Effect of Mutations of Arginine 94 on Proton Pumping, Electron Transfer, and Superoxide Anion Generation in Cytochrome b of the bc₁ Complex from Rhodobacter sphaeroides

Background: The bc₁ complex catalyzes electron transfer from ubiquinol to cytochrome c and translocates protons across the membrane.

Results: Substitution of Arg-94 decreased the electron transfer activity and proton pumping capability and increased the superoxide production.

Conclusion: Arg-94 is an important amino acid for the proton pumping capability of the bc₁ complex.

Significance: The result is significant for understanding the catalytic mechanism of the bc₁ complex.

Abstract

Proton transfer involving internal water molecules that provide hydrogen bonds and facilitate proton diffusion has been identified in some membrane proteins. Arg-94 in cytochrome b of the Rhodobacter sphaeroides bc₁ complex is fully conserved and is hydrogen-bonded to the heme propionate and a chain of water molecules. To further elucidate the role of Arg-94, we generated the mutations R94A, R94D, and R94N. The wild-type and mutant bc₁ complexes were purified and then characterized. The results show that substitution of Arg-94 decreased electron transfer activity and proton pumping capability and increased O₂^˙̄ production, suggesting the importance of Arg-94 in the catalytic mechanism of the bc₁ complex in R. sphaeroides. This also suggests that the transport of H⁺, O₂, and O₂^˙̄ in the bc₁ complex may occur by the same pathway.

Introduction

The cytochrome bc₁ complex (also known as ubiquinol-cytochrome c oxidoreductase or complex III) is a multisubunit dimeric integral membrane protein complex. It is an essential segment of cellular energy-conserving electron transport chains in animals, plants, and bacteria (1, 2). This complex catalyzes electron transfer from ubiquinol to cytochrome c (or cytochrome c₂ in bacteria) and concomitantly translocates protons across the membrane to generate a membrane potential and pH gradient for ATP synthesis. The cytochrome bc₁ complexes from all species contain three core subunits, cytochrome b, cytochrome c₁, and the Rieske iron-sulfur protein, which house two b-type cytochromes (b_H and b_L), one c-type cytochrome (c₁), and a high potential Rieske [2Fe-2S] cluster, respectively. Depending on the source, the cytochrome bc₁ complexes contain various numbers (zero to eight) of non-redox group-containing subunits, also called supernumerary subunits (3–5).

Intensive biochemical and biophysical studies on this complex (6–8) have led to the formulation of the “protonmotive Q-cycle” mechanism for electron and proton transfer in this complex (9–11). In the Q-cycle mechanism, it is postulated that the first electron of ubiquinol is transferred to the “high potential chain,” consisting of the Rieske iron-sulfur protein and cytochrome c₁. Then, the second electron of ubiquinol, via a transient semiquinone, is passed through the “low potential chain,” consisting of cytochromes b_L and b_H, to reduce ubiquinone or ubisemiquinone bound at the ubiquinol reduction site (Q_N). One drawback of this sequential scheme is the lack of a “functional” semiquinone at the ubiquinol oxidation site (Q_P) (12–14), even though some radicals have been reported under abnormal conditions (15, 16). Recently, pre-steady-state kinetic analysis of the reduction of cytochrome b_L and the Rieske iron-sulfur protein in the same sample using fast quenching coupled with EPR (17) indicated that both the iron-sulfur cluster and heme b_L are reduced by ubiquinol at the same rate, suggesting a concerted scheme for the bifurcated oxidation of ubiquinol at the Q_P site (18, 19).

It has been established that for every electron transferred through the bc₁ complex, two protons are translocated across the membrane. This 2H⁺/e⁻ stoichiometry has been verified in a wide variety of species through in vitro studies of bc₁ complexes in phospholipid (PL)² vesicles.

Arg-79 in cytochrome b of the yeast bc₁ complex is hydrogen-bonded to the heme propionate and provides a proton exit pathway to the bulk solvent mediated by a chain of hydrogen-bonded water molecules. Arg-79 is fully conserved in cytochrome b, indicating its importance for the catalytic mechanism (20). Arg-94 in cytochrome b of Rhodobacter sphaeroides corresponds to Arg-79 in yeast. To further elucidate the role of this important amino acid in cytochrome b of R. sphaeroides, we report herein detailed procedures for generating mutations of Arg-94 in cytochrome b and characterize the electron transfer activity, proton pumping capability, pre-steady-state reduction kinetics of hemes (b and c₁), and superoxide anion production in purified bc₁ complexes. We found that substitution of Arg-94 decreased electron transfer activity and proton pumping capability and increased superoxide anion production. The transport of H⁺, O₂, and O₂^˙̄ may follow the same pathway.

EXPERIMENTAL PROCEDURES

Materials

Cytochrome c (horse heart, type III), stigmatellin, antimycin A, carbonyl cyanide m-chlorophenylhydrazone (CCCP), and valinomycin were purchased from Sigma. 8-Hydroxypyrene-1,3,6-trisulfonic acid trisodium salt (pyranine) was from Acros Organics. Asolectin was obtained from Associated Concentrates and purified according to the method of Kagawa and Racker (21). n-Dodecyl-β-d-maltopyranoside and n-octyl-β-d-glucopyranoside were from Anatrace. Nickel-nitrilotriacetic acid gel, a QIAprep spin miniprep kit, and a PCR purification kit were obtained from Qiagen. 2-Methyl-6-(4-methoxyphenyl)-3,7-dihydroimidazo[1,2-α]pyrazin-3-onehydrochloride (MCLA) was from Molecular Probes. 2,3-Dimethoxy-5-methyl-6-(10-bromodecyl)-1,4-benzoquinol (Q₀C₁₀BrH₂) was prepared in our laboratory as reported previously (22). All other chemicals were of the highest purity commercially available.

Generation of R. sphaeroides Cytochrome bc₁ Mutants

Mutations were constructed using the QuikChange site-directed mutagenesis kit (Stratagene) with supercoiled double-stranded pGEM7Zf(+)-fbcB as a template. Forward and reverse primers were used for PCR amplification (Table 1). The pGEM7Zf(+)-fbcB plasmid (23) was constructed by ligating the NsiI-XbaI fragment from pRKD418-fbcFBC_6HQ into the NsiI and XbaI sites of the pGEM7Zf(+) plasmid. The NsiI-XbaI fragment from the pGEM7Zf(+)-fbcB_m plasmid was ligated into the NsiI and XbaI sites of the pRKD418-fbcFBK_mC_6HQ plasmid to generate the pRKD418-fbcFB_mC_6HQ plasmid. A plate-mating procedure (24) was used to mobilize the pRKD418-fbcFB_mC_6HQ plasmid in Escherichia coli S17 cells into R. sphaeroides BC17 cells. The presence of the engineered mutations was confirmed by DNA sequencing before and after semi-aerobic growth of the cells. The expression plasmid pRKDfbcF_mBC_HQ was purified from an aliquot of semi-aerobically grown culture using the Qiagen plasmid miniprep kit. Because R. sphaeroides cells contain four types of endogenous plasmids, the isolated plasmids lacked the purity and concentration needed for direct sequencing. Therefore, a 2-kilobase pair DNA segment containing the mutation sequence was amplified from the isolated plasmids by PCR. The PCR products were purified with an extraction kit from Sigma and then sequenced. DNA primers were purchased from Invitrogen. DNA sequencing was carried out at the Recombinant DNA/Protein Core Facility of Oklahoma State University.

TABLE 1.

Oligonucleotides used for site-directed mutagenesis

The underlined bases correspond to the genetic codes for the amino acid(s) to be mutated.

Primer	Sequence
R94A
Forward	GCTTCATGCTGGCCTACCTGCATGCG
Reverse	CGCATGCAGGTAGGCCAGCATGAAGC
R94N
Forward	GCTTCATGCTGAACTACCTGCATGCG
Reverse	CGCATGCAGGTAGTTCAGCATGAAGC
R94D
Forward	GCTTCATGCTGGACTACCTGCATGCG
Reverse	CGCATGCAGGTAGTCCAGCATGAAGC

Growth of Bacteria

E. coli cells were grown at 37 °C in LB medium. R. sphaeroides BC17 cells (24) were grown photosynthetically at 30 °C in enriched Siström's medium containing 5 mm glutamate and 0.2% casamino acids. Photosynthetic growth conditions for R. sphaeroides were essential as described previously (25). The concentrations and antibiotics used were as follows: ampicillin, 125 μg/ml; kanamycin sulfate, 30 μg/ml; tetracycline, 10 μg/ml for E. coli and 1 μg/ml for R. sphaeroides; and trimethoprim, 100 μg/ml for E. coli and 30 μg/ml for R. sphaeroides.

Enzyme Preparations and Specific Electron Transfer Activity Assay

Chromatophore membranes were prepared from frozen cell paste, and cytochrome bc₁ complexes with a His₆ tag placed at the C terminus of cytochrome c₁ were purified from chromatophores as described previously (25) and stored at −80 °C in the presence of 10% glycerol. Protein concentrations were determined by absorbance at 280 nm using a converting factor of 1 A₂₈₀ = 0.56 mg/ml. The concentrations of cytochromes b and c₁ were determined spectrophotometrically using published molar extinction coefficients (26–28).

To assay ubiquinol-cytochrome c reductase activity, purified cytochrome bc₁ complexes were diluted with 50 mm Tris-Cl (pH 8.0) containing 200 mm NaCl and 0.01% n-dodecyl-β-d-maltopyranoside to a final cytochrome b concentration of 1 μm unless specified otherwise. Appropriate amounts of the diluted samples were added to 1 ml of assay mixture containing 100 mm Na⁺/K⁺ phosphate buffer (pH 7.4), 0.3 mm EDTA, 100 μm cytochrome c, and 25 μm Q₀C₁₀BrH₂. The specific electron transfer activities were determined by measuring the reduction of cytochrome c (the increase in the absorbance at a wavelength of 550 nm) with a Shimadzu UV-2401 PC spectrophotometer at 23 °C using a millimolar extinction coefficient of 18.5 for calculation. The non-enzymatic oxidation of Q₀C₁₀BrH₂, determined under the same conditions in the absence of enzyme, was subtracted during specific activity calculations. Although the chemical properties of Q₀C₁₀BrH₂ are comparable with those of Q₀C₁₀H₂, the former is a better substrate for the cytochrome bc₁ complex (22).

Preparation of Electron Transfer Complex-inlaid PL Vesicles

Protein-PL vesicles were prepared by the cholate dialysis method of Kagawa and Racker (21). The wild-type or mutant bc₁ complex was mixed with 1 ml of asolectin micellar solution to give an asolectin (milligrams)/protein (milligrams) ratio of 40. The asolectin micellar solution was prepared by sonicating 200 mg of acetone-washed asolectin in 4 ml of 50 mm sodium phosphate buffer (pH 7.4) containing 2% sodium cholate and 100 mm KCl in an ice-water bath. Sonication was performed in an anaerobic environment by continually passing argon into the vessel. The bc₁ complex/PL mixtures were incubated at 0 °C for 30 min before overnight dialysis at 4 °C against 100 volumes of 50 mm sodium phosphate buffer (pH 7.4) containing 100 mm KCl with three changes of buffer. The mixture was then dialyzed against 100 volumes of 150 mm KCl for 3–4 h.

Determination of Proton Translocation Activity of bc₁ Complex-PL Vesicles

Proton translocation coupled to electron flow through the bc₁ complex-PL vesicles was measured at room temperature using an Accumet Model 10 pH meter and Model 13-620-96 combination pH electrode. 25 nmol of Q₀C₁₀BrH₂ was added to the 1.6-ml reaction mixture containing 150 mm KCl, 4 μm ferricytochrome c, 1 μm valinomycin, and an appropriate amount of bc₁ complex-PL vesicles (30–50 μl). Electron flow was initiated by the addition of 5 nmol of ferricyanide, which oxidizes the cytochrome c and thus provides an electron acceptor for the complex. Electron flow under conditions in which no transmembrane ΔpH formed was measured in an identical manner except that the protonophore CCCP was present at a concentration of 2 μm to make the vesicles permeable to protons. Proton pumping (H⁺/e⁻) was calculated as the ratio of the decrease in pH upon ferricyanide addition to bc₁ complex-PL vesicles before and after treatment with CCCP.

Fast Kinetics Study

Measurements were performed in an Applied Photophysics SX.18MV stopped-flow spectrometer with a photodiode array scan between 600 and 500 nm. The reaction was started by mixing equal volumes of solutions A and B at room temperature. For the experiment to determine electron transfer rates between ubiquinol and heme b or c₁, solution A contained 50 mm Tris-Cl (pH 8.0) at 4 °C, 200 mm NaCl, 0.01% n-dodecyl-β-d-maltopyranoside, and 12.0 μm cytochrome bc₁ complex (based on cytochrome c₁). Solution B was the same as solution A except that the bc₁ complex was replaced with 240 μm Q₀C₁₀BrH₂. Reductions of cytochromes b and c₁ were determined from the absorption changes at 560–580 nm and at 551–539 nm, respectively. When an inhibitor was used, the cytochrome bc₁ complex was treated with a 5-fold molar excess of inhibitor over heme c₁ for 5 min at 4 °C prior to the experiment.

Because the concentration of ubiquinol used was much higher than that of the cytochrome bc₁ complex, the reactions between bc₁ and ubiquinol were treated as pseudo first-order reactions. Time traces of the reaction were fitted using a first-order rate equation to obtain the pseudo first-order rate constants (k₁) by KaleidaGraph.

For the experiment to determine proton production rates, solution A contained 150 mm KCl, 30 μm Q₀C₁₀BrH₂, 2 μm valinomycin, 100 μm pyranine, and bc₁ complex-PL vesicles (35 μl/ml of solution A). Solution B contained 150 mm KCl and 8 μm ferricytochrome c. Solutions A and B were both adjusted carefully to pH 7.0 with 2 mm KOH. Proton pumping was determined from the absorption changes at 457 nm.

Measurement of Superoxide Anion Generation

Superoxide anion generation by the cytochrome bc₁ complex was determined by measuring the chemiluminescence of the MCLA-O₂^˙̄ adduct (29) in an Applied Photophysics SX.18MV stopped-flow spectrometer by leaving the excitation light off and registering the light emission (30). Reactions were carried out at 23 °C by mixing solutions A and B at 1:1. Solution A contained 100 mm Na⁺/K⁺ phosphate buffer (pH 7.4), 1 mm EDTA, 1 mm KCN, 1 mm NaN₃, 0.1% bovine serum albumin, 0.01% n-dodecyl-β-d-maltopyranoside, and 5.0 μm wild-type or mutant bc₁ complex. Solution B was the same as solution A except that the bc₁ complex was replaced with 150 μm Q₀C₁₀BrH₂ and 4 μm MCLA.

RESULTS AND DISCUSSION

Photosynthetic Growth Behaviors of the Wild-type and Mutant bc₁ Complexes

Because the cytochrome bc₁ complex is absolutely necessary for photosynthetic growth of R. sphaeroides, a mutant with a substitution at a critical position will not grow photosynthetically, whereas mutants with substitutions at noncritical positions will grow. Thus, observing the photosynthetic growth behavior, one can determine whether substitutions are at critical positions. In mid-log phase, semi-aerobically dark-grown wild-type and mutant cells were inoculated into enriched Siström's medium and subjected to anaerobic photosynthetic growth conditions. Table 2 shows that mutants could grow, indicating that substitutions of Arg-94 are noncritical to the complex. These mutants grew at a decreased rate compared with the wild-type bc₁ complex, suggesting that substitutions of Arg-94 affect the function of the cytochrome bc₁ complex and thus retard the growth of R. sphaeroides.

TABLE 2.

Characterization of mutants

The cytochrome bc₁ complexes were in 50 mm Tris-Cl (pH 8.0) containing 200 mm NaCl, 200 mm histidine, 0.5% octyl glucoside, and 10% glycerol.

Strain	Photosynthetic growth	Activitya
WT	++++	4.58 (100%)
R94A	+	0.18 (4%)
R94D	++	1.61 (35%)
R94N	+++	2.34 (51%)

^a The enzyme-specific electron transfer activity of the purified bc₁ complexes is expressed as micromoles of cytochrome c reduced per min/nmol of cytochrome b at room temperature.

Proton Translocation Activity of the Wild-type and Mutant bc₁ Complexes

The bc₁ complex catalyzes electron transfer from ubiquinol to cytochrome c and concomitantly translocates protons of ubiquinol across the membrane. The two protons of ubiquinol are released via two pathways. The ejection of the first proton is controlled by the protonation and deprotonation of the histidine ligands of the [2Fe-2S] cluster. The histidine ligands take up a proton from the substrate, ubiquinol, upon reduction of the [2Fe-2S] cluster and release it to the intermembrane space when oxidized by cytochrome c₁, as was suggested recently (31). Glu-295 in cytochrome b is important for the release of the second proton, as proposed previously (31–33). Glu-295 is completely conserved in mitochondrial cytochrome b (34), and the importance of the residue in proton transfer is indicated by mutagenesis studies because alteration of glutamine abolishes ubiquinol oxidation in R. sphaeroides (35). Additionally, recent kinetic studies showed that protonation of a group with a pK_a of 5.7 blocked catalysis, and this effect was attributed to Glu-295 (36). The second proton of ubiquinol is first transferred to Glu-295 to form the neutral acid and is then released and delivered to heme propionate A by rotation of the side chain of Glu-295. The subsequent proton release is mediated by a hydrogen-bonded water chain stabilized by cytochrome b residues (Fig. 1) (20, 31).

FIGURE 1.

Proton exit pathway formed by a chain of hydrogen-bonded water molecules at the Q_P site with the stigmatellin bound. Blue dots on Arg-94 indicate the NH₁ and NH₂ groups. Red dots on heme b_L indicate O1A and O2A. Other red dots indicate water (W) molecules. The arrow shows the proton exit pathway from Glu-295 to bulk solvent.

The proton pumping property has been well demonstrated in PL vesicles embedded with the purified mitochondrial bc₁ complex (37–40). Fig. 2 shows a typical proton translocation activity assay for PL vesicles embedded with the R. sphaeroides bc₁ complex. After pH equilibrium was reached for the mixture containing Q₀C₁₀BrH₂, valinomycin, ferricytochrome c, and bc₁ complex-PL vesicles, an aliquot of ferricyanide solution (arrow 1) was added to initiate electron flow from Q₀C₁₀BrH₂ to cytochrome c. After pH equilibrium was attained, the protonophore CCCP was added (arrow 2) to render the liposome membrane freely permeable to protons, and then a second aliquot of ferricyanide was added (arrow 3). The ratio of the pH changes produced by the addition of equal amounts of ferricyanide before (x) and after (y) the addition of CCCP was taken as a measure of the H⁺/e⁻ ratio for the proton translocation activity of the bc₁ complex. The protons released after CCCP addition were the “scalar” protons only, as no contribution from the accumulation of “vectorially” translocated protons was possible.

FIGURE 2.

Proton pumping of R. sphaeroides cytochrome bc₁ complexes embedded in PL vesicles. Arrows indicate the points of addition of 5 nmol of ferricyanide (arrow 1), 2 μm CCCP (arrow 2), and 5 nmol of ferricyanide (arrow 3). Note that the proton pumping ratio (H⁺/e⁻) = x/y.

Table 3 shows the proton translocation activity (H⁺/e⁻) of the wild-type and mutant bc₁ complexes. The proton translocation activity of R94N showed a small decrease compared with the wild-type bc₁ complex, whereas that of R94A and R94D exhibited a significant decrease. H⁺/e⁻ reflects only the final ratio of proton translocation to electron transfer. To further study the proton translocation rate, a kind of dye, pyranine, was used in a stopped-flow experiment. Fig. 3 shows that the magnitude of proton translocation rate of the wild-type and mutant bc₁ complexes can be ranked as WT > R94N > R94D > R94A. These results indicate that a positive correlation exists between the changes in proton translocation activity (H⁺/e⁻) and the proton translocation rate.

TABLE 3.

Proton pumping ratios (H⁺/e⁻) for PL vesicles harboring wild-type and mutant bc₁ complexes

For the definition of H⁺/e⁻ and experimental conditions, see “Experimental Procedures” and the legend to Fig. 2.

Vesicle type	H+/e−
WT	1.5
R94A	1.2
R94D	1.23
R94N	1.48

FIGURE 3.

Determination of proton translocation rate of PL vesicles embedded with wild-type or mutant bc₁ complexes using a stopped-flow spectrophotometer. Reaction conditions were as described under “Experimental Procedures.” pH changes were monitored by following the absorption change of pyranine at 457 nm.

Proton transfer pathways involving internal water molecules that provide hydrogen bonds and facilitate proton diffusion have been identified in other membrane proteins such as bacteriorhodopsin (41) and cytochrome c oxidase (42). Although the mechanisms for proton translocations are different for different proteins, the underlying principle for bringing protons to the active sites is similar. For Arg-94, the nitrogen atom of the guanidyl easily forms a hydrogen bond with H₂O, and the repulsion function of the positive charge to H⁺ is also favorable for H⁺ movement. For Ala, the carbon atom of the methyl does not easily form a hydrogen bond with H₂O, and there is no positive charge on its side chain. In addition, as a hydrophobic amino acid, the hydrophobic microenvironment is also unfavorable for H⁺ movement. Thus, the proton translocation activity of the R94A mutant is inhibited. The structure of Asn is similar to that of Arg except for a small difference in molecular weight, so the proton translocation activity of the R94N mutant is similar to that of the wild type. The low proton translocation activity of R94D may be due to the negative charge of the side chain of Asp exerting an attractive force to H⁺, which is unfavorable for H⁺ movement. The low proton translocation activity of the mutants indicates that some of the “second H⁺” of Q₀C₁₀BrH₂ cannot be pumped into the exterior of the vesicle and also suggests that Arg-94 in cytochrome b of the bc₁ complex is an important amino acid for proton pumping.

Effect of Mutations on Cytochrome b Reduction by Ubiquinol

Fig. 4 shows the time course traces of heme b reduction by Q₀C₁₀BrH₂ in the wild type and mutants in the absence (panel A) and presence (panel B) of antimycin A. Antimycin A is a Q_N site inhibitor that blocks electron transfer from heme b_H to ubiquinone and prevents reduction of heme b_H by Q₀C₁₀BrH₂ through the Q_N site.

FIGURE 4.

Time traces of cytochrome b reduction by Q₀C₁₀BrH₂ in the wild-type and mutant complexes in the absence (A) and presence (B) of antimycin A. Reactions and measurements were performed as described under “Experimental Procedures.” The reaction was monitored by photodiode array scanning for 0.4 s. Cytochrome b was determined from the increase in A_560–580. AA, antimycin A.

In the case of the native complex (Fig. 4A), the extent of heme b reduction of mutants decreased relative to the wild type. It should be noted that heme b reduction is mostly heme b_H (43). The heme b_H reduction by ubiquinol in the bc₁ complex, according to the Q-cycle mechanism, is affected by (i) the forward reduction through the Q_P site to heme b_L and then to b_H, (ii) the reoxidation of reduced heme b_H by ubiquinone, and (iii) the “back door” reduction through the Q_N site. Therefore, it is difficult to explain the differences in the extent of heme b reduction among the wild type and mutants.

In the presence of antimycin A (Fig. 4B), heme b reduction by Q₀C₁₀BrH₂ occurred only through the Q_P site via heme b_L, so this case is simplified. Relative to the wild type, the heme b reduction extent of R94N, R94D, and R94A decreased by 2.4, 77.71, and 84.93%, respectively. This decrease implies that some electrons may deviate from the low potential electron transfer chain and leak from the reduced heme b_L or ubisemiquinone at the Q_P site during bc₁ catalysis. The results also indicate that the extent of the electron leak is WT < R94N < R94D < R94A.

Whether in the absence or presence of antimycin A, the rate constants of heme b reduction of the mutants all decreased relative to the wild type, and the extent of the decrease can be described as R94N < R94D < R94A (Fig. 4). The decrease in the rate constants of heme b reduction suggests that the transfer rate of the second electron of Q₀C₁₀BrH₂ is decreased for mutants.

The addition of antimycin A (Fig. 4) increased the extent and decreased the rate of heme b reduction in the wild type and mutants, and these results are consistent with a previous report (44). However, the degree of this effect varied in these complexes. Relative to the native case (Fig. 4A), the rate of heme b reduction of the wild type, R94N, R94D, and R94A was decreased by 52, 43, 50, and 58%, respectively. Relative to the native case (Fig. 4A), the extent of heme b reduction of the wild type, R94N, R94D, and R94A was increased by 83, 255, 25, and 56%, respectively.

Effect of Mutations on Cytochrome c₁ Reduction by Ubiquinol

Fig. 5 shows the time course traces of heme c₁ reduction by Q₀C₁₀BrH₂ in the wild type and mutants in the absence (panel A) and presence (panel B) of antimycin A. In both the absence and presence of antimycin A, the rate constants of heme c₁ reduction of all mutants decreased relative to the wild type, and the extent of the decrease is R94N < R94D < R94A. The decrease in the rate constants of heme c₁ reduction suggests that the transfer rate of the first electron of Q₀C₁₀BrH₂ is decreased for mutants.

FIGURE 5.

Time traces of cytochrome c₁ reduction by Q₀C₁₀BrH₂ in the wild-type and mutant complexes in the absence (A) and presence (B) of antimycin A. Reactions and measurements were performed as described under “Experimental Procedures.” The reaction was monitored by photodiode array scanning for 0.4 s. Cytochrome c₁ was determined from the increase in A_551–539. AA, antimycin A.

Relative to the values for the native case, the addition of antimycin A decreased the rate of heme c₁ reduction by 18, 9, 9, and 73% in the wild type, R94N, R94D, and R94A, respectively (Fig. 5). These results are consistent with previous reports (18, 43) that antimycin A has a significant effect on the reduction rate of heme c₁ in cytochrome bc₁ complexes. This inhibitive effect has been attributed to the long-range effect of antimycin A on the Q_P site when binding to the Q_N site (18, 43). In other words, the effect of antimycin A on the heme c₁ reduction rate does not occur through the low potential redox component but through the cytochrome b protein subunit.

In the Q-cycle mechanism, the oxidation of ubiquinol and reduction of ubiquinone or ubisemiquinone occur mainly in the Q_P and Q_N sites of cytochrome b. In the mutant bc₁ complexes, the Q_P and Q_N sites are functional because all of the mutant complexes were sensitive to antimycin A (Figs. 4B and 5B) and stigmatellin (a Q_P site inhibitor) (data not shown). The changes in electron transfer activity or the changes in heme b and c₁ reduction should all be related to the mutation at Arg-94, but they are not related to the impairment of the Q_P or Q_N site. Substitution of Arg-94 decreased the proton translocation rate, slowed down the decomposition rate of Q₀C₁₀BrH₂ by feedback inhibition, and then slowed down the transfer of the two electrons of ubiquinol. A decrease in the first electron transfer induced the heme c₁ reduction rate decrease and the electron transfer activity decrease (Table 2). A decrease in the second electron transfer induced the heme b reduction rate decrease (Fig. 4).

The decreases in the proton translocation rate, the heme b and c₁ reduction rate, and the electron transfer activity all changed in the same order of R94N < R94D < R94A for the three mutants. This positive correlation also supports the relationship discussed above. In addition, the decreases in the heme b reduction rate and the electron transfer activity are also related to the production of superoxide anion, as discussed below.

Effect of Mutations on Superoxide Anion Production by the Cytochrome bc₁ Complex

The above results show that some electrons may leak from the low potential electron transfer chain during bc₁ catalysis for mutants. What is the fate of these leaked electrons? One of the possible pathways is a reaction with molecular oxygen to form superoxide anions. If this is the pathway, one should see more superoxide anion production by mutants than the wild-type complex because more electrons leak from the mutant complexes.

Fig. 6 shows the tracings of O₂^˙̄ generation by the wild type and mutants. MCLA-O₂^˙̄ chemiluminescence induced by the bc₁ complex reached peak intensity after ∼0.1 s at room temperature and then decayed. Relative to the wild type, O₂^˙̄ generation increased by 18, 36, and 61% for R94N, R94D, and R94A, respectively. No luminescence was detected when the bc₁ complex was omitted from the enzyme-containing solution. This result suggests that some electrons do leak from the low potential electron transfer chain to O₂ and then form O₂^˙̄ during bc₁ catalysis. The result also indicates that the extent of the electron leak is WT < R94N < R94D < R94A, which is the same as the result from the heme b reduction analysis above. There is an inverse relationship between O₂^˙̄ production and the heme b reduction rate (Figs. 4 and 6). The heme b reduction rate indicates the second electron transfer rate. It can therefore be deduced that another reason for the decreased second electron transfer rate in the hydrophobic Q_P pocket for mutants is the increased O₂^˙̄ production. More superoxide anions released means a lower electron transfer rate.

FIGURE 6.

Time traces of superoxide anion generation. The superoxide anion generation reactions were carried out at 23 °C in an Applied Photophysics SX.18MV stopped-flow reaction analyzer by mixing solutions A and B (1:1) containing enzyme complexes and substrate as described under “Experimental Procedures.” The orange trace is for control experiments, when no bc₁ complexes were present in the system.

In addition, the generation of more O₂^˙̄ implies that more electrons are consumed by O₂ in the bc₁ complex, which would result in decreased electron transfer activity. Thus, the decreased activity of mutants is ascribed to the increased O₂^˙̄ generation as well as to the decreased proton pumping (discussed above). Under anaerobic conditions, there is no O₂^˙̄ generation. Thus, one can deduce that the difference between activities in a mutant and the wild type under anaerobic conditions should be less than that under aerobic conditions. This is indeed the case. Fig. 7 shows that, compared with the wild type, the electron transfer activities of R94N, R94D, and R94A decreased by 49, 65, and 96%, respectively, under aerobic conditions, whereas they decreased by 41, 61, and 94%, respectively, under anaerobic conditions. The difference is significant (p < 0.05, Student's t test) between aerobic and anaerobic conditions for every mutant complex. These data also show that the effect of the superoxide anion generation on the decrease in the electron transfer activity of mutants is R94N > R94D > R94A, and the superoxide anion generation has a smaller effect on the decrease in the electron transfer activity of mutants compared with the proton pumping decrease.

FIGURE 7.

Electron transfer activity changes in the wild-type and mutant complexes under aerobic and anaerobic conditions. The activity of the wild type is regarded as 100%, and that of mutants is described as the percentage of the wild type. Data represent an average of three experiments. Error bars indicate S.D. The difference is significant (p < 0.05, Student's t test) between aerobic and anaerobic conditions for every mutant complex.

Transport Pathway of H⁺, O₂, and O₂^˙̄ in the bc₁ Complex

It is known that O₂^˙̄ is generated inside the bc₁ complex, perhaps in the hydrophobic environment of the Q_P pocket through bifurcated oxidation of ubiquinol by transfer of its two electrons to a high potential electron acceptor, an iron-sulfur cluster, and a low potential heme b_L or molecular oxygen. The protein subunits, at least those surrounding the Q_P pocket, play a role either in preventing the release of O₂^˙̄ from its production site to aqueous environments or in preventing O₂ from getting access to the hydrophobic Q_P pocket (45). The increase in superoxide anion production by mutants (Fig. 6) may result from the rapid transport of O₂ and O₂^˙̄ between the hydrophobic Q_P pocket and the aqueous phase because the O₂ concentrations in the aqueous phase of the wild type and mutants are the same.

Substitution of Arg-94 changes the proton pumping and O₂^˙̄ generation simultaneously. This suggests that the transport of H⁺, O₂, and O₂^˙̄ may occur by the same pathway as described in Figs. 1 and 8. Arg-94 of cytochrome b may function as a gate for the transport of H⁺, O₂, and O₂^˙̄. However, the factors that influence the transport of H⁺, O₂, and O₂^˙̄ may be different. H⁺ transport is related mainly to the hydrogen bond and charge as described above, whereas that of O₂ and O₂^˙̄ may be affected mainly by the side chain size of Arg-94 or its substitute. The long side chain, e.g. that of Arg-94 in the wild type, is unfavorable for the movement of O₂ and O₂^˙̄, and this results in low O₂^˙̄ production. However, a short side chain, e.g. that of Ala-94, is favorable for the movement of O₂ and results in high O₂^˙̄ production. In addition, as a hydrophobic amino acid of Ala, the hydrophobic environment is also favorable to the solubility of O₂ and generation of O₂^˙̄ (45). More O₂^˙̄ production by R94D than R94N may be related to the negative charge, which has a repellent force to O₂^˙̄, providing a favorable condition for O₂^˙̄ movement. In this study, only one residue was mutated and studied, so this suggestion remains to be further investigated.

FIGURE 8.

Schematic depiction of the transfer of the two electrons and two protons of ubiquinol at the Q_P pocket when it is oxidized in the bc₁ complex. The first electron and proton are in green, and the second electron and proton are in red. The blue arrow indicates protons that return to the matrix for mutants; the purple arrow indicates oxygen molecules that are transferred to the Q_P quinol oxidation pocket from the cytosol solvent. Q_N is the quinone reduction pocket. QH₂, ubiquinol; TM, transmembrane region; ISP, Rieske iron-sulfur protein.