Skip to main content
PLOS One logoLink to PLOS One
. 2013 Jan 14;8(1):e52757. doi: 10.1371/journal.pone.0052757

Identification of Upregulated Genes under Cold Stress in Cold-Tolerant Chickpea Using the cDNA-AFLP Approach

Ali Dinari 1, Ali Niazi 1,*, Ali Reza Afsharifar 2, Amin Ramezani 3
Editor: Venugopalan Cheriyath4
PMCID: PMC3544839  PMID: 23341906

Abstract

Low temperature injury is one of the most significant causes of crop damage worldwide. Cold acclimatization processes improve the freezing tolerance of plants. To identify genes of potential importance for acclimatzation to the cold and to elucidate the pathways that regulate this process, global transcriptome expression of the chickpea (Cicer arietinum L), a species of legume, was analyzed using the cDNA-AFLP technique. In total, we generated 4800 transcript-derived fragments (TDFs) using cDNA-AFLP in conjunction with 256 primer combinations. We only considered those cDNA fragments that seemed to be up-regulated during cold acclimatization. Of these, 102 TDFs with differential expression patterns were excised from gels and re-amplified by PCR. Fifty-four fragments were then cloned and sequenced. BLAST search of the GenBank non-redundant (nr) sequence database demonstrated that 77 percent of the TDFs belonged to known sequences with putative functions related to metabolism (31), transport (10), signal transduction pathways (15) and transcription factors (21). The last group of expressed transcripts showed homology to genes of unknown function (22). To further analyze and validate our cDNA-AFLP experiments, the expression of 9 TDFs during cold acclimatzatiion was confirmed using real time RT-PCR. The results of this research show that cDNA-AFLP is a powerful technique for investigating the expression pattern of chickpea genes under low-temperature stress. Moreover, our findings will help both to elucidate the molecular basis of low-temperature effects on the chickpea genome and to identify those genes that could increase the cold tolerance of the chickpea plant.

Introduction

In worldwide agriculture, abiotic stress, such as extreme temperature, drought and salinity, is the primary cause of crop damage and reduces average yields for most crop plants by more than 50% [1]. While it is estimated that biotic stress causes a 10 to 20% decrease in crop yields, abiotic stress, by comparison, results in a 50% decrease [2]. In general, morphological, physiological, biochemical and molecular changes, which are the result of both biotic and abiotic stress factors, influence crop growth and development [3]. One of the major factors of abiotic stress is low temperature, which limits the growth productivity and spatial distribution of crop plants worldwide [4]. Cold stress that occurs during late freezes in spring and sudden freezes in autumn preventing plants from realizing their full genetic potential [1], [4], [5].

Cold acclimatization is a process that increases the freezing tolerance in most temperate plants [5]. Exposure to low temperatures during the cold acclimatization process leads to the remodeling of plant cell structures and the reprogramming of gene expression and metabolism [6]. There is evidence indicating that the cell membrane is the primary site that is damaged by freezing due to the formation of ice in the apoplectic space causing a mechanical strain on the cell wall and plasma membrane, thereby leading to cell rupture [7]. On the other hand, the reactive oxygen species (ROS) produced as a result of low temperature stress can attack all basic molecules, such as carbohydrates, lipids, protein and nucleic acids, and therefore result in membrane oxidation [8]. Cold acclimatization can lead to changes in lipid composition, protein, and nucleic acid conformation, as well as the accumulation of carbohydrates. These modifications assist plants in withstanding and repressing the intensive dehydration produced by freezing stress [5], [8]. The key roles of cold acclimatization are to protect and stabilize the integrity of cell membrane rigidification and to prevent disruption by freezing. This ability is vital for plants because cellular membranes have a fundamental role in metabolism.

While one might previously have questioned how plants sense low temperatures, it is now known that plant responses to any environmental signal are mediated by a series of ratios. This mechanism is referred to as signal transduction [4]. Multiple signaling pathways play a role in the response to cold stress, and these signaling pathways may have a significant overlap with each other and with those patterns of gene expression involved in responses to additional stress factors [8]. The perception of cold stress leads to changes in membrane fluidity and increased rigidity, as those membranes have a higher proportion of unsaturated fatty acids [5]. Sensors can perceive the initial stress signal and can then initiate a signaling cascade to translocate the signals through intracellular space; these sensors can also activate nuclear transcription factors to induce the expression of low-temperature-related genes [1].The transcriptome profile is the main level of plant response to environmental stress factors, as temperatures of cold acclimatization cause profound changes in the transcriptome [5]. The basic mechanism of plant responses to abiotic and biotic stresses is the transcriptional control of the expression of stress-related genes.

The chickpea (Cicer arietinum L) is an annual plant that is diploid (2n = 2x = 16) and self-pollinating, and it is cultivated around the world. Because of its high nutrient and protein content, it is the third most important legume worldwide. Despite a wide variety of germplasm sources, cultivated chickpea has very little genetic variation [9]. Most knowledge about plant responses to stress concerns model crops such as Arabidopsis thaliana, oryza sativa, medicago truncatula, and lotus japonicas; however, information related to the chickpea genome and its response to stress is limited.

In species for which genome information is limited, two methods of investigation include AFLP and cDNA-AFLP; these methods are the best choices for global genome- and transcriptome-level analysis. Using these methods, researchers are able to discover genes on the basis of their polymorphism or differential expression patterns [10]. cDNA-amplified length polymorphism (cDNA-AFLP) is a sensitive, reproducible and efficient technology for the discovery and identification of genes. The main advantages of the cDNA-AFLP method, as opposed to other techniques such as microarrays and gene chips, are that, first, cDNA-AFLP does not require any prior knowledge of gene sequences, and second, its high specificity allows the detection of rarely expressed genes and differentiates among homologous genes, including members of the same gene families. These features make cDNA-AFLP an ideal system for genome-wide expression analysis [11]. The results of various studies have indicated that this technique is able to provide a global vision of gene expression fluctuation induced by a specific stress; the technique is also a useful tool for gene isolation [12].

In this study, the cDNA-AFLP technique was employed to isolate transcripts during low-temperature stress in the chickpea. Furthermore, we demonstrate that the expression of several differentially expressed genes increased during cold acclimatization using real-time RT-PCR. These genes and their possible functions during cold acclimatization are discussed below.

Methods

Plant material, growth conditions and cold stress treatment

Chickpea seeds of the Azad variety (a cold-resistant chickpea genotype) were used in this study. The chickpea plants were cultivated and maintained in a greenhouse at an institute of biotechnology (Shiraz University, Iran). Evaluation of germination and growth conditions were conducted, and seven-day-old seedlings were subsequently divided into groups. One group remained in greenhouse conditions as a control, while the other group was transferred to a cold room at 4°C for three days. On the third day of cold-treatment, tissues (leaves and stems) were sampled both from the control- and cold-treated-seedlings, ground with a mortar and pestle and preserved at −80°C.

RNA extraction and cDNA synthsis

Total RNA was isolated from the frozen tissues of both the cold-treated and control plants utilizing modified RNA extraction buffer containing 100 mM Tris-HCl, pH = 8; 100 mM liCl; 10 mM EDTA, pH = 8; and 1% SDS, according to the hot phenol method described by Verwoevd et al [13]. The RNA quality and integrity was determined by analyzing 4 µl of total RNA by agarose gel electrophoresis; the RNA quantity was also checked using the NanoDrop 1000 spectrophotometer (Wilmington U.S.A). To eliminate any contaminating genomic DNA, samples of RNA were treated, prior to cDNA synthesis, with RNase-free DNase Kit (Fermentas, Hanover, MD). First-strand cDNA was synthesized from 5 µg of total RNA treated with DNase I using 200 U reverse transcriptase (Fermentas). Second-strand cDNA was synthesized using 10 U of DNA polymerase I and RNaseH (Takara Japan) according to the manufacturers' instructions.

AFLP reactions

Preparation of the cDNA template was performed as described by Bachem et al. [14]. Double-stranded cDNA was first digested with 10 U of EcoR1 for 3 h at 65°C followed by digestion with 10 U of MseI for 3 h at 37°C. The digestion products were ligated to EcoRI and MseI double-stranded adaptors at 20°C overnight. The adaptors were 5′-CTCGTAGACTGCGTACC-3′ and 3′-CATCTGACGCATGGTTAA-5′ for EcoR1 and 5′-GACGATGAGTCCTGAG-3′ and 3′-TACTCAGGACTCAT-5′ for MseI. Ligated cDNA fragments were subsequently amplified by PCR using non-selective EcoR1 and MseI primers. The PCR program was as follows: 5 min at 94°C for the initial denaturation and then 30 s at 94°C (denaturation), 45 s at 50°C (annealing), 60 s at 72°C for an extension (30 cycles), followed by 5 min at 72°C. The amplified products were then analyzed on an ethidium bromide-stained 1% agarose gel. The amplification products were diluted 200-fold with sterile water and then used for selective PCR amplification with primers having two selective nucleotides at the 3′ end. The primer combinations were used for selective PCR amplification. Touch-down PCR conditions for selective amplification were as follows: 5 min 94°C for the initial denaturation, followed by 30 s at 94°C, 35 s annealing at 62°C and 1 min at 72°C for an extension. (from 11 cycles, the annealing temperature was reduced in each cycle by 1°C from 62°C to 52°C, and the annealing temperature was then maintained at 52°C for 25 cycles.) The selectively amplified PCR products were then separated on a denaturing 6% polyacrylamide gel (cleaver scientific, England) running at 250 volts for 4 h. The polyacrylamide gels were then silver stained according to Bassam et al. [15], and the cDNA-AFLP fragments were visualized.

Isolation, cloning and sequence analysis of up-regulated TDFs

On the basis of their presence, absence or up regulated intensity, the bands of interest were selected and cut from the gels with a surgical blade, then dissolved in 50 µl of sterile water with vigorous vortexing for 1 min, and incubated at room temperature for 30 min. One microliter of each dissolved band was re-amplified using the touch-down PCR method and the specific selective nucleotide primers. The re-amplified fragments were then extracted from 1% agarose gels and subsequently cloned into the pTZ vector using the TA Cloning Kit (fermentas) and sequenced (dragon tech). Using the assembly algorithms of Vector NTI Advance 10 software, we produced EST contigs and compared them against the EST sequences in the TIGR (The Institute for Genomic Research) database. As well as the sequencing results were compared against all nucleotide and protein sequences in the GenBank nonredundant database using the BLASTn and BLASTx programs. Finally 48 transcript derived fragments (TDFs) were submitted to GenBank database after six month.

Real-time PCR

Real-time PCR was performed on RNA obtained from three independent experiments. All samples included equal quantities of RNA. Total RNA was extracted using RNX-Plus buffer (CINNAGEN, Iran). The purified total RNA was quantified with NanoDrop ND 1000 Spectrophotometer (USA). DNase treatment was carried out using the Fermentas DNase Kit (Fermentas, Hanover, MD) according to the manufacturer's instructions. Three micrograms of DNase-treated RNA was used for first strand cDNA synthesis, using 200 U M-Mulv reverse transcriptase (Fermentas) in a 20 µl final volume. Primer design was carried out using Allele ID 7 software for the reference gene and all other genes of interest. The chickpea Elongation factor α (Ef α) gene (AJ004960.1) was used as the reference gene for data normalization (Table 1).

Table 1. Sequences of primers used for Real-Time PCR amplification and the resulting product size.

ta amplicon length (bp) sequence primer
52/6 137 bp ccacggagacccaaactg copper-f
52/6 137 bp tgctggaatcaaacggtatc copper-r
55/6 149 bp cttcgccttccaacccttcttg f nuc act
55/6 149 bp tgctactccattgtttctgaaccc f nuc act
51/1 154 bp catagactgtgatgtagc f phophs
51/1 154 bp ttcttcttcctcttcctc r phophs
53/3 105 bp aaccacacaaacaacaacaac f t6-451
53/3 105 bp ctcctcttccttgccttcc r t6-451
55/8 177 bp cgtatccgtagcccttgc f t4-116
55/8 177 bp ccgccgatgagtcttatcc r t4-116
52/7 177 bp gatggttctggctcgtttgg f hetro
52/7 177 bp ggtttcccttgatctactgc r hetro
53/4 171 bp aggtgaagcgtgtctactatcc f cystha
53/4 171 bp caaatgaggcagcaatgtatggg r cystha
53/3 91 bp tggggttgattgtgctctg f alpha 1-4
53/3 91 bp attcctctgtgctggcttg r alpha 1-4
50 102 bp ggataggatataatcaggcagtag f t11-143
50 102 bp tcaaacagtaaagtggacagc r t11-143

Relative Real-time PCR was performed in a total volume of 20 µl containing 1 µl of cDNA, 1× Syber Green buffer and 4 pmol of each primer. The amplification reactions were carried out in a Line Gene K thermal cycler (Bioer, China) under the following conditions: 2 min at 94°C, 40 cycles of 94°C for 10 sec, Ta°C (annealing temperature) for 15 sec and 72°C for 30 sec. After 40 cycles, the amplification products were heated to 95°C to determine their melting curves and confirm their specificity. All amplification reactions were repeated three times under identical conditions and included a negative control and five standard samples. To ensure that the PCR products were generated from cDNA and not genomic DNA, proper control reactions were carried out without the presence of reverse transcriptase. For the Quantitative Real Time PCR data, the relative expression for the genes of interest was calculated using the threshold cycle (CT) method. The CT for each sample was calculated using the Line-Gene K software and the method of Larionov et al. [16]. Accordingly, the amount of expression of target mRNAs over reference values was calculated by the equation 2−ΔΔCT [17], where ΔCT is determined by subtracting the corresponding Ef α CT value (reference gene) from the specific CT of the target (gene of interest) and ΔΔCT is obtained by subtracting the ΔCT of each experimental sample from that of the calibrator sample.

Results

Detection and isolation of cold stress–induced TDFs

In total, 4800 TDFs were generated by 256 primer combinations and visualized on 6% denaturing polyacrylamide gel (Figure 1). The lengths of the TDFs were 50–500 bp in size. The average number of TDFs per lane in the treatment and control samples was the same and was typically 20 TDFs/lane; however, the intensities differed, which implied variation of expression. In total, 102 TDFs with differentially expressed patterns were excised from the gels (as described in methods section) and re-amplified by PCR. Of these, 63 were cloned using the pTZ vector system, and 54 of them were sequenced.

Figure 1. An example of TDFs in a polyacrylamide gel with 13 primer combinations included: EcoR1+AT, CC and Mse1+TG, CT, GC, GA, AG, GT, AT, TT, CG, GG.

Figure 1

Gene sequence analysis

Six TDFs were discarded because of vector or adaptor contamination, and the remaining 48 TDFs were compared against the GenBank non-redundant (nr) sequences using the basic local alignment search tool (BLAST). Homology search analysis using the BLASTn and BLASTx programs revealed 22% of TDFs with high homology to ESTs or unknown proteins; 77% of these belonged to known sequences with putative functionality during biotic and abiotic stresses in different plant species. Among those cloned TDFs that had homology with genes of known functions, 31% were involved in metabolism, while 10%, 15% and 21% were involved in transport, signal transduction pathway and transcription factors, respectively One sequence showed no significant homology to any known sequences in public databases. All of these TDF sequences were deposited in NCBI databases (Table 2).

Table 2. Transcript derived fragments(TDFs) from chickpea leaves and stems under cold acclimation.

Accession No Primer com length BLAST score annotation
Jk649793 GT-TC 375 bp blastx 2e-57 d-3-phosphoglycerate dehydrogenase
Jk649794 CG-CA 196 bp blastn 7e-54 protein binding protein (zinc finger family)
Jk649795 AA-GT 233 bp blastx 2e-23 protein with unknown function
JK649796 AA-GT 184 bp blastn 3e-72 cystathionine gamma-synthase
Jk649797 AC-CC 328 bp Blastn 1e-117 zinc finger protein ZF3 gene (Cicer arietinum)
JK649798 AC-AG 456 bp Blastx 5.7 domain binding protein (Laccaria bicolor)
JK649799 AC-TG 304 bp Blastx 3e-13 heterogeneous nuclear ribonucleoprotein
JK649800 AC-GT 251 bp Blastx 2e-26 dessication-related protein, putative
JK649801 AG-GG 272 bp Blastx 3e-35 ptpla domain protein, putative
JK649802 AG-GG 248 bp Blastx 3e-05 ubiquitin-associated/TS-N domain-containing protein putative
JK649803 AG-TC 223 bp Blastx 2e-08 mitogen-activated protein kinase 11, putative
JK649804 AC-CT 116 bp Blastx 0.006 ethylene-responsive element binding factor 4
JK649805 AG-TG 119 bp Blast est• 3e-54 similar to stress related ESTs
JK649806 AT-TC 185 bp Blastn 4e-36 pyruvate decarboxylase, putative
JK649807 CC-GG 193 bp Blastn 1e-91 copper amine oxidase
JK649808 CC-CA 153 bp blastx 5e-15 DNA binding protein
JK649809 CT-CA 260 bp Blastx 7e-11 inositol or phosphatidylinositol kinase, putative
JK649810 CT-TA 155 bp Blastx 3e-21 Alpha-1,4-glucan-protein synthase (UDP-forming) cell wall metabolism
JK649811 GA-TC 164 bp Blastn, blastx 3e-05 unknown function
JK649812 GA-TC 147 bp Blastn 5e-14 eukaryotic translation initiation factor SUI1, putative
JK649813 GC-TC 121 bp Blastn 2e-26 C2 domain-containing protein
JK649814 GT-GG 294 bp Blastn 9e-149 14-3-3-like protein
JK649815 GT-TC 246 bp Blastx 4e-27 predicted protein
JK649816 GT-TC 256 bp blastx 9e-22 clathrin assembly protein putative, transport system
JK649817 TA-TC 279 bp Blastx 5.6 hypothetical protein
JK649818 TC-TC 68 bp Blast 0.008 Ribulose-1,5 bisphosphate carboxylase/oxygenase large subunit N-methyltransferase, chloroplastic
JK649819 TC-TC 210 bp Blastn 4e-51 heat shock protein 90
JK649820 TC-TC 151 bp Blast 1e-09 C3HL domain class transcription factor
JK649821 TC-TC 256 bp Blastn 7e-95 14-3-3 protein
JK649822 TT-CA 451 bp blastx 5e-19 Hypothetical protein
JK649823 CG-CC - Novel
JK649824 AC-CC 201 bp Blastx 2e-29 Transport protein particle (TRAPP) component
JK649825 AC-AC 173 bp Blastx 1e-14 Sodium/calcium exchanger family protein
JK649826 AC-AC 179 bp Blast 1e-11 MATE efflux protein-related
JK649827 AT-GC 172 bp Blastx 5e-15 Short-chain dehydrogenase/reductase SDR
JK649828 AT-TA 226 bp Blastx 2e-07 XH/XS domain-containing protein/XS zinc finger domain-containing protein putative
JK649829 AT-TA 361 bp Blastx 2e-46 bet1-like snare 1-1(lusin zipper)
JK649830 TG-AG 236 bp Blastx 6e-10 Chloroplast isoflavone synthase
JK649831 TG-AC 303 bp Blastx 3e-13 Putative heterogeneous nuclear ribonucleoprotein
JK649832 AC-GC 194 bp blastx 7e-11 putative glycoside hydrolase family
JK649833 CT-CT 288 bp Blastx 3e-38 Putative protein COBRA precursor
JK649834 TC-GC 256 bp blastx 3e-26 clathrin assembly protein, putative
JK649835 CT-TG 440 bp Blastx 3e-61 Putative AMP dependent ligase
JK649836 GC-AC 186 bp blastx 2e-06 conserved hypothetical protein
JK649837 GA-TA 298 bp blastx 9e-35 hydrolase acting on ester bonds
JK649838 CA-CT 258 bp blastx 7e-11 inositol or phosphatidylinositol kinase
JK649839 TT-CG 142 bp blastx 2e-13 UDP-D-apiose/UPD-D-xylose synthetase
JK649840 AT-GG 143 bp Blast est• 1e-64 mRNA sequence

Confirmation of selected gene expression patterns by real-time RT-PCR

The expression patterns of nine TDFs were analyzed using real-time RT-PCR (Figure 2). The aim was to investigate the reliability of the cDNA-AFLP technique in both detecting differentially expressed genes and validating the levels of gene expression. The TDFs of interest were selected on the basis of their intensity and differential pattern of expression in the cDNA-AFLP experiment. . According to the results we observed that the highest expression is related to cystationine gamma synthase and the TDFs named unknown 143 bp in the treated plants. By the contrary the lower expression is related to unknown 451 bp gene and seems that has similar pattern in the treated and control plant.

Figure 2. Real-time RT-PCR analysis.

Figure 2

Real-time RT-PCR analysis of transcript levels for 9 selected genes in the control- and cold-treated-chickpea leaves. Relative expression for genes of interest were calculated based on the threshold cycle (CT) method. The relative expression level for treated plants at each time point was calculated as fold of the control plants at that time point using the comparative ΔΔCT method. All data were normalized to the Ef α expression level. The mean expression value was calculated for each genes with three replications.

Discussion

The study of plant genomes and the regulation of gene expression under biotic and abiotic stresses demonstrate that any phenomenon of plant life is the result of an interaction between the plant and its environmental conditions. Transcriptome analysis provides a beneficial and strong approach for the investigation of plant-stress interactions [18]. All TDFs discovered in the present study belonged to different categories of genes, including photosynthesis, metabolism, signal transduction, transport systems and other mechanisms related to cold acclimatization. Data obtained from real-time RT-PCR conformed to that of the cDNA-AFLP experiments and confirmed the reliability of our results. Several categories of genes are involved with chickpea compatibility under cold stress conditions. The early transient response to cold stress encompasses genes encoding transcription factors, cell signaling components and those involved in detoxification processes [19]. Whereas the genes active during the late response played a role in metabolism, cell structure and transport systems [2].

Bioinformatics analysis show that 77 percent of TDFs belonged to known genes including genes with putative function related to metabolism (31 percent), transport (10 percent), signal transduction pathways (15 percent) and transcription factors (21 percent). The last group of TDFs show homology to unknown genes. A majorty of TDFs exhibit similarity to genes that response to different environmental stresses. These observation indicate that cross-talk among signal transduction pathways is responsible for different stress conditions [38]. it should be noted that classification of TDFs in above mentioned groups performed using the information of bioinformatics analysis. These finding is according to those of other researches and signified the correctness of our cDNA-AFLP experiments.

Signal transduction

Approximately 14% of the up-regulated genes in our investigation were involved in signal transduction and plant cell pathways. We noted a 3.5-fold increase in the expression of genes encoding phosphatidylinositol 4–kinase (Jk649809 and Jk649838). Phosphatidylinositol 4–kinase (PI4K) is a key enzyme in phosphatidylinositol metabolism and leads to the release of Ca2+ into the cell cytoplasm [1], [20]. The mitogen-activated protein kinase (Jk649803) was up-regulated during cold acclimatization. Genetic studies have demonstrated that the activity and expression of kinases in the MAPK pathway under external stimuli effects such as cold and other stresses are regulated [21]. The formation of ROS is called oxidative stress and acts as a result of environmental stresses [22]. This phenomenon leads to extensive cellular damage and induces genes involved in the detoxification process, such as the copper amine oxidase enzyme gene (JK649807). Our results show that under cold stress, the expression of the copper amine oxidase gene was increased 3-fold and that it may act as a scavenger on these toxic compounds.

Transcription factors

Numerous studies indicate that transcription factors play pivotal roles in the regulation of temporal and spatial expressions of plant genes responsive to stresses [23]. For example, the Jk649804, Jk649829 and Jk649794 belong to the AP2/EREBP family (ethylene- responsive–element-binding factor or ERF), the bZIP family and the zinc finger family, respectively, and are up-regulated under cold stress conditions. The products of these genes can activate downstream genes through binding to the cis elements (or cis-acting elements) within the promoters of these downstream genes at a later point in time [24]. the gene-encoding heterogeneous nuclear ribonucleoprotein (hnRNP) (Jk649799) was up-regulated during cold stress. Most hnRNP show movement between the nuclear-cytoplasmic space and play a critical role in mRNA export [25], [26]. On the whole, this observation suggests that transcription factors play important roles in the coordinated regulation of cold stress-specific genes.

Cellular metabolism and organization

Metabolism is not a passive target of cold stress; rather, it can be directly regulated by cold responsive gene expression and cellular organization [27]. The primary role of cold acclimatization is the activation of mechanisms that stabilize membranes and protect cells against the damage occasioned by freezing. Alteration in the lipid composition of plant cell membranes is one among the multiple defense strategies [28]. It is therefore not surprising that the genes involved in fatty acid metabolism were up-regulated by cold stress, including an acyl-lipid desaturases/oleate (Jk649836) and an acetyl-COA synthetase. Genes responsible for numerous cellular activities, including protein modification, degradation enzymes, protein–protein interactions, kinases, and phosphatases, were all up-regulated in our experiments. The genes encoding 14-3-3 protein 9 (JK649814, JK649821) and a heat shock protein (Hsp90) (JK649819) were clear examples in this context. The 14-3-3 protein plays a key role in the activity of various enzymes involved in ion transport and vesicle trafficking and does so via direct protein–protein interactions [29]. Studies suggest that the accumulation of mis-folded and damaged protein due to accumulation of intracellular ROS leads to the activation of Hsp90, which subsequently acts as a molecular chaperone, thereby reducing the harmful effects of ROS in plant cell metabolism [30]. In addition to protein biosynthesis, we observed increases in the expression levels of some genes, such as cystathionine gamma-synthase (JK649796), involved in amino acid biosynthesis. Researchers have demonstrated that this is the primary enzyme active in methionine (met) biosynthesis [31]. An increase in amino-acid content in response to biotic and abiotic stresses as part of plant defense has been reported in several previous studies [32], [33]. Nine of the up-regulated genes encoding proteins function as membrane transporters, such as Na+/Ca2+ exchanger (JK649825) and clathrin assembly protein (JK649834). The Na+/Ca2+ exchanger is reported to be a member of a large superfamily of membrane proteins that play an important role in Ca2+ signaling pathways and that function to transport cytosolic Ca2+ across membranes [34]. Clathrin-mediated endocytosis has been reported to be the main mechanism for endocytosis in plant cells [35]. Researchers have demonstrated that the remodeling of the plant cell wall during stress conditions has an essential function in plant resistance. For instance, the gene encoding UDP-D-xylose synthase (JK649839) and the gene encoding COBRA protein (JK649833) proved necessary for cell-wall biogenesis and modification [36], [37].

Unknown genes

The last group (approximately 22%) of stress up-regulated genes observed in this study is annotated by an unknown sequence. The genes with unknown functions consist of those that have not yet been associated with a response to cold stress, and some of these novel genes did not match any sequence from the GenBank databases. In general, our results confirm previous research, which indicates that multiple defense strategies lead to an enhanced cold temperature defense capacity in plants.

Supporting Information

List S1

List of assigned Genbank Accession Numbers.

(DOCX)

Funding Statement

The authors have no support or funding to report.

References

  • 1. Rodríguez M, Canales E, Hidalgo OB (2005) Molecular aspects of abiotic stress in plants. Biotecnol Apl 22: 1–10. [Google Scholar]
  • 2. Kreps JA, Wu Y, Chng HS, Zhu T, Wang X, et al. (2002) Transcriptome Changes for Arabidopsis in Response to Salt, Ismotic, and Cold Stress. Plant Physiol 130: 2129–2141. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Wang WX, Vinocur B, Shoseyov O, Altman A (2001) Biotechnology of plant osmotic stress tolerance: physiological and molecular considerations. Acta Hort 560: 285–92. [Google Scholar]
  • 4. Heidarvand L, Maali Amiri R (2010) What happens in plant molecular responses to cold stress?. Acta Physiol Plant 32: 419–431. [Google Scholar]
  • 5. Chinnusamy V, Zhu J, Zhu JK (2007) Cold stress regulation of gene expression in plants. Trends Plant Sci 12: 444–451. [DOI] [PubMed] [Google Scholar]
  • 6. Viswanathan C, Zhu JK (2002) Molecular genetic analysis of cold-regulated gene transcription. Philos Trans R Soc Lond 357: 877–886. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.McKersie BD, Bowley SR (1997) Active Oxygen and Freezing Tolerance in Transgenic Plants, Plant Cold Hardiness, Molecular Biology, Biochemistry and Physiology, Plenum, New York pp. 203–214.
  • 8. Mahajan S, Tuteja N (2005) Cold, salinity and drought stresses: An overview. Arch Biochem Biophys 444: 139–158. [DOI] [PubMed] [Google Scholar]
  • 9. Mantri NL, Ford R, Coram TE, Pang ECK (2010) Evidence of unique and shared responses to major biotic and abiotic stresses in chickpea. Environ Exper Bot 69: 286–292. [Google Scholar]
  • 10. Botton A, Galla G, Conesa A, Christian Bachem (2008) Large-scale Gene Ontology analysis of plant transcriptome-derived sequences retrieved by AFLP technology. BMC Genomics 9: 347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Vuylsteke M, Peleman JD, Eijk M (2007) AFLP-based transcript profiling (cDNA-AFLP) for genome-wide expression analysis. NAT PROTOC 2: 1399–1413. [DOI] [PubMed] [Google Scholar]
  • 12. Bachem C, Horvath B, Trindade L, Claassens M, Davelaar E, et al. (2001) A potato tuber-expressed mRNA with homology to steroid dehydrogenases, gibberellin levels and plant development. Plant J 25: 595–604. [DOI] [PubMed] [Google Scholar]
  • 13. Verwoerd TC, Dekker BM, Hoekema A (1989) A small-scale procedure for the rapid isolation of plant RNAs. Nucl Acide Res 17: 2362. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Bachem C, Oomen R, Visser R (1998) Transcript imaging with cDNA-AFLP: a step by step protocol. Plant Mol Biol Rep 16: 157–173. [Google Scholar]
  • 15. Bassam BJ, Caetano-Anolles G, Gresshoff PM (1991) Fast and sensitive silver staining of DNA in polyacrylamide gels. Anal Boichem 196: 80–83. [DOI] [PubMed] [Google Scholar]
  • 16. Larionov A, Krause A, Miller W (2005) A standard curve based method for relative real time PCR data processing. BMC Bioinformatics 6: 62. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Zhu T, Provart NJ (2003) Transcriptional responses to low temperature and their regulation in Arabidopsis. Can J Bot 81: 1168–1174. [Google Scholar]
  • 18. Polesani M, Desario F, Ferrarini A, Zamboni A, Pezzotti M, et al. (2008) cDNA-AFLP analysis of plant and pathogen genes expressed in grapevine infected with Plasmopara viticola. BMC Genomics 9: 142. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Sun MM, Li LH, Xie H, Ma RC, He YK (2007) Differentially Expressed Genes under Cold Acclimation in Physcomitrella patens. J Biochem Mol Biol 40: 986–1001. [DOI] [PubMed] [Google Scholar]
  • 20. Divecha N, Irvine RF (1995) Phospholipid signalling. Cell 80: 269–278. [DOI] [PubMed] [Google Scholar]
  • 21. Chinnusamy V, Schumaker K, Zhu JK (2004) Molecular genetic perspectives on crosstalk and specificity in abiotic stress signaling in plants. J Exp Bot 55: 225–36. [DOI] [PubMed] [Google Scholar]
  • 22. Sunkar R, Bartels D, Kirch HH (2003) Over-expression of a stress-inducible dehydrogenase gene from Arabidopsis thaliana in transgenic plants improves stress tolerance. Plant J 35: 452–464. [DOI] [PubMed] [Google Scholar]
  • 23. Chen W, Provart NJ, Glazebrook J, Katagiri F, Chang HS, et al. (2002) Expression Profile Matrix of Arabidopsis Transcription Factor Genes Suggests Their Putative Functions in Response to Environmental Stresses. Plant Cell 14: 559–574. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Chinnusamy V, Zhu J, Zhu JK (2006) Gene regulation during cold acclimation in plants. Physiol Plant 126: 52–61. [Google Scholar]
  • 25. Li T, Evdokimov E, Shen RF, Chao CC, Tekle E, et al. (2004) Sumoylation of heterogeneous nuclear ribonucleoproteins, zinc finger proteins, and nuclear pore complex proteins: A proteomic analysis. PNAS 101: 8551–8556. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Dreyfuss G, Kim VN, Kataoka N (2002) Messenger-RNA-binding proteins and the messages they carry. Nat Rev Mol Cell Biol 3: 195–205. [DOI] [PubMed] [Google Scholar]
  • 27. Zhu J, Dong CH, Zhu JK (2007) Interplay between cold-responsive gene regulation, metabolism and RNA processing during plant cold acclimation. Curr Opin Plant Biol 10: 290–295. [DOI] [PubMed] [Google Scholar]
  • 28. Thomashow MF (1999) Plant cold acclimation : freezing tolerance genes and regulatory mechanisms. Annu Rev Plant Physiol Plant Mol Biol 50: 571–599. [DOI] [PubMed] [Google Scholar]
  • 29. Roberts MR (2003) 14-3-3 Proteins find new partners in plant cell signaling. Trends Plant Sci 8: 218–223. [DOI] [PubMed] [Google Scholar]
  • 30. Yokoi AN, Tainaka H, Yoshida E, Tamoi M, Yabuta Y, et al. (2010) The 26S Proteasome Function and Hsp90 Activity Involved in the Regulation of HsfA2 Expression in Response to Oxidative Stress. Plant Cell Physiol 51: 486–496. [DOI] [PubMed] [Google Scholar]
  • 31. Ravanel S, Gakieare B, Job D, Douce R (1998) cystathionine c-synthase from arabidopsis thaliana : purification and biochemical characterization of the recombinant enzyme overexpressed in Escherichia coli. Biochem J 331: 639–648. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Mayer RR, Cherry JH, Rhodes D (1990) Effects of heat shock on amino acid metabolism of cowpea cells. Plant Physiol 94: 796–810. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Rizhsky L, Liang H, Shuman J, Shulaev V, Davletova S, et al. (2004) When defense pathways collide. The response of Arabidopsis to a combination of drought and heat stress. Plant Physiol 134: 1683–1696. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Cai X, Lytton J (2004) The Cation/Ca2+ Exchanger Superfamily: Phylogenetic Analysis and Structural Implications. Mol Biol Evol 21: 1692–1703. [DOI] [PubMed] [Google Scholar]
  • 35. Dhonukshe P, Aniento F, Hwang I, Robinson DG, Mravec J, et al. (2007) Clathrin-mediated constitutive endocytosis of PIN auxin efflux carriers in Arabidopsis. Curr Biol 17: 520–527. [DOI] [PubMed] [Google Scholar]
  • 36. Roudier F, Schindelman G, DeSalle R, Benfey PN (2002) The COBRA Family of Putative GPI-Anchored Proteins in Arabidopsis. A New Fellowship in Expansion. Plant Physiol 538–548. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Ahn JW, Verma R, Kim M, Lee JY, Kim YK, et al. (2006) Depletion of UDP-D-apiose/UDP-D-xylose Synthases Results in Rhamnogalacturonan-II Deficiency, Cell Wall Thickening, and Cell Death in Higher Plants. J Biol Chem 281: 13708–13716. [DOI] [PubMed] [Google Scholar]
  • 38. Xiong LM, Schumaker KS, Zhu JK (2002) Cell signaling during cold, drought, and salt stress. Plant Cell 165–183. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

List S1

List of assigned Genbank Accession Numbers.

(DOCX)


Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES