Activation of proliferation and differentiation of dental follicle stem cells (DFSCs) by heat stress

M Rezai Rad; GE Wise; H Brooks; MB Flanagan; S Yao

doi:10.1111/cpr.12004

. 2012 Dec 21;46(1):58–66. doi: 10.1111/cpr.12004

Activation of proliferation and differentiation of dental follicle stem cells (DFSCs) by heat stress

M Rezai Rad ¹, GE Wise ¹, H Brooks ¹, MB Flanagan ¹, S Yao ^1,^✉

PMCID: PMC3540160 NIHMSID: NIHMS410979 PMID: 23278983

Abstract

Objectives

Adult stem cells (ASCs) remain in a slowly cycling/quiescent state under normal physiological conditions, but they can be awakened from this by certain factors, such as injury signals. Previously, our group has shown that dental follicle stem cells (DFSCs) appear to proliferate more rapidly than their non‐stem cell counterparts at elevated temperatures. The study described here has aimed to (i) elucidate optimal temperature in which to culture DFSCs, (ii) determine whether elevated temperatures could enhance differentiation capability of DFSCs and (iii) characterize stem cell and osteogenic marker expression of DFSCs at elevated temperatures.

Materials and methods

DFSCs obtained from rat first molars were cultured at 37 (control), 38, 39, 40 and 41 ºC. Cell proliferation was evaluated by Alamar blue reduction assay and mean numbers of viable dissociated cells. Osteogenic differentiation was evaluated after 7 or 14 days osteogenic induction. Expression of selected marker genes was also assessed during proliferation and differentiation of the cells.

Results

Increased cell proliferation was seen at heat‐stress temperatures of 38º, 39º and 40 ºC. DFSCs revealed maximal osteogenesis when cultured at 39 and 40 ºC. Moreover, some stem cell and osteogensis‐associated markers had elevated expression in heat‐stress conditions.

Conclusions

Under determined heat‐stress conditions, DFSCs increased their proliferation, osteogenic differentiation and expression of some marker genes. Thus, it is likely that elevated temperature could serve as a factor to activate adult stem cells.

Introduction

Stem cells residing in adult tissues are termed adult stem cells (ASCs). ASCs are non‐differentiated and play important roles in maintaining tissue integrity in vivo through both normal tissue renewal and pathological tissue regeneration 1. Due to the therapeutic potential of ASCs, extensive research has been attempted to isolate and characterize them from various sources including dental tissues (for example, dental follicle and dental pulp). Dental stem cells have been shown to be an optimal alternative source of stem cells in reconstructive dentistry and regeneration of craniofacial defects 2 and studies have shown that dental follicle stem cells (DFSCs) have typical ASC properties of self‐renewal, colony formation and multi‐lineage differentiation 3, 4, suggesting that they could be useful for tissue engineering and in regenerative medicine.

It is believed that the majority of ASCs residing in tissues exist in a slowly cycling or quiescent state under normal physiological conditions 5, 6. This quiescent property is one of the self‐protection mechanisms of ASCs to protect them from malignant transformation and to prevent stem cell pool exhaustion 5, 7. However, this quiescent state can be awakened by certain factors, such as tissue injury signals released by damaged cells 8, 9. Once activated, ASCs can be recruited to distant sites of injury, to repair or regenerate damaged tissue.

Besides slow cycling, a further self‐protection mechanism is that stem cells exhibit higher stress tolerance than differentiated cells 10. Recent studies in our laboratory revealed that DFSCs express higher levels of certain heat‐shock proteins (HSPs) than do their non‐stem cell counterparts 11. It is well known that HSPs can protect cells from stress damage, thus, high‐level expression of these proteins would allow DFSCs to endure such stress conditions. We have shown that DFSCs appear to proliferate more rapidly than their non‐stem cell counterparts in heat‐stress conditions, suggesting that heat stress could serve as a signal to activate stem cells from their quiescent state 11. Thus, we proposed that the stress‐tolerant differential of stem cells and non‐stem cells could be explored to develop cell culture conditions for purification and proliferation of stem cells.

Given the above background knowledge, our objectives for the study described below were to answer the following questions: (i) What is the optimal temperature for DFSC cultures? (ii) Can heat stress serve as a signal to activate/stimulate proliferation and differentiation of these cells? (iii) What stem cell‐related genes are affected by heat stress during proliferation and differentiation? Addressing these questions would help in understanding stem‐cell biology and developing methods for their proliferation and differentiation. Results of this research also have significant implications for application of DFSCs, as well as to other ASCs.

Materials and methods

Cell culture

Dental follicles were surgically isolated from first mandibular molars of rat pups at 6‐7 days postnatally. Followed by trypsinization, primary dental follicle cell suspensions were obtained, and then cells were cultured in stem cell growth medium consisting of α‐MEM (Invitrogen, Grand Island, NY, USA), 20% FBS and antibiotics 3 to establish DFSC culture. To establish non‐stem cell dental follicle cells (DFCs), primary cells were cultured in fibroblast growth medium 12. DFCs established under such conditions have previously been shown to contain no stem cells 3. Cultures were maintained at 37 ºC and in 5% CO₂ atmosphere. Stem cell medium was changed every 4 days and at 80–90% confluence, cells were detached using trypsin and passed into new flasks. DFSCs at passages 3–5 were used throughout this study.

Cell proliferation assays

Equal numbers of DFSCs (10⁴ cells/well) were seeded in 6‐well plates and cultured in stem cell growth medium. Plates were incubated at 37 ºC (control), 38, 39, 40 and 41 ºC for 1, 3 and 5 days. Cell proliferation was evaluated using the Alamar blue reduction assay 11. For this, culture medium was removed and 1 ml of assay medium containing α‐MEM, 10% FBS and 10% Alamar blue (Invitrogen) was added to each well. After 2 h incubation, 100 μL assay medium was loaded into 96‐well plates and optical density was read at 570 and 595 nm. Alamar blue reduction was calculated using the formula provided by the manufacturer (Invitrogen).

To confirm results of Alamar blue reduction, a cell counting‐based method was performed to obtain numbers of viable dissociated cells, as described in the literature 13. In particular, DFSCs were seeded in T‐25 flasks at density of 10⁴ cells/flask and cultured for 5 days. They were then trypsinized and collected by centrifugation. After re‐suspension in 5 ml fresh medium, numbers of dissociated cells were counted for each treatment, using a Cellometer^™ Auto T4 cell counter (Nexcelom Bioscience, Lawrence, MA, USA). Results were reported as number of dissociated cells/ml.

Osteogenic differentiation

For assessment of effects of temperature on osteogenic potential of DFSCs, cells proliferated at 37 °C were seeded into 6‐well plates at the density of 10⁵ cells/well, and incubated in osteogenic medium at a range of temperatures from 37 °C to 41 °C. Osteogenic medium consisted of DMEM‐LG, 10% FBS, 50 μg/ml ascorbate‐2 phosphate, 10⁻⁸ M dexamethasone and 10 mM β‐glycerophosphate. After 7 and 14 days induction, mineral deposition was evaluated using alizarin red staining.

Gene expression study

To explore effects of the elevated temperatures (heat‐stress) on molecular characterization of DFSCs, the cells were collected after designated times of incubation at the designated heat‐stress temperatures, during proliferation and differentiation, respectively. For proliferation, cells were collected after 7 days incubation in stem‐cell growth medium. For differentiation, they were harvested after 7 and 14 days osteogenic induction. We also assessed effects of heat stress on expression of marker genes in non‐stem cell DFCs; for this, the DFCs were incubated in identical heat‐stress condition as for DFSCs for 7 days, before being collected for RNA isolation.

Total RNA was extracted using RNeasy Mini Kit (Qiagen, Valencia, CA, USA) from collected cells. Gene expression of selected stem‐cell markers and osteogenic markers was determined using real‐time RT‐PCR with primers listed in Table 1. Briefly, about 2 μg RNA was reverse transcribed into 20 μl cDNA using random primers and MLV reverse transcriptase (Invitrogen). SYBR green real‐time PCR was conducted with 0.5 μl cDNA for each sample. Relative gene expression (RGE) was calculated using Delta C_T method with temperature of 37 °C as control.

Table 1.

Primer pairs used for Real time‐PCR

Marker genes	Abbreviation	Forward Primer	Reverse Primer
Alkaline phosphatase	ALP	GACAAGAAGCCCTTCACAGC	ACTGGGCCTGGTAGTTGTTG
Breast cancer resistance protein	BCRP	GTTTGGACTCAAGCACAGCA	AATACCGAGGCTGGTGAATG
Biglycan	Bgn	AGAATGGGAGCCTGAGTTTTCT	ACCTTGGTGATGTTGTTGGAGT
Bone morphogenetic protein‐2	BMP2	CTCAGCGAGTTTGAGTTGAGG	GGTACAGGTCGAGCATATAGGG
Bone morphogenetic protein‐3	BMP3	TACTACAGTCCCTTCCGTCTCC	AAACAACCTAGCCACAGACACA
Bone morphogenetic protein‐6	BMP6	CTTACAGGAGCATCAGCACAGA	GTCACCACCCACAGATTGCTA
Collagen Type III A1	Col3a1	GAAAGAATGGGGAGACTGGAC	TATGCCTTGTAATCCTTGTGGA
Collagen Type Ix A1	Col9a1	TGAGAGTTGTGCAAGAGCATTT	ATCTGACCAGGGAAACCATTC
Receptor tyrosine kinases	C‐kit	ACAAGAGGAGATCCGCAAGA	AGCAAATCATCCAGGTCCAG
Cathepsin K	Ctsk	TCTCACATTCCTTCCTCAACAG	GACTCCAGCGTCTATCAGCAC
fms‐related tyrosine kinase 1	Flt1	ACAGAAGAGGATGAGGGTGTCT	ATCAGCTCCAGGTTTGACTTGT
Oestrogen‐related receptor beta	Esrrb	GTGCCTGAAGGGGATATCAA	AGAAACCTGGGATGTGCTTG
Runt‐related transcription factor 2	Runx2	TACTTCGTCAGCGTCCTATCAG	ATCAGCGTCAACACCATCATT
Secreted phosphoprotein 1	Spp1	GCTTGGCTTACGGACTGAGG	GCAACTGGGATGACCTTGATA

Open in a new tab

Alkaline phosphatase staining

Cells were seeded into 6‐well plates at 10⁴/well density. After 7 days incubation at designated temperatures, cells were stained for cell membrane alkaline phosphatase (ALP) using a Stem TAG ^™ alkaline phosphatase staining kit (Cell Biolabs, INC., San Diego, CA, USA) according to manufacturer's protocol. Briefly, cells were fixed and then incubated in staining solution for 20 min with no exposure to light. The staining solution was then removed and plates were washed in PBS. ALP staining was observed using an inverted microscope. Cells cultured at normal temperature (37 ºC) were used as controls.

Statistical analysis

Each experiment was replicated at least three times. Effects of treatment were compared using analysis of variance (ANOVA) and SAS program. Means were separated with least significant difference (LSD) at P < 0.05.

Results

Optimal temperature for growth of DFSCs

Alamar blue reduction assay was conducted to monitor cell proliferation. Increase in Alamar blue reduction indicates increase in cell number in the culture. Significantly higher Alamar blue reduction was seen when cells were incubated at 38–40 °C compared to 37 °C control over 3 days incubation (Fig. 1a). In contrast, cells incubated at 41 °C had lowest Alamar blue reduction, which was lower than cells cultured at 37 °C and other heat‐stress temperatures (Fig. 1a).

**Proliferation of DFSCs at different temperatures (37–41 ºC) was continuously monitored using Alamar blue reduction assay after 1, 3 and 5 days incubation** (a). Final cell numbers after 5 days culture were assessed by cell counting (b). Note that significant increase in cell proliferation was observed at the heat‐stress temperatures of 38–40 ºC after 3 and 5 days incubation compared to 37 °C (control), whereas cell number after 5 days incubation was significantly lower at 41 ºC compared to other temperatures. Same letter bars indicate no significant difference at P < 0.05.

Alamar blue is a non‐toxic dye used for continuously monitoring cell number expansion in cultures. Its sensitivity reduces once cultures reach certain cell densities. Thus, a more accurate and labour‐intensive cell counting‐based method was used to obtain mean numbers of dissociated cells/ml after 5 days incubation, as shown in Fig. 1b. The number of dissociated cells was 2.1 × 10³ cells/ml when incubated at 37 °C (control), whereas continuous increase in the number of cells was observed when cultured at elevated temperatures, with a maximum cell number being 5.45 × 10³/ml at 40 °C (Fig. 1b). Cell number increase was statistically significant at 38–40 °C when compared to 37 °C control. In contrast to that increase, significant reduction in cell number was seen when cells were cultured at 41 ºC. Thus, results based on cell counting and Alamar blue reduction assay suggest that optimal temperature for rapid population growth of DFSCs would be in mild heat‐stress conditions below 41 °C.

Differentiation of DFSCs at elevated temperatures

Subjecting DFSCs to osteogenic differentiation at different temperatures, we observed that osteogenesis (as shown by alizarin red staining) could occasionally be detected after as early as 7 days induction only at 39 and 40 °C treatments (Fig. 2a). After 14 days induction, osteogenesis occurred at all treatments and osteogenesis increased coincidently with increase in temperatures from 37 °C to 40 °C with maximum seen at 39 °C and 40 °C (Fig. 2b). However, when DFSCs were incubated at 41 °C for osteogenic induction, complete loss of osteogenesis was usually observed, although a low level of osteogenesis was still sometimes seen (Fig. 2c).

**Effect of temperatures on induction of osteogenic differentiation of DFSCs as determined by alizarin red staining.** (a) Mineral deposition was detected after 7 days induction only from cells incubated at 39 °C and 40 °C (arrows). (b) Increase in staining was seen as temperatures increased from 37 ºC to 40 ºC after 14 days induction. (c) When DFSCs were subjected to osteogenic differentiation at 41 °C for 14 days, variability in osteogenesis was observed ranging from loss of osteogenic capability to abnormal osteogenesis.

Expression of stem cell‐related markers

DFSCs were collected after 7 days incubation in stem cell growth medium at different temperatures for gene expression analysis. RGE of selected stem cell markers was determined by real‐time RT‐PCR as shown in Fig. 3a. Increased expression of ALP, BCRP, BMP3, COL9a1, C‐kit and Esrrb were observed when cells were cultured at 38–40 ºC, compared to controls grown at 37 ºC. In general, increase in gene expression was coincident with increase in temperature. Statistical analysis determined that the increases were significant for ALP, BCRP and Col9a1 at 39 ºC and 40 ºC compared to 37 ºC control. DFSCs grown at different temperatures also were stained for membrane ALP activity. Results showed that a great number of cells cultured at 38–40 ºC expressed high levels of membrane ALP (Fig. 3c), whereas low ALP was observed for DFSCs incubated at 41 ºC.

Expression of selected stem‐cell marker genes in DFSCs and DFCs after 1‐week incubation in different temperatures, as determined by real‐time RT‐PCR. Relative gene expression (RGE) was calculated from 4 replicates in the DFSCs (a) and in the DFCs (b). Bar (RGE) with * indicates significant difference at P < 0.05 compared to control. (c) Alkaline phosphatase (ALP) staining of DFSCs demonstrated that number of cells positive for ALP increased at 39 ºC and 40 ºC compared to 37 ºC control, whereas decrease in ALP‐positive cells was observed at 41 ºC.

When DFCs were incubated at elevated temperatures, slight increases in ALP and BCRP were observed, but with no statistical significance (Fig. 3b). RGE of DFCs were generally lower than those of DFSCs, except for BMP3. For example, at 40 °C, ALP increased more than 90% (that is, RGE >1.9) in DFSCs, whereas for DFCs, the increase was only 20%. Reduction in expression of Col9a1 and c‐kit of DFCs was observed at certain heat‐stress conditions, but statistical differences were not detected. Thus, in general, heat‐stress treatments appeared to cause no significant change in expression of these stem cell marker genes in DFCs. Interestingly, heat stress at 40 °C produced a significant increase in BMP3 expression in DFCs (Fig. 3b), but not in DFSCs (Fig. 3a).

For assessment of expression of osteogenic markers during osteogenic induction, DFSCs were collected after 7 and 14 days osteogenic induction at the appropriate temperatures (Fig. 4). Real‐time RT‐PCR analysis of selected osteogenic markers indicated that after 7 days induction, expression of BMP2, Col3a1 and Bgn were slightly enhanced at 39 ºC and 40 ºC with maximum of 50% increase compared to controls. In contrast, more than 50% increase in expression of BMP6, Flt1, Runx2 and SPP1 was detected at elevated temperatures versus 37 °C. Of these, more than 2‐fold increase in Runx2 and SPP1 was seen after some treatments (Fig. 4a). Generally, as temperature increased from 37 °C to 40 °C, expression of these osteogenic markers also increased, with exception of Ctsk. Statistical analysis indicated that increased gene expression was significant at 39 °C and 40 ºC compared to control (Fig. 4a).

**Expression of osteoblast marker genes in DFSCs subjected to osteogenic induction. Relative gene expression (RGE) was determined by real‐time RT‐PCR after 7 days induction** (a) and after 14 days induction (b). Relative gene expression (RGE) was calculated from 3 experiments. Bar (RGE) with * indicates significant difference at P < 0.05 compared to control (37 ºC). Note that significantly increased expressions of *BMP6* and *Flt1* were observed in heat‐stress treatments compared to control after 7 days osteogenic induction. However, expressions of *BMP6* and *Flt1* were reduced for heat‐stress treatments after 14 days induction.

Expression of osteogenic markers was also determined after 14 days induction at the different temperatures (Fig. 4b). Expression of BMP2, Col3a1, Ctsk and Bgn was still significantly higher at higher temperature treatments than controls. However, no significant increase was seen in expression of BMP6 and Flt1 between higher temperature treatments and 37 °C control. A significant reduction in Flt1 expression was observed after 14 days induction at 40 ºC.

Discussion

DFSCs have been isolated from different species including humans and rats 3, 4, and their potential use in tissue regeneration has been investigated. Due to dental follicle being very small and a limited source of such tissue, isolation of large quantities of DFSCs is difficult. Rapid expansion of primary isolation to obtain sufficient numbers of these stem cells with high differentiation potential is usually necessary for their clinical application. Evidence from our previous studies has shown that DFSCs are likely to be more tolerant to heat stress than their non‐stem cell counterparts. We have previously reported that DFSCs grew more rapidly under certain heat‐stress conditions than at 37 °C 11. In the study described here, we have determined that optimal temperature for in vitro proliferation of DFSCs was 39–40 °C (Fig. 1a, b).

Other studies have suggested that most ASCs exist in tissues in quiescence 5, 6, and cell injury signals could activate quiescent stem cells to start rapid proliferation and differentiation for tissue repair 8. For example, in the case of hepatic diseases, various stem cells are activated and recruited to a site of injury for liver regeneration 14. Here, DFSCs grown in mild heat‐stress conditions equivalent to temperatures reached during common fever, resulted in rapid cell proliferation (Fig. 1).

Recent findings suggest that heat stress could promote neural differentiation of mouse embryonal carcinoma stem cells, and that HSPs appear to regulate this differentiation 15. To determine whether heat‐stress treatments would be able to enhance differentiation capability of DFSCs, they were subjected to osteogenic induction at temperatures ranging from 37 °C to 41 °C. DFSCs from 38 to 40 °C treatments resulted in greater osteogenesis than did 37 °C control (Fig. 2b), indicating that appropriate heat‐stress treatments could promote differentiation. Our previous studies have revealed that DFSCs express higher levels of several HSPs than do their non‐stem cell counterparts 11; however, further work is needed to determine exact roles of HSPs in promoting osteogenesis of DFSCs. Taken together, the results suggest that elevated temperature could possibly serve as a signal to activate tissue stem cells to undergo proliferation and differentiation.

Based on marker gene expression, DFSCs had significantly higher expression of selected markers including ALP, BCRP, Col9a1 and c‐kit after incubation at elevated temperatures (Fig. 3a). This could be due to increase in stem cell numbers in the cell population, and/or enhanced expression of the markers by heat‐stress treatments. Regarding the former, it should be kept in mind that the DFSC population used in this study was heterogeneous, in that it contained stem cells and non‐stem cells. Because stem cells possess greater heat tolerance and proliferate more rapidly than non‐stem cells in heat‐stress conditions, number of stem cells in this population could be increased after proliferation at elevated temperatures 11. Another possibility is that heat‐stress induced expression of the marker genes. We cultured the non‐stem cell dental follicle cells (DFCs) at elevated temperatures and found that heat stress did not result in significant change in expression of these genes in the DFCs (Fig. 3b). Thus, increased expression of the genes must largely emanate from the stem cells in the population. We speculate that increased expression of the genes in DFSCs under higher temperatures could possibly enhance cells' heat‐resistant capability, thus allowing DFSCs to endure heat‐stress as discussed below.

ALP has been reported to be a universal marker for all types of pluripotent stem cells 16, 17. Undifferentiated stem cells have elevated levels of ALP on their cell membranes, and thus membrane ALP staining is used to detect these cells 18. Enhancement of ALP activity by oxidative and heat stresses has been observed in intestinal epithelial cells and dental pulp cells, respectively 19, 20. When rat pulp cells were subjected to 42 °C heat stress for 30 min, ALP activity was increased in them for up to 14 days 20; our study indicated that ALP expression in DFSCs also was enhanced by heat stress (Fig. 3a, c). The role of ALP in protecting stem cells from heat stress is currently unknown.

BCRP is expressed abundantly in various ASCs 21 to serve as a detoxification mechanism of stem cells 22. We have shown that DFSCs can express BCRP 3 and it has been suggested that BCRP may play a physiological role in survival of stem cells in hypoxic environments 23. Significant increase in BCRP expression seen in heat‐stressed DFSCs (Fig. 3a) suggests that BCRP may also play a role in survival of stem cells under heat‐stress conditions.

C‐kit protein has been found on the surface of haematopoietic stem cells, as well as in mesenchymal stem cells 24, 25. Binding of stem cell factor (SCF) to C‐kit activates various types of signal transduction, which play roles in proliferation and differentiation of cells. In addition, the SCF/C‐kit pathway functions to protect cells from stress‐induced cell damage. For example, it has been suggested that SCF/C‐kit can activate an anti‐apoptotic pathway to promote cell survival 24, 26, 27. As heat stress can induce apoptosis 28, 29, increased expression of C‐kit in heat‐stressed DFSCs (Fig. 3a) may prevent activation of the apoptotic pathway at higher temperatures, and thus increase cell survival.

When DFSCs were subjected to osteogenic induction at different temperatures, osteogenesis could occur as early as 7 days in cells incubated at 39 °C or 40 °C, as detected by alizarin red staining (Fig. 2a). No osteogenesis could be seen in the 37 °C control, suggesting that osteogenic processes of DFSCs were accelerated at the higher temperature. This was supported by increased expression of osteogenic genes (BMP2, BMP6, Col3a1, Flt1, Runx2 and SPP1) seen in heat‐stressed cells compared to control cells after 7 days induction (Fig. 4a).

After 14 days induction, real‐time RT‐PCR showed that expression of osteogenic markers (except BMP6 and Flt1) at elevated temperature treatments remained at higher levels than controls (Fig. 4b), whereas RGE of BMP6 and Flt1 were greatly reduced at elevated temperature treatments. Given that BMP6 is the earliest of the BMPs to be expressed during osteogenic differentiation 30, its high level of expression at day 7 followed by levelling off at day 14 seen in this study suggest that BMP6 is likely to be important for osteogenic differentiation of DFSCs in initiation/early stages.

Flt1 protein (also known as vascular endothelial growth factor receptor1(VEGFR1)) and Flk1 (VEGFR2) are the two receptors that bind to VEGF for a variety of biological effects, such as in angiogenesis and haematopoiesis. In developing mice, metaphyseal blood vessels and trabecular bone formation are impaired when some VEGF activity is blocked 31. When exogenous VEGF has been applied to mouse femur fractures, blood vessel formation, ossification and new bone (callus) maturation were enhanced. Moreover, inhibition of VEGF dramatically slows down healing of tibial cortical bone defects 32. Thus, VEGF signalling plays important roles not only for angiogenesis, but also for osteogenesis. In that sense, a recent study has showed that inhibiting both Flt1 and Flk1 activity resulted in reduction of ALP activity during osteoblastic differentiation of cultured human periosteal‐derived cells. However, inhibiting Flk1 activity did not alter ALP activity 33, suggesting that Flt1 would be the receptor for VEGF signalling in osteogenesis. In the present study, we observed that Flt1 expression and osteogenesis increased in a concurrent manner in differentiating DFSCs at initiation stages (Figs 2a and 4a), and its expression was reduced in DFSCs once differentiation was complete (Figs 2b and 4b). This result provides additional evidence that VEGF/Flt1 could be the signalling pathway for osteogenic differentiation.

In conclusion, this study has demonstrated that elevated temperature could serve as a signal to activate stem cells (in this case, DFSCs) from quiescence to undergo proliferation and differentiation. The results are significant for tissue engineering and regenerative medicine application of stem cells. From a clinical perspective, the results could help design a treatment guideline in stem cell therapy. For example, prior to transplantation, the stem cells could be incubated at certain elevated temperatures to boost their osteogenic capability. A heat pad may be applied to an injury site after stem cell transplantation to promote proliferation and differentiation of the transplanted stem cells, and in turn to accelerate the healing process. However, appropriate temperature (for example, 39 °C) and duration would have to be carefully considered to avoid thermal damage to tissues if such a heat pad is used.

Results of this study indicate that culturing DFSCs under mild heat‐stress could effectively promote proliferation and osteogenic differentiation. Optimal temperatures to culture and differentiate DFSCs appears to be 39–40 ºC. This finding might be used to develop a cell culture conditions for rapid in vitro expansion of DFSCs for therapeutic applications.

Acknowledgements

This work was supported by grants 5R03DE018998‐02 and 5R01DE008911‐21 from the National Institute of Dental and Craniofacial Research (NIDCR).

References

1. Mimeault M, Batra SK (2006) Concise review: recent advances on the significance of stem cells in tissue regeneration and cancer therapies. Stem Cells 24, 2319–2345. [DOI] [PubMed] [Google Scholar]
2. Yu J, Wang Y, Deng Z, Tang L, Li Y, Shi J et al (2007) Odontogenic capability: bone marrow stromal stem cells versus dental pulp stem cells. Biol. Cell 99, 465–474. [DOI] [PubMed] [Google Scholar]
3. Yao S, Pan F, Prpic V, Wise GE (2008) Differentiation of stem cells in the dental follicle. J. Dent. Res. 87, 767–771. [DOI] [PMC free article] [PubMed] [Google Scholar]
4. Honda MJ, Imaizumi M, Tsuchiya S, Morsczeck C (2010) Dental follicle stem cells and tissue engineering. J. Oral Sci. 52, 541–552. [DOI] [PubMed] [Google Scholar]
5. Orford K W, Scadden DT (2008) Deconstructing stem cell self‐renewal: genetic insights into cell‐cycle regulation. Nature Rev. Genet. 9, 115–128. [DOI] [PubMed] [Google Scholar]
6. Arai F, Suda T (2007) Maintenance of quiescent hematopoietic stem cells in the osteoblastic niche. Ann. NY Acad. Sci. 1106, 41–53. [DOI] [PubMed] [Google Scholar]
7. Park Y, Gerson SL (2005) DNA repair defects in stem cell function and aging. Annu. Rev. Med. 56, 495–508. [DOI] [PubMed] [Google Scholar]
8. Wilson A, Laurenti E, Oser G, van der Wath RC, Blanco‐Bose W, Jaworski M et al (2008) Hematopoietic stem cells reversibly switch from dormancy to self‐renewal during homeostasis and repair. Cell 135, 1118–1129. [DOI] [PubMed] [Google Scholar]
9. Wang YZ, Plane JM, Jiang P, Zhou CJ, Deng W (2011) Concise review: quiescent and active states of endogenous adult neural stem cells: identification and characterization. Stem Cells. 29, 907–912. [DOI] [PMC free article] [PubMed] [Google Scholar]
10. Prinsloo E, Setati MM, Longshaw VM, Blatch GL (2009) Chaperoning stem cells: a role for heat shock proteins in the modulation of stem cell self‐renewal and differentiation? BioEssays 31, 370–377. [DOI] [PubMed] [Google Scholar]
11. Yao S, Gutierrez DL, He H, Dai Y, Liu D, Wise GE (2011) Proliferation of dental follicle‐derived cell populations in heat‐stress conditions. Cell Prolif. 44, 486–493. [DOI] [PMC free article] [PubMed] [Google Scholar]
12. Wise GE, Lin F, Fan W (1992) Culture and characterization of dental follicle cells from rat molars. Cell Tissue Res. 267, 483–492. [DOI] [PubMed] [Google Scholar]
13. Patel M, Smith AJ, Sloan AJ, Smith G, Cooper PR (2009) Phenotype and behavior of dental pulp cells during expansion culture. Arch. Oral Biol. 54, 898–908. [DOI] [PubMed] [Google Scholar]
14. Bird TG, Lorenzini S, Forbes SJ (2008) Activation of stem cells in hepatic diseases. Cell Tissue Res. 331, 283–300. [DOI] [PMC free article] [PubMed] [Google Scholar]
15. Afzal E, Ebrahimi M, Najafi SM, Daryadel A, Baharvand H (2011) Potential role of heat shock proteins in neural differentiation of murine embryonal carcinoma stem cells (P19). Cell Biol. Int. 35, 713–720. [DOI] [PubMed] [Google Scholar]
16. Pease S, Braghetta P, Gearing D, Grail D, Williams RL (1990) Isolation of embryonic stem (ES) cells in media supplemented with recombinant leukemia inhibitory factor (LIF). Dev. Biol 141, 344–352. [DOI] [PubMed] [Google Scholar]
17. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K et al (2007) Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861–872. [DOI] [PubMed] [Google Scholar]
18. O'Connor MD, Kardel MD, Iosfina I, Youssef D, Lu M, Li MM et al (2008) Alkaline phosphatase‐positive colony formation is a sensitive, specific, and quantitative indicator of undifferentiated human embryonic stem cells. Stem Cells, 26, 1109–1116. [DOI] [PubMed] [Google Scholar]
19. López‐Posadas R, González R, Ballester I, Martínez‐Moya P, Romero‐Calvo I, Suárez MD et al (2011) Tissue‐nonspecific alkaline phosphatase is activated in enterocytes by oxidative stress via changes in glycosylation. Inflamm. Bowel Dis. 17, 543–556. [DOI] [PubMed] [Google Scholar]
20. Lee MW, Muramatsu T, Uekusa T, Lee JH, Shimono M (2008) Heat stress induces alkaline phosphatase activity and heat shock protein 25 expression in cultured pulp cells. Int. Endod. J. 41, 158–162. [DOI] [PubMed] [Google Scholar]
21. Zhou C, Zhao L, Inagaki N, Guan J, Nakajo S, Hirabayashi T et al (2001) ATP‐binding cassette transporter ABC2/ABCA2 in the rat brain: a novel mammalian lysosome associated membrane protein and a specific marker for oligodendrocytes but not for myelin sheaths. J. Neurosci. 21, 849–857. [DOI] [PMC free article] [PubMed] [Google Scholar]
22. Kuo MT (2009) Redox regulation of multidrug resistance in cancer chemotherapy: molecular mechanisms and therapeutic opportunities. Antioxid. Redox Signal. 11, 99–133. [DOI] [PMC free article] [PubMed] [Google Scholar]
23. Krishnamurthy P, Ross DD, Nakanishi T, Bailey‐Dell K, Zhou S, Mercer KE et al (2004) The stem cell marker Bcrp/ABCG2 enhances hypoxic cell survival through interactions with heme. J. Biol. Chem. 279, 24218–24225. [DOI] [PubMed] [Google Scholar]
24. Edling CE, Hallberg B (2007) c‐Kit: a hematopoietic cell essential receptor tyrosine kinase. Int. J. Biochem. Cell Biol. 39, 1995–1998. [DOI] [PubMed] [Google Scholar]
25. Hatzistergos KE, Quevedo H, Oskouei BN, Hu Q, Feigenbaum GS, Margitich IS et al (2010) Bone marrow mesenchymal stem cells stimulate cardiac stem cell proliferation and differentiation. Circ. Res. 107, 913–922. [DOI] [PMC free article] [PubMed] [Google Scholar]
26. Iemura A, Tsai M, Ando A, Wershil BK, Galli SJ (1994) The c‐kit ligand, stem cell factor, promotes mast cell survival by suppressing apoptosis. Am. J. Pathol. 144, 321–328. [PMC free article] [PubMed] [Google Scholar]
27. Lennartsson J, Rönnstrand L (2006) The stem cell factor receptor/c‐Kit as a drug target in cancer. Curr. Cancer Drug Targets 6, 65–75. [DOI] [PubMed] [Google Scholar]
28. Yin Y, Hawkins KL, DeWolf WC, Morgentaler A (1997) Heat stress causes testicular germ cell apoptosis in adult mice. J. Androl. 18, 159–165. [PubMed] [Google Scholar]
29. Isom SC, Prather RS, Rucker EB 3rd (2007) Heat stress‐induced apoptosis in porcine in vitro fertilized and parthenogenetic preimplantation‐stage embryos. Mol. Reprod. Dev. 74, 574–581. [DOI] [PubMed] [Google Scholar]
30. Boden SD, Hair G, Titus L, Racine M, McCuaig K, Wozney JM et al (1997) Glucocorticoid‐induced differentiation of fetal rat calvarial osteoblasts is mediated by bone morphogenetic protein‐6. Endocrinology, 138, 2820–2828. [DOI] [PubMed] [Google Scholar]
31. Zelzer E, McLean W, Ng YS, Fukai N, Reginato AM, Lovejoy S et al (2002) Skeletal defects in VEGF(120/120) mice reveal multiple roles for VEGF in skeletogenesis. Development 129, 1893–1904. [DOI] [PubMed] [Google Scholar]
32. Street J, Bao M, deGuzman L, Bunting S, Peale FV Jr, Ferrara N et al (2002) Vascular endothelial growth factor stimulates bone repair by promoting angiogenesis and bone turnover. Proc. Natl Acad. Sci. USA 99, 9656–9661. [DOI] [PMC free article] [PubMed] [Google Scholar]
33. Hah YS, Jun JS, Lee SG, Park BW, Kim DR, Kim UK et al (2011) Vascular endothelial growth factor stimulates osteoblastic differentiation of cultured human periosteal‐derived cells expressing vascular endothelial growth factor receptors. Mol. Biol. Rep. 38, 1443–1450. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0001] 1. Mimeault M, Batra SK (2006) Concise review: recent advances on the significance of stem cells in tissue regeneration and cancer therapies. Stem Cells 24, 2319–2345. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0002] 2. Yu J, Wang Y, Deng Z, Tang L, Li Y, Shi J et al (2007) Odontogenic capability: bone marrow stromal stem cells versus dental pulp stem cells. Biol. Cell 99, 465–474. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0003] 3. Yao S, Pan F, Prpic V, Wise GE (2008) Differentiation of stem cells in the dental follicle. J. Dent. Res. 87, 767–771. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cpr12004-bib-0004] 4. Honda MJ, Imaizumi M, Tsuchiya S, Morsczeck C (2010) Dental follicle stem cells and tissue engineering. J. Oral Sci. 52, 541–552. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0005] 5. Orford K W, Scadden DT (2008) Deconstructing stem cell self‐renewal: genetic insights into cell‐cycle regulation. Nature Rev. Genet. 9, 115–128. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0006] 6. Arai F, Suda T (2007) Maintenance of quiescent hematopoietic stem cells in the osteoblastic niche. Ann. NY Acad. Sci. 1106, 41–53. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0007] 7. Park Y, Gerson SL (2005) DNA repair defects in stem cell function and aging. Annu. Rev. Med. 56, 495–508. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0008] 8. Wilson A, Laurenti E, Oser G, van der Wath RC, Blanco‐Bose W, Jaworski M et al (2008) Hematopoietic stem cells reversibly switch from dormancy to self‐renewal during homeostasis and repair. Cell 135, 1118–1129. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0009] 9. Wang YZ, Plane JM, Jiang P, Zhou CJ, Deng W (2011) Concise review: quiescent and active states of endogenous adult neural stem cells: identification and characterization. Stem Cells. 29, 907–912. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cpr12004-bib-0010] 10. Prinsloo E, Setati MM, Longshaw VM, Blatch GL (2009) Chaperoning stem cells: a role for heat shock proteins in the modulation of stem cell self‐renewal and differentiation? BioEssays 31, 370–377. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0011] 11. Yao S, Gutierrez DL, He H, Dai Y, Liu D, Wise GE (2011) Proliferation of dental follicle‐derived cell populations in heat‐stress conditions. Cell Prolif. 44, 486–493. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cpr12004-bib-0012] 12. Wise GE, Lin F, Fan W (1992) Culture and characterization of dental follicle cells from rat molars. Cell Tissue Res. 267, 483–492. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0013] 13. Patel M, Smith AJ, Sloan AJ, Smith G, Cooper PR (2009) Phenotype and behavior of dental pulp cells during expansion culture. Arch. Oral Biol. 54, 898–908. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0014] 14. Bird TG, Lorenzini S, Forbes SJ (2008) Activation of stem cells in hepatic diseases. Cell Tissue Res. 331, 283–300. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cpr12004-bib-0015] 15. Afzal E, Ebrahimi M, Najafi SM, Daryadel A, Baharvand H (2011) Potential role of heat shock proteins in neural differentiation of murine embryonal carcinoma stem cells (P19). Cell Biol. Int. 35, 713–720. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0016] 16. Pease S, Braghetta P, Gearing D, Grail D, Williams RL (1990) Isolation of embryonic stem (ES) cells in media supplemented with recombinant leukemia inhibitory factor (LIF). Dev. Biol 141, 344–352. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0017] 17. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K et al (2007) Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 131, 861–872. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0018] 18. O'Connor MD, Kardel MD, Iosfina I, Youssef D, Lu M, Li MM et al (2008) Alkaline phosphatase‐positive colony formation is a sensitive, specific, and quantitative indicator of undifferentiated human embryonic stem cells. Stem Cells, 26, 1109–1116. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0019] 19. López‐Posadas R, González R, Ballester I, Martínez‐Moya P, Romero‐Calvo I, Suárez MD et al (2011) Tissue‐nonspecific alkaline phosphatase is activated in enterocytes by oxidative stress via changes in glycosylation. Inflamm. Bowel Dis. 17, 543–556. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0020] 20. Lee MW, Muramatsu T, Uekusa T, Lee JH, Shimono M (2008) Heat stress induces alkaline phosphatase activity and heat shock protein 25 expression in cultured pulp cells. Int. Endod. J. 41, 158–162. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0021] 21. Zhou C, Zhao L, Inagaki N, Guan J, Nakajo S, Hirabayashi T et al (2001) ATP‐binding cassette transporter ABC2/ABCA2 in the rat brain: a novel mammalian lysosome associated membrane protein and a specific marker for oligodendrocytes but not for myelin sheaths. J. Neurosci. 21, 849–857. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cpr12004-bib-0022] 22. Kuo MT (2009) Redox regulation of multidrug resistance in cancer chemotherapy: molecular mechanisms and therapeutic opportunities. Antioxid. Redox Signal. 11, 99–133. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cpr12004-bib-0023] 23. Krishnamurthy P, Ross DD, Nakanishi T, Bailey‐Dell K, Zhou S, Mercer KE et al (2004) The stem cell marker Bcrp/ABCG2 enhances hypoxic cell survival through interactions with heme. J. Biol. Chem. 279, 24218–24225. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0024] 24. Edling CE, Hallberg B (2007) c‐Kit: a hematopoietic cell essential receptor tyrosine kinase. Int. J. Biochem. Cell Biol. 39, 1995–1998. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0025] 25. Hatzistergos KE, Quevedo H, Oskouei BN, Hu Q, Feigenbaum GS, Margitich IS et al (2010) Bone marrow mesenchymal stem cells stimulate cardiac stem cell proliferation and differentiation. Circ. Res. 107, 913–922. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cpr12004-bib-0026] 26. Iemura A, Tsai M, Ando A, Wershil BK, Galli SJ (1994) The c‐kit ligand, stem cell factor, promotes mast cell survival by suppressing apoptosis. Am. J. Pathol. 144, 321–328. [PMC free article] [PubMed] [Google Scholar]

[cpr12004-bib-0027] 27. Lennartsson J, Rönnstrand L (2006) The stem cell factor receptor/c‐Kit as a drug target in cancer. Curr. Cancer Drug Targets 6, 65–75. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0028] 28. Yin Y, Hawkins KL, DeWolf WC, Morgentaler A (1997) Heat stress causes testicular germ cell apoptosis in adult mice. J. Androl. 18, 159–165. [PubMed] [Google Scholar]

[cpr12004-bib-0029] 29. Isom SC, Prather RS, Rucker EB 3rd (2007) Heat stress‐induced apoptosis in porcine in vitro fertilized and parthenogenetic preimplantation‐stage embryos. Mol. Reprod. Dev. 74, 574–581. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0030] 30. Boden SD, Hair G, Titus L, Racine M, McCuaig K, Wozney JM et al (1997) Glucocorticoid‐induced differentiation of fetal rat calvarial osteoblasts is mediated by bone morphogenetic protein‐6. Endocrinology, 138, 2820–2828. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0031] 31. Zelzer E, McLean W, Ng YS, Fukai N, Reginato AM, Lovejoy S et al (2002) Skeletal defects in VEGF(120/120) mice reveal multiple roles for VEGF in skeletogenesis. Development 129, 1893–1904. [DOI] [PubMed] [Google Scholar]

[cpr12004-bib-0032] 32. Street J, Bao M, deGuzman L, Bunting S, Peale FV Jr, Ferrara N et al (2002) Vascular endothelial growth factor stimulates bone repair by promoting angiogenesis and bone turnover. Proc. Natl Acad. Sci. USA 99, 9656–9661. [DOI] [PMC free article] [PubMed] [Google Scholar]

[cpr12004-bib-0033] 33. Hah YS, Jun JS, Lee SG, Park BW, Kim DR, Kim UK et al (2011) Vascular endothelial growth factor stimulates osteoblastic differentiation of cultured human periosteal‐derived cells expressing vascular endothelial growth factor receptors. Mol. Biol. Rep. 38, 1443–1450. [DOI] [PubMed] [Google Scholar]

PERMALINK

Activation of proliferation and differentiation of dental follicle stem cells (DFSCs) by heat stress

M Rezai Rad

GE Wise

H Brooks

MB Flanagan

S Yao