates do not express a hyaluronic acid capsule, which may be due to the deletion of a single nucleotide and introduction of a premature stop codon in hasA. This is not to say that hyaluronic acid capsule formation in B. anthracis strains could not be restored, either by a spontaneous mutation or via suppression of the opal codon in hasA. If so, it would seem of interest to learn what effect hasACB expression could have on either PDGA capsule function in wild-type B. anthracis or on the otherwise non-encapsulated vaccine strain B. anthracis Sterne (pXO1+, pXO2-).

B. cereus pBC218 encodes a second capsular polysaccharide via its bpsX-H gene cluster. The presence of this capsular material could only be detected in vitro by treating vegetative forms with hyaluronidase, which reduced the size of capsules but failed to remove all of the material that excluded India ink staining of vegetative forms. In vivo expression of the BPS capsule was observed during infection of mice with hasACB mutant spores. Animals that succumbed to challenge with 105 hasACB spores harbored large amounts of encapsulated vegetative forms in the spleen. The capsule of these bacilli could not be removed with hyaluronidase (Fig. 8C). Future work needs to reveal the chemical composition and structure of the BPS capsule, which will be important in achieving molecular appreciation for its function during the pathogenesis of anthrax-like disease. Taken together, these findings suggest that several different capsules enable bacilli to escape innate and adaptive immune responses and establish anthrax or anthrax-like diseases.

Our experiments with immuno-competent C57BL/6 mice indicate that B. cereus G9241 is considerably more virulent than environmentally isolated B. cereus strains lacking capsule and anthrax toxin plasmids. Histopathology analyses of B. cereus G9241 infected animals revealed an anthrax-like disease with massive replication of encapsulated vegetative forms in the spleen and other internal organs. The pathogenesis of this B. cereus G9241 disease required both capsule and toxin genes. In contrast, the highly virulent B. anthracis isolate Ames requires capsule production but not its protective antigen or associated toxin genes to cause a lethal infection of mice (Drysdale et al., 2005, Chand et al., 2009). Thus, the B. anthracis Ames isolate can be considered unique owing to its high virulence and relative independence on toxin production for lethal disease as compared to other B. anthracis and B. cereus isolates (Fellows et al., 2001).

Experimental procedures

Bacterial growth and capsule production

B. cereus G9241 was obtained from the Biodefense and Emerging Infections Research Program (BEI). B. cereus G9241, its mutants, and ATCC14579 strains were grown routinely in tryptic soy broth (TSB) or propagated on tryptic soy agar (TSA). Kanamycin (Kan) was added at a concentration of 50 μg ml−1 for E. coli and B. cereus to achieve plasmid or mutant allele selection. To induce capsule production or toxin secretion, B. cereus G9241 strains were grown at 30°C overnight and then refreshed in heart infusion broth (HIB) containing 50% (vol/vol) heat-inactivated fetal bovine serum (FBS) or 0.8% (wt/vol) sodium bicarbonate for 4 to 6 hours at 37°C, respectively. Spores of B. cereus G9241 or its variants were directly inoculated into 50% FBS-containing HIB (HIBFBS) to assess capsule induction.

Plasmids

The deletion mutants were generated with the temperature-sensitive replication plasmid pLM4 (Marraffini & Schneewind, 2006). PCR products derived from the primer pairs P148/P149 and P150/P151 were inserted into pLM4 via EcoRI, NheI, and KpnI restriction, thereby generating pSY92, which carries a mutant pagA1 (pBCXO1-encoded protective antigen gene) allele. Insertion of P189/P190 and P198/P176 PCR products into pLM4 via EcoRI, NheI and XmaI sites generated pSY106 carrying a mutant hasACB allele. To generate pSY108 for the bpsX-H mutation, P211/P212 and P213/P214 PCR products were inserted into pLM4 via XmaI, NheI and SacI sites. The P203/P204 PCR product was ligated into pLM4 via XmaI and SacI sites to generate pSY107 (phasACB). Insertion of P228/P229 and P213/P231 into pLM4 via SacI, NheI, and XmaI sites generated pSY113 carrying a mutant bpsAB allele.

Construction of B. cereus G9241 mutant strains

Plasmids were electroporated into B. cereus G9241. Electroporation of B. cereus G9241 was performed by a previously established method with slight modifications (Silo-Suh et al., 1994). B. cereus G9241 was grown in 4 ml of TSB overnight at 30°C with vigorous agitation. Cultures were diluted into 150 ml of TSB and incubated at 30°C until OD600 0.3. Cultures were incubated on ice for 20 min, centrifuged at 10,000 ×g and bacilli washed twice with EP buffer (0.5 mM K2HPO4-KH2PO4, 0.5 mM MgCl2, and 272 mM sucrose). DNA (0.1 to 1 μg) was mixed with 0.1 ml of the cell suspension and incubated on ice for 10 min and transferred to a chilled 0.2 cm cuvette and electroporated at 50 μF, 200 Ω, 1.0 kV in a Gene Pulser electroporation apparatus (Bio-Rad). Immediately following pulse delivery, 1 ml of TSB was transferred to the cuvette and the cell suspension was transferred to 16 mm test tube and incubated at 30°C for 1 hr and then spread on TSA containing 50 μg/ml kanamycin (Kan) and incubated at 30°C overnight. Transformants were first grown at 30°C in TSB-Kan, a condition permissive for pSY92 replication. Cultures were then diluted 1:100 into fresh media and incubated overnight at the restrictive temperature of 43°C. After four passages at 43°C, cultures were propagated in TSB without antibiotic at 30°C and refreshed every twelve hours. Aliquots were plated on TSA without Kan to form about 200 colonies. Colonies were patched on agar with and without Kan to identify antibiotic-sensitive colonies. DNA from Kan-sensitive colonies was analyzed by PCR to assess the presence or absence of mutant alleles. P209/P210 was used to confirm deletion of pagA1 shown in Fig. 3A. Nucleic acid sequences of mutant alleles were verified by DNA sequencing. The presence or absence of pBCXO1, pBC218 and pBClin29 during the allelic exchange procedure was confirmed by PCR. Variants lacking one or the other of the two plasmids were isolated following a shift of cultures to 43°C. The variants were analyzed further by immunoblotting with antibodies specific for PA, BslA, or SrtA (Kern & Schneewind, 2008, Gaspar et al., 2005). Two pairs of primers were designed to amplify two genes each on pBCXO1, pBC218 and pBClin29, thereby examining B. cereus isolates for plasmid variants. P124/P125 and P126/P146 amplify pBC218_066 and pBC218_058 coding sequence, which specify a putative chain length determinant protein for polysaccharide synthesis and a putative collagen adhesin, respectively. The primer pairs P85/P86 and P173/P174 amplify pBCXO1_119 and pBCXO1_105, which encode edema factor and BslA. The primer pairs P220/P221 and P222/P223 amplify pBClin29_006 and pBClin29_025, which encode a putative amidase and anti-repressor, respectively. All primers used in this study are listed in Table 1.

TABLE 1.

Oligonucleotides used in this study

Primer Restriction sitea Sequenceb Locus tagc
P85 - AAGTGGTGTGGCTACAAAGGG pBCXO1_0119 (969)
P86 - AACTCTGCTGACGTAGGGATGG pBCXO1_0119 (969)
P124 - CAATAGTTCCACCTCTAAATG pBC218_0066 (762)
P125 - GGTGTTAGATCGATGAGGAGG pBC218_0066 (762)
P126 NheI aaagctagcGACTGGTATTTCAAGAGAAGCG pBC218_0058 (1530)
P146 EcoRI aaagaattcAACAGTAATACGCCTGTAGCCG pBC218_0058 (1530)
P148 EcoRI aaagaattcTTAATGCAGTTACTCGAGATG pBCXO1_0025 (1045)
P149 NheI atcgctagcCGTTTTTTCATATACGTTCTCC pBCXO1_0025 (1045)
P150 NheI acggctagcGATAGGATAAGGTAATTCTAGGTG pBCXO1_0027 (1042)
P151 KpnI aaaggtaccTTTAAACGCATAGGATGTGCC pBCXO1_0027 (1042)
P173 - GAAAAAATTGAGAACGAGTTAGAGGAATG pBCXO1_0105 (964)
P174 XhoI aaactcgagCATATATAATAGTACCTCC pBCXO1_0105 (964)
P176 XmaI aaacccgggTTAACAATACCACCGCAGC pBCXO1_0111 (969)
P189 EcoRI aaagaattcTCTAATTCATCGCCAACG pBCXO1_0107 (1002)
P190 NheI aaagctagcTTTCATCTAAAATGGATTCTCC pBCXO1_0107 (1002)
P198 NheI aaagctagcGGAGAGATAACAGCTTGAG pBCXO1_0111 (969)
P203 XmaI aaacccGGGACAGTTCAGGTAAAGC pBCXO1_0108 (4344)
P204 SacI tttgagctctcaTCAAGCTGTTATCTCTCC pBCXO1_0110 (4344)
P209 - GCATAGTTAAGAGGGGTAGG pBCXO1_0026 (3242, 975)
P210 - GGCGCTCGTTTCGTCTAATC pBCXO1_0026 (3242, 975)
P211 SacI aaagagctcAGCCCATGGCATTTTATATACC pBC218_0059 (1152)
P212 NheI aaagctagcCCTGAAGAATTTGGGATGTATTCG pBC218_0059 (1152)
P213 NheI aaagctagcATAGCTAACATCCCCACACAG pBC218_0067 (1121,1074)
P214 XmaI aaacccgggTGCATAAGCCGTTGGATCAGG pBC218_0067 (1121)
P220 - TGTTGGTATCGCTTTAGG pBClin29_006 (907)
P221 - ATGTTAAATCGATACTACGTC pBClin29_006 (907)
P222 - TCTTGAAAACGCAGCGTGG pBClin29_025 (1381)
P223 - TCCATTGGCTTCAATCCTC pBClin29_025 (1381)
P228 SacI aaagagctcGTGATACGACTCCATTTTAGG pBC218_0065 (1073)
P229 NheI aaagctagcACCTATCTCAGAACAATATC pBC218_0065 (1073)
P231 XmaI aaacccgggGTAGATATTGTAGACGTTAAGCC pBC218_0067 (1074)
Open in a new tab
a

Restriction sites are underlined in the oligonucleotide sequence.

b

Capitalized nucleotides were derived from the genome sequence of B. cereus G9241. Lower case nucleotides were engineered.

c

Numbers in parentheses indicate the length of amplified products.

Immunoblotting

Bacterial cultures grown in the presence of 0.8% sodium bicarbonate were centrifuged and the supernatant precipitated with 9% trichloroacetic acid (TCA). Bacterial sediments were suspended in PBS and proteins precipitated with 9% TCA. TCA precipitates were washed in acetone, dried and proteins solubilized in 50 μl sample buffer. Proteins were separated on SDS-PAGE, transferred to PVDF membrane and probed with rabbit antibodies specific for PA, BslA, or SrtA. Immune-reactive signals were detected via chemiluminescence.

Digestion of capsule with hyaluronidase

Bacterial cultures or spleen homogenate were fixed with 10% formalin and washed three times with 20 mM sodium phosphate buffer (pH 7.0) containing 75 mM NaCl and incubated with 200 or 1,000 units of hyaluronidase (Sigma H3506) for 2 hours or 10 hours, respectively.

Spore preparation

B. cereus strains inoculated into TSB were grown overnight at 30°C. Bacilli were inoculated into 4 ml of modG medium (Kim & Goepfert, 1974) and grown at 200 rpm and 30°C for 4 days. The cultures were heated at 68°C for 150 minutes to kill the remaining vegetative cells. Spore preparations were then washed and suspended in water. Ten-fold serial dilutions of aliquots were spread on TSA followed by incubation and enumeration of colony-forming units (CFU). The purity and extent of sporulation was assessed by phase-contrast microscopy.

Mouse infection

Animal experimental protocols were reviewed, approved, and supervised by the Institutional Animal Care and Use Committee at the University of Chicago. All infections were carried out in animal biological safety level-3 containment laboratories at the Howard Taylor Ricketts Laboratory. Mice were housed in cages with HEPA filters. Six week old, female C57BL/6 mice (Jackson Laboratory) were challenged by intraperitoneal injection of B. cereus spore suspensions in 100 μl PBS. Aliquots of the spore inoculum were spread on agar plates to enumerate the challenge dose. Infected animals were monitored in 8 hour intervals for survival or a moribund state (inability to remain upright, weight loss, non-responsive to touch). Moribund animals were killed by inhalation of compressed CO2. All animals were subjected to necropsy and their spleen, liver, kidney, and lungs removed. Organs were immediately fixed by submersion in 10% neutral-buffered formalin and embedded in paraffin. Samples were submitted to the University of Chicago Animal Pathology Core for serial 4-μm thin sections and staining with hematoxylin–eosin. Tissue samples were viewed by light microscopy. Organ samples isolated during necropsy were also homogenized in phosphate buffered saline with or without heat treatment (68°C for 30 min), serially diluted, and plated on TSA to enumerate bacterial load as CFU. Alternatively, samples were fixed with neutral buffered formalin and stained with India ink to visualize the capsule of bacilli. All animal infection experiments were done at least twice and representative data are shown. Experimental protocols were reviewed, approved and performed under regulatory supervision of The University of Chicago’s Institutional Biosafety Committee (IBC). Animals were managed by the University of Chicago Animal Resource Center. Animals that were judged to be moribund were euthanized with CO2.

Phagocytosis assay

J774A.1 cells (murine macrophage cell line) were grown in Dulbecco modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum and 1% Glutamax (GIBCO). Cells were seeded in 48-well tissue culture dishes (Corning) at a concentration of 1 × 105 cells per well and allowed to adhere by overnight incubation at 37°C with 5% CO2 and were then washed with pre-warmed DMEM before use. The spores were germinated in HIBFBS for 1 hr at 37°C and diluted in the same medium as the cells that were to be infected. After addition of the bacteria at a multiplicity of infection (MOI) of 2, 4, or 8, vegetative forms were centrifuged onto monolayers at 100 ×g for 5 min and allowed to interact with the cells for 30 min at 37°C with 5% CO2. Supernatant was removed to determine the number of bacteria not associated with macrophages. Cells samples were then washed with DMEM three times and incubated with 2.5% saponin in PBS at 4°C for 10 min to disrupt macrophage membranes. Cell lysates were spread on TSA and incubated to enumerate macrophage-associated bacilli as CFU.

Confocal microscopy of J774A.1 macrophages infected with bacilli

J774A.1 macrophage cultures were grown on glass cover slips and infected with B. cereus G9241 (pGFP) or its ΔhasACB, bpsAB (pGFP) variant. Thirty minutes after infection, cells were washed with PBS and fixed with 4% paraformaldehyde for 10 min at room temperature. Cells were washed three times with PBS and blocked with 3% bovine serum albumin (BSA) in PBS for 20 min at room temperature followed by incubation of rabbit anti-BslA antibodies (1:1500 in 3% BSA-PBS) for 30 min. Cells were washed five times and incubated with goat anti-rabbit Alexa Fluor 647 – conjugated IgG (Invitrogen) for 20 min in the dark. After three washes with PBS, cover slips were mounted with N-propylgallate, sealed, viewed and images were collected with a Leica SP5 AOBS spectral two-photon confocal microscope. Captured images were processed with ImageJ software and plugins (Abramoff et al, 2004).

Statistical analysis

Data were processed using GraphPad PRISM 5.0 software to generate graphs and for statistical analyses. Bacterial load data were analyzed for statistical significance with the two-tailed Student’s t- test. Comparisons of survival between two groups were statistically evaluated with the log-rank test.

Acknowledgments

We thank Andrea DeDent for her help with the fluorescence microscopy experiments as well as Dominique M. Missiakas and members of our laboratory for discussion and experimental assistance. This work was supported by grants from the National Institute of Allergy and Infectious Diseases (NIAID), Infectious Diseases Branch (AI69227 and AI38897 to O.S.). J.M.B. was a trainee of the NIH Medical Scientist Training Program at The University of Chicago (GM07281). O.S. acknowledges membership within and support from the Region V “Great Lakes” Regional Center of Excellence in Biodefense and Emerging Infectious Diseases Consortium (NIH Award 1-U54-AI-057153).

Footnotes

Accession codes

Nucleotide sequences used in this work are as follows: pBCXO1 (NZ_AAEK01000036.1), pBC218 (NZ_AAEK01000004.1), pBClin29 (NZ_AAEK01000053.1) and Ames Ancestor pXO1 (NC_007322.2). Locus tags for genes in used in this work are as follows: pagA1 (BCE_G9241_pBCXO1_0026), hasACB (BCE_G9241_pBCXO1_0108 to 0110), bpsXABCDEFGH (BCE_G9241_pBC218_0059 to 0067), Streptococcus pyogenes MGAS8232 hasA (NP_608168), hasB (NP_608169), hasC (NP_ NP_608170), B. anthracis Ames Ancestor hasACB (GBAA_pXO1_0128 to 0130).

References

  1. Abramoff MD, Magelhaes PJ, Ram SJ. Image processing with ImageJ. Biophotonics Int. 2004;11:36–42. [Google Scholar]
  2. Aruffo A, Stamenkovic I, Melnick M, Underhill CB, Seed B. CD44 is the principal cell surface receptor for hyaluronate. Cell. 1990;61:1303–1313. doi: 10.1016/0092-8674(90)90694-a. [DOI] [PubMed] [Google Scholar]
  3. Ashbaugh C, Alberti S, Wessels MR. Molecular analysis of the capsule gene region of group A Streptococcus: the hasAB genes are sufficient for capsule expression. J Bacteriol. 1998;180:4955–4959. doi: 10.1128/jb.180.18.4955-4959.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bradley KA, Mogridge J, Mourez M, Collier RJ, Young JA. Identification of the cellular receptor for anthrax toxin. Nature. 2001;414:225–229. doi: 10.1038/n35101999. [DOI] [PubMed] [Google Scholar]
  5. Candela T, Fouet A. Poly-gamma-glutamate in bacteria. Mol Microbiol. 2006;60:1091–1098. doi: 10.1111/j.1365-2958.2006.05179.x. [DOI] [PubMed] [Google Scholar]
  6. Chand HS, Drysdale M, Lovchik J, Koehler TM, Lipscomb MF, Lyons CR. Discriminating virulence mechanisms among Bacillus anthracis strains by using a murine subcutaneous infection model. Infect Immun. 2009;77:429–435. doi: 10.1128/IAI.00647-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Crater DL, Dougherty BA, van de Rijn I. Molecular characterization of hasC from an operon required for hyaluronic acid synthesis in group A streptococci. Demonstration of UDP-glucose pyrophosphorylase activity. J Biol Chem. 1985;270:28676–28680. doi: 10.1074/jbc.270.48.28676. [DOI] [PubMed] [Google Scholar]
  8. Crater DL, van de Rijn I. Hyaluronic acid synthesis operon (has) expression in group A streptococci. J Biol Chem. 1995;270:18452–18458. doi: 10.1074/jbc.270.31.18452. [DOI] [PubMed] [Google Scholar]
  9. Cywes C, Stamenkovic I, Wessels MR. CD44 as a receptor for colonization of the pharynx by group A Streptococcus. J Clin Invest. 2000;106:995–1002. doi: 10.1172/JCI10195. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Cywes C, Wessels MR. Group A Streptococcus tissue invasion by CD44-mediated cell signalling. Nature. 2001;414:648–652. doi: 10.1038/414648a. [DOI] [PubMed] [Google Scholar]
  11. DeAngelis PL, Weigel PH. Immunochemical confirmation of the primary structure of streptococcal hyaluronan synthase and synthesis of high molecular weight product by the recombinant enzyme. Biochemistry. 1994;33:9033–9039. doi: 10.1021/bi00197a001. [DOI] [PubMed] [Google Scholar]
  12. DeGrendele HC, Estess P, Siegelman MH. Requirement for CD44 in activated T cell extravasation into an inflammatory site. Science. 1997;278:672–675. doi: 10.1126/science.278.5338.672. [DOI] [PubMed] [Google Scholar]
  13. Dougherty BA, van de Rijn I. Molecular characterization of a locus required for hyaluronic acid capsule production in group A streptococci. J Exp Med. 1992;175:1291–1299. doi: 10.1084/jem.175.5.1291. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Drobniewski FA. Bacillus cereus and related species. Clin Microbiol Rev. 1993;6:324–338. doi: 10.1128/cmr.6.4.324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Drysdale M, Heninger S, Hutt J, Chen Y, Lyons CR, Koehler TM. Capsule synthesis by Bacillus anthracis is required for dissemination in murine inhalation anthrax. EMBO J. 2005;24:221–227. doi: 10.1038/sj.emboj.7600495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Fellows PF, Linscott MK, Ivins BE, Pitt ML, Rossi CA, Gibbs PH, Friedlander AM. Efficacy of a human anthrax vaccine in guinea pigs, rabbits, and rhesus macaques against challenge by Bacillus anthracis isolates of diverse geographical origin. Vaccine. 2001;19:3241–3247. doi: 10.1016/s0264-410x(01)00021-4. [DOI] [PubMed] [Google Scholar]
  17. Fillit HM, McCarty M, Blake M. Induction of antibodies to hyaluronic acid by immunization of rabbits with encapsulated streptococci. J Exp Med. 1986;164:762–776. doi: 10.1084/jem.164.3.762. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Gaspar AH, Marraffini LA, Glass EM, DeBord KL, Ton-That H, Schneewind O. Bacillus anthracis sortase A (SrtA) anchors LPXTG motif-containing surface proteins to the cell wall envelope. J Bacteriol. 2005;187:4646–4655. doi: 10.1128/JB.187.13.4646-4655.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Green BD, Battisti L, Koehler TM, Thorne CB, Ivins BE. Demonstration of a capsule plasmid in Bacillus anthracis. Infect Immun. 1985;49:291–297. doi: 10.1128/iai.49.2.291-297.1985. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Heninger S, Drysdale M, Lovchik J, Hutt J, Lipscomb MF, Koehler TM, Lyons CR. Toxin-deficient mutants of Bacillus anthracis are lethal in a murine model for pulmonary anthrax. Infect Immun. 2006;74:6067–6074. doi: 10.1128/IAI.00719-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Hoffmaster AR, Hill KK, Gee JE, Marston CK, De BK, Popovic T, Sue D, Wilkins PP, Avashia SB, Drumgoole R, Helma CH, Ticknor LO, Okinaka RT, Jackson PJ. Characterization of Bacillus cereus isolates associated with fatal pneumonias: strains are closely related to Bacillus anthracis and harbor B. anthracis virulence genes. J Clin Microbiol. 2006;44:3352–3360. doi: 10.1128/JCM.00561-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  22. Hoffmaster AR, Ravel J, Rasko DA, Chapman GD, Chute MD, Marston CK, De BK, Sacchi CT, Fitzgerald C, Mayer LW, Maiden MC, Priest FG, Barker M, Jiang L, Cer RZ, Rilstone J, Peterson SN, Weyant RS, Galloway DR, Read TD, Popovic T, Fraser CM. Identification of anthrax toxin genes in a Bacillus cereus associated with an illness resembling inhalation anthrax. Proc Natl Acad Sci USA. 2004;101:8449–8454. doi: 10.1073/pnas.0402414101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Ivanova N, Sorokin A, Anderson I, Galleron N, Candelon B, Kapatral V, Bhattacharyya A, Reznik G, Mikhailova N, Lapidus A, Chu L, Mazur M, Goltsman E, Larsen N, D’Souza M, Walunas T, Grechkin Y, Pusch G, Haselkorn R, Fonstein M, Ehrlich SD, Overbeek R, Kyrpides N. Genome sequence of Bacillus cereus and comparative analysis with Bacillus anthracis. Nature. 2003;423:87–91. doi: 10.1038/nature01582. [DOI] [PubMed] [Google Scholar]
  24. Jensen GB, Hensen BM, Eilenberg J, Mahillon J. The hidden lifestyles of Bacillus cereus and relatives. Environ Microbiol. 2003;5:631–640. doi: 10.1046/j.1462-2920.2003.00461.x. [DOI] [PubMed] [Google Scholar]
  25. Kendall FE, Heidelberger M, Dawson MH. A serologically inactive polysaccharide elaborated by mucoid strains of group A hemolytic Streptococcus. J Biol Chem. 1937;118:61–69. [Google Scholar]
  26. Kern JW, Schneewind O. BslA, a pXO1-encoded adhesin of Bacillus anthracis. Mol Microbiol. 2008;68:504–515. doi: 10.1111/j.1365-2958.2008.06169.x. [DOI] [PubMed] [Google Scholar]
  27. Kern JW, Schneewind O. BslA, the S-layer adhesin of Bacillus anthracis, is a virulence factor for anthrax pathogenesis. Mol Microbiol. 2009;75:324–332. doi: 10.1111/j.1365-2958.2009.06958.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Kim HU, Goepfert JM. A sporulation medium for Bacillus anthracis. J Appl Bacteriol. 1974;37:265–267. doi: 10.1111/j.1365-2672.1974.tb00438.x. [DOI] [PubMed] [Google Scholar]
  29. Kintzer AF, Thoren KL, Sterling HJ, Dong KC, Feld GK, Tang II, Zhang TT, Williams ER, Berger JM, Krantz BA. The protective antigen component of anthrax toxin forms functional octameric complexes. J Mol Biol. 2009;392:614–629. doi: 10.1016/j.jmb.2009.07.037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Koch R. Die Ätiologie der Milzbrand-Krankheit, begründet auf die Entwicklungsgeschichte des Bacillus anthracis. Beiträge zur Biologie der Pflanzen. 1876;2:277–310. [Google Scholar]
  31. Leppla SH. Anthrax toxin edema factor: a bacterial adenylate cyclase that increases cyclin AMP concentrations in eukaryotic cells. Proc Natl Acad Sci USA. 1982;79:3162–3166. doi: 10.1073/pnas.79.10.3162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Leppla SH. Anthrax toxin. In: Aktories K, Just I, editors. Bacterial protein toxins. Springer; 2000. pp. 445–472. [Google Scholar]
  33. Marraffini LA, Schneewind O. Targeting proteins to the cell wall of sporulating Bacillus anthracis. Mol Microbiol. 2006;62:1402–1417. doi: 10.1111/j.1365-2958.2006.05469.x. [DOI] [PubMed] [Google Scholar]
  34. Menzel EJ, Farr C. Hyaluronidase and its substrate hyaluronan: biochemistry, biological activities and therapeutic uses. Cancer Lett. 1998;131:3–11. doi: 10.1016/s0304-3835(98)00195-5. [DOI] [PubMed] [Google Scholar]
  35. Meyer K, Chaffee E, Hobby GL, Dawson MH. Hyaluronidases of bacterial and animal origin. J Exp Med. 1941;73:309–326. doi: 10.1084/jem.73.3.309. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Meyer K, Palmer JW. The polysaccharide of the vitreous humor. J Biol Chem. 1934;107:629–634. [Google Scholar]
  37. Milne J, Furlong D, Hanna PC, Wall JS, Collier RJ. Anthrax protective antigen forms oligomers during intoxication of mammalian cells. J Biol Chem. 1994;269:20607–20612. [PubMed] [Google Scholar]
  38. Milne JC, Blanke SR, Hanna PC, Collier RJ. Protective antigen-binding domain of anthrax lethal factor mediates translocation of a heterologous protein fused to its amino- or carboxy-terminus. Mol Microbiol. 1995;15:661–666. doi: 10.1111/j.1365-2958.1995.tb02375.x. [DOI] [PubMed] [Google Scholar]
  39. Mock M, Fouet A. Anthrax. Annu Rev Microbiol. 2001;55:647–671. doi: 10.1146/annurev.micro.55.1.647. [DOI] [PubMed] [Google Scholar]
  40. Okinaka RT, Cloud K, Hampton O, Hoffmaster AR, Hill KK, Keim P, Koehler TM, Lamke G, Kumano S, Mahillon J, Manter D, Martinez Y, Ricke D, Svensson R, Jackson PJ. Sequence and organization of pXO1, the large Bacillus anthracis plasmid harboring the anthrax toxin genes. J Bacteriol. 1999;181:6509–6515. doi: 10.1128/jb.181.20.6509-6515.1999. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Preisz H. Experimentelle Studien über Virulenz, Empfänglichkeit und Immunität beim Milzbrand. Zeitschrift für Immunitäts-Forschung. 1909;5:341–452. [Google Scholar]
  42. Reed LJ, Muench H. A simple method of estimating fifty per cent endpoints. Am J Hyg. 1938;27:493–497. [Google Scholar]
  43. Richter GS, Anderson JV, Garufi G, Lu L, Joachimiak A, He C, Schneewind O, Missiakas D. Capsule anchoring in Bacillus anthracis occurs by a transpeptidation mechanism that is inhibited by capsidin. Mol Microbiol. 2009;71:404–420. doi: 10.1111/j.1365-2958.2008.06533.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Robertson DL, Leppla SH. Molecular cloning and expression in Escherichia coli of the lethal factor gene of Bacillus anthracis. Gene. 1986;44:71–78. doi: 10.1016/0378-1119(86)90044-2. [DOI] [PubMed] [Google Scholar]
  45. Schrager HM, Alberti S, C C, Dougherty GL, Wessels MR. Hyaluronic acid capsule modulates M protein-mediated adherence and acts as a ligand for attachment of group A Streptococcus to CD44 on human keratinocytes. J Clin Invest. 1998;101:1708–1716. doi: 10.1172/JCI2121. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Scobie HM, Rainey GJ, Bradley KA, Young JA. Human capillary morphogenesis protein 2 functions as an anthrax toxin receptor. Proc Natl Acad Sci U S A. 2003;100:5170–5174. doi: 10.1073/pnas.0431098100. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Silo-Suh LA, Lethbridge BJ, Raffel SJ, He H, Clardy J, Handelsman J. Biological activities of two fungistatic antibiotics produced by Bacillus cereus UW85. Appl Env Microbiol. 1994;60:2023–2030. doi: 10.1128/aem.60.6.2023-2030.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Smith H, Keppie HS, Stanley JI. The chemical basis of the virulence of Bacillus anthracis. I. Properties of bacteria grown in vivo and preparation of extracts. Br J Exp Pathol. 1953;34:477–485. [PMC free article] [PubMed] [Google Scholar]
  49. Sterne M. Avirulent anthrax vaccine. Onderstepoort J Vet Sci Animal Ind. 1937;21:41–43. [PubMed] [Google Scholar]
  50. Tomcsik J, Szongott H. Über ein spezifisches Protein der Kapsel des Milzbrandbazillus. Zeitschrift für Immunitäts-Forschung. 1933;78:86–99. [Google Scholar]
  51. Uchida I, Hashimoto K, Terakado N. Virulence and immunogenicity in experimental animals of Bacillus anthracis strains harbouring or lacking 110 MDa and 60 MDa plasmids. J Gen Microbiol. 1986;132:557–559. doi: 10.1099/00221287-132-2-557. [DOI] [PubMed] [Google Scholar]
  52. Vodkin MH, Leppla SH. Cloning of the protective antigen gene of Bacillus anthracis. Cell. 1983;34:693–697. doi: 10.1016/0092-8674(83)90402-6. [DOI] [PubMed] [Google Scholar]
  53. Welkos SL, Keener TJ, Gibbs PH. Differences in susceptibility of inbred mice to Bacillus anthracis. Infect Immun. 1986;51:795–800. doi: 10.1128/iai.51.3.795-800.1986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Welkos SL, Trotter RW, Becker DM, Nelson GO. Resistance to the Sterne strain of B. anthracis: phagocytic cell responses of resistant and susceptible mice. Microb Pathogen. 1989;7:15–35. doi: 10.1016/0882-4010(89)90108-3. [DOI] [PubMed] [Google Scholar]
  55. Wessels MR, Moses AE, Goldberg JB, DiCesare TJ. Hyaluronic acid capsule is a virulence factor for mucoid group A streptococci. Proc Natl Acad Sci USA. 1991;88:8317–8321. doi: 10.1073/pnas.88.19.8317. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Young JA, Collier JR. Anthrax toxin: receptor binding, internalization, pore formation and translocation. Annu Rev Biochem. 2007;76:243–265. doi: 10.1146/annurev.biochem.75.103004.142728. [DOI] [PubMed] [Google Scholar]

RESOURCES