Skip to main content
Molecular Endocrinology logoLink to Molecular Endocrinology
. 2012 Dec 4;27(1):106–115. doi: 10.1210/me.2012-1145

Regulation of the Human Hydroxysteroid Sulfotransferase (SULT2A1) by RORα and RORγ and Its Potential Relevance to Human Liver Diseases

Zhimin Ou 1,*, Xiongjie Shi 1,*, Richard K Gilroy 1, Levent Kirisci 1, Marjorie Romkes 1, Caitlin Lynch 1, Hongbing Wang 1, Meishu Xu 1, Mengxi Jiang 1, Songrong Ren 1, Roberto Gramignoli 1, Stephen C Strom 1, Min Huang 1,✉, Wen Xie 1,✉
PMCID: PMC3545217  PMID: 23211525

Abstract

The retinoid-related orphan receptors (RORs) were postulated to have functions in tissue development and circadian rhythm. In this study, we revealed a novel function of RORα (NR1F1) and RORγ (NR1F3) in regulating the human hydroxysteroid sulfotransferase (SULT2A1), a phase II conjugating enzyme known to sulfonate bile acids, hydroxysteroid dehydroepiandrosterone, and related androgens. A combination of promoter reporter gene assay and EMSA and chromatin immunoprecipitation (ChIP) assays showed that both RORα and RORγ transactivated the SULT2A1 gene promoter through their binding to a ROR response element found in the SULT2A1 gene promoter. Interestingly, this ROR response element overlaps with a previously reported constitutive androstane receptor response element on the same promoter. Down-regulation of RORα and/or RORγ by small interfering RNA inhibited the expression of endogenous SULT2A1. In primary human hepatocytes and human livers, we found a positive correlation between the expression of SULT2A1 and RORs, which further supported the regulation of SULT2A1 by RORs. We also found that the expression of RORα and RORγ was impaired in several liver disease conditions, such as steatosis/steatohepatitis, fibrosis, and hepatocellular carcinoma. The positive regulation of human SULT2A1 by RORs is opposite to the negative regulation of Sult2a1 by RORs in rodents. In summary, our results established SULT2A1 as a novel ROR target gene. The expression of RORs is a potential predictor for the expression of SULT2A1 as well as disease conditions.


The retinoid-related orphan receptors (RORs) subfamily, including RORα (NR1F1), RORβ (NR1F2), and RORγ (NR1F3) isoforms, were isolated based on their homologies to the retinoid receptors (1). Each of the three ROR isoforms shows unique tissue distribution patterns (2). RORα is widely distributed (3, 4). RORβ, on the other hand, shows more tissue-restricted expression in the brain, retina, and pineal gland (1, 5). RORγ is highly expressed in the thymus but is also detectable in the kidney, liver, and muscle (1, 6).

RORs regulate target gene expression, mainly through their binding as monomers to the ROR response elements (ROREs) found in the promoters of target genes. A typical RORE consists of a consensus AGGTCA half-site preceded by an A/T-rich region (7). RORα has also been shown to bind to a target promoter as homodimers (8). Early functional characterization of RORs has mostly relied on studies of ROR-deficient mice due to the lack of functional ligands. RORα−/− mice, which carried a natural deletion in the ligand-binding domain of the RORα gene resulting in a frame shift (3, 4), had cerebellar ataxia phenotype, which could be also observed in the Staggerer (sg/sg) mutant mice. Vascular dysfunction, muscular irregularities, osteoporosis, immune abnormalities, and sensitization to diet-induced atherosclerosis could be seen in sg/sg mice (9, 10). RORβ−/− mice showed distinguishing phenotypes in circadian behaviors and retinal degeneration (11). RORγ−/− mice showed defects in lymphoid organogenesis and thymopoiesis (12). In recent years, major progress has been made in the identification, development, and characterization of ROR ligands (13–15), which has facilitated the functional characterization of RORs. SR1001, a synthetic RORα and RORγ antagonist, was recently shown to suppress TH17 differentiation and autoimmunity (15).

Although both RORα and RORγ are expressed in the liver, their hepatic function was not appreciated until recently. Loss of RORα and/or RORγ in mice affected the expression of multiple hepatic phase I and phase II drug-metabolizing enzymes (16). RORα and RORγ have been shown to directly regulate the hepatic cytochrome P450 enzymes oxysterol 7α-hydroxylase (CYP7B1) (17) and CYP2C8 (18). Sulfotransferases (SULTs) belong to a family of phase II drug-metabolizing enzymes that catalyze the sulfonation of hydroxyl-containing compounds including endogenous and exogenous molecules. SULT2A1, a member of the hydroxysteroid SULT subfamily (19), is highly expressed in the liver and adrenal gland. The prototypical substrates for SULT2A1 include bile acids (20), hydroxysteroid dehydroepiandrosterone (DHEA) (21), and related androgens. SULT2A1-mediated bile acid sulfonation, at least in rodents, has been shown to play an important role in bile acid detoxification and prevention of cholestasis. The expression of SULT2A1 is transcriptionally regulated by nuclear receptors, such as pregnane X receptor (PXR) (22), constitutive androstane receptor (CAR) (23), liver X receptor (LXR)-α (24), hepatocyte nuclear factor-4 (25), farnesoid X receptor (26), and estrogen receptor-related receptor-α (27). The activation of SULT2A1 by PXR, CAR, and LXRα was postulated to play an important role in the anticholestatic activity of these receptors in rodent models of cholestasis (22–24). The expression of mouse Sult2a1 was elevated in mice that lacked RORα and/or RORγ, whereas overexpression of the wild-type or constitutively activated RORα in liver suppressed the expression of Sult2a1 (16), suggesting that the mouse Sult2a1 is negatively regulated by RORs. However, the mechanism for the negative regulation of Sult2a1 by RORs was not understood (16). There was no information on whether the human SULT2A1 is regulated by RORs.

In the current study, we showed that RORs positively and directly regulated the expression of the human SULT2A1 gene, which was opposite to the negative regulation of Sult2a1 by RORs in rodents. The regulation of SULT2A1 by RORs was supported by the positive association between SULT2A1 and RORs in primary human hepatocytes and human livers. Our results also suggested that the expression of RORs could be impaired by liver diseases.

Materials and Methods

Plasmid constructs

The pGL3-SULT2A1 promoter reporter was cloned by PCR using the following primers: forward, 5′-CGCGAGCTCTGAGAACAGATAAAGACTGT-3′, and reverse, 5′-CCGCTCGAGGTGGTGTGAGGGTTTCAACTG-3′, using human placenta genomic DNA as the template. The PCR products were digested with SacI and XhoI and inserted into the same enzyme-digested pGL3-basic vector from Promega (Madison, WI). The 500-bp SULT2A1 promoter reporters carrying the CAR response element (CARE), half site that shared by CAR and ROR binding elements (CORE), or RORE mutations were generated by site-directed mutagenesis, using primers as follows: CARE mutant, 5′-TCACTCTCAGGAACGCAATATAAGATGACCCCTAAAATGGTCTCTAGATAAGTTCATG-3′ and 5′-CATGAACTTATCTAGAGACCATTTTAGGGGTCATCTTATATTGCGTTCCTGAGAGTGA-3′; CORE mutant, 5′-TCACTCTCAGGAACGCAAGCTCAGATGCGGCCTAAAATGGTCTCTAGATAAGTTCATG-3′ and 5′-CATGAACTTATCTAGAGACCATTTTAGGCCGCATCTGAGCTTGCGTTCCTGAGAGTGA-3′; RORE mutant, 5′-TCACTCTCAGGAACGCAAGCTCAGATGACCCCGCCCCTGGTCTCTAGATAAGTTCATG-3′ and 5′-CATGAACTTATCTAGAGACCAGGGGCGGGGTCATCTGAGCTTGCGTTCCTGAGAGTGA-3′.

The synthetic tk reporter genes were generated by annealing and ligating the following oligonucleotides into the HindIII and BamHI digested tk-Luc vector: wild type, 5′-AGCTTAACGCAAGCTCAGATGACCCCTAAAATGGAACGCAAGCTCAGATGACCCCTAAAATGGAACGCAAGCTCAGATGACCCCTAAAATGGG-3′ and 5′-GATCCCCATTTTAGGGGTCATCTGAGCTTGCGTTCCATTTTAGGGGTCATCTGAGCTTGCGTTCCATTTTAGGGGTCATCTGAGCTTGCGTTA-3′; CARE mutant, 5′-AGCTTAACGCAATATAAGATGACCCCTAAAATGGAACGCAATATAAGATGACCCCTAAAATGGAACGCAATATAAGATGACCCCTAAAATGGG-3′ and 5′-GATCCCCATTTTAGGGGTCATCTTATATTGCGTTCCATTTTAGGGGTCATCTTATATTGCGTTCCATTTTAGGGGTCATCTTATATTGCGTTA-3′; CORE mutant, 5′-AGCTTAACGCAAGCTCAGATGCGGCCTAAAATGGAACGCAAGCTCAGATGCGGCCTAAAATGGAACGCAAGCTCAGATGCGGCCTAAAATGGG-3′ and 5′-GATCCCCATTTTAGGCCGCATCTGAGCTTGCGTTCCATTTTAGGCCGCATCTGAGCTTGCGTT CCATTTTAGGCCGCATCTGAGCTTGCGTTA-3′; RORE mutant, 5′-AGCTTAACGCAAGCTCAGATGACCCCGCCCCTGGAACGCAAGCTCAGATGACCCCGCCCCTGGAACGCAAGCTCAGATGACCCCGCCCCTGGG-3′ and 5′-GATCCCCAGGGGCGGGGTCATCTGAGCTTGCGTTCCAGGGGCGGGGTCATCTGAGCTTGCGTTCCAGGGGCGGGGTCATCTGAGCTTGCGTTA-3′. The identities of all cloned sequences were verified by DNA sequencing.

Human primary hepatocytes and human liver samples

Normal human hepatocytes were obtained through the Liver Tissue Procurement and Distribution System (Pittsburgh, PA). The human liver samples were obtained from the Kansas University Liver Center Tissue Bank at the University of Kansas Medical Center (www.kumc.edu/livercenter).

Cell culture and transient transfection

HepG2 cells were transfected using the polyethyleneimine polymer transfection agent as previously described, and the transfection efficiency was normalized against the β-gal activity from the cotransfected pCMX-β-gal vector (28). For each triplicate transfection, 0.6 μg of reporter, 0.3 μg of receptors (pCMX-RORα, pCMX-RORγ, or pCMX-HA-CAR), and 0.3 μg of pCMX-β-gal were transfected on a 48-well plate. Twenty-four hours after the transfection, cells were treated with vehicle or 1, 4-bis-[2-(3, 5,-dichloropyridyloxy)] benzene (TCPOBOP; 5 μm) in medium containing 10% charcoal/dextran-stripped fetal bovine serum for 24 h before being harvested for luciferase and β-gal assays. All transfections were performed in triplicate and repeated for at least three times.

Real-time RT-PCR analysis

Total RNA was extracted with TRIzol reagent. The cDNA was synthesized from total RNA by Superscript3 (Invitrogen, Carlsbad, CA). Aliquots of cDNA were amplified on an ABI 7300 real-time PCR system from Applied Biosystems (Foster City, CA) using the SYBR Green PCR master mix. The target mRNA expression was normalized against the cyclophilin B expression (28).

Sulfotransferase assay

Human primary hepatocyte or HepG2 cell cytosols were prepared by homogenizing cells in 5 mm KPO4 buffer (pH 6.5) containing 0.25 m sucrose. A sulfotransferase assay was carried out as described previously (29). [35S]-phosphoadenosine phosphosulfate (PAPS) from PerkinElmer (Waltham, MA) was used as the sulfate donor. In brief, 20 μg/ml total cell cytosolic proteins was incubated with 5 μm of DHEA and [35S]PAPS at 37 C for 20 min. After the reaction, free [35S]PAPS was removed by extracting with ethyl acetate. The aqueous phase was then counted in the LS6500 scintillation counter (Beckman, Palo Alto, CA) for radioactivity. Control reactions that without substrate were also carried out in parallel, and each reaction were run in triplicate.

Electrophoretic mobility shift assay

Receptor proteins were prepared using the T7 Quick Coupled Transcription/Translation System in vitro transcription and translation system from Promega. The 20-μl binding reaction contained 2 μl of radioactive probe, 2 μl of RORα, RORγ, or CAR/retinoid X receptor (RXR)-α T7 Quick Coupled Transcription/Translation System protein, 1 μl of Poly deoxyinosine-deoxycytosine, 4 μl of 5× binding buffer, and 5 μl of cold competitor when applicable. Sterile water was used to bring the final volume to 20 μl. The reactions were kept at room temperature for 20 min before electrophoresis through 5% polyacrylamide gel in 0.5× Tris borate-EDTA at 4 C for 1–3 h. For competition experiments, unlabeled (cold) oligonucleotides were added to the reactions. The EMSA oligonucleotide sequences are shown in the figures.

Chromatin immunoprecipitation (ChIP) assay

Huh7 cells with or without receptor transfection were treated with vehicle or TCPOBOP (5 μm) for 24 h before the ChIP assay as described previously (28, 30). Huh7 cells were chosen for ChIP assay because for uncharacterized reasons, Huh7 cells instead of HepG2 cells produced more reliable and reproducible ChIP results, as we have previously reported (40). Cell lysates were incubated overnight with 1 μg of anti-RORα or anti-RORγ antibody from Santa Cruz Biotechnology (Santa Cruz, CA), or anti-CAR antibody from R&D Systems (Minneapolis, MN) at 4 C. Parallel samples were incubated with normal IgG as a negative control. The following PCR primers were used: SULT2A1 CARE/RORE forward, 5′-GTTTGCACTCAAACCTTAAG-3′, and reverse, 5′-CCAGCATGTCACATGTTTG-3′; CYP2B6 forward, 5′-AAGCACTTCACGCCTCCC-3′, and reverse, 5′-CCCAGGAGGAGCAGACAAA-3′; apolipoprotein (Apo)-A-V forward, 5′-TGGGTAGTTGTGTAAGAGAGGGG-3′, and reverse, 5′-ATGAGTGCCCTGGTATCAGG-3′.

RORα and RORγ RNA interference [small interfering RNA (siRNA)]

RORα siRNA (sc-38862) and RORγ siRNA (sc-38880) were purchased from Santa Cruz Biotechnology. The siRNA transfection was carried out using Lipofectamine 2000 (Invitrogen) as we have previously described (40). The efficiencies of ROR siRNA down-regulations were confirmed by Western blot analysis.

Statistical analysis

All values were expressed as mean ± sd. Comparisons between groups were performed using a Student t test or one-way ANOVA where appropriate. P < 0.05 was considered statistically significant. Linear regression was used to analyze the expression data in primary human hepatocytes and human livers. In addition to univariate analysis, a mixed-model analysis was conducted to analyze the expression data using multiple predictors (namely RORα, RORγ, and CAR) simultaneously in predicting the expression of SULT2A1 in primary human hepatocytes and human livers.

Results

The hSULT2A1 gene promoter was activated by RORα and RORγ, and down-regulation of RORα/γ inhibited the expression of endogenous SULT2A1

To determine whether the human SULT2A1 gene is also subject to the transcriptional regulation by RORs, we cloned a 500-bp 5′ flanking region of the human SULT2A1 gene and tested its regulation by RORα and RORγ using transient transfection and reporter gene assay in HepG2 cells. To our surprise, we found this 500-bp SULT2A1 gene promoter was activated by the cotransfection of RORα or RORγ (Fig. 1A). The same promoter was activated by the cotransfection of the mouse CAR, and this activation was enhanced with the treatment of CAR agonist TCPOBOP (Fig. 1A), consistent with a previous report (31). Cholesterol sulfate has been reported as a natural ligand of RORα (32). DHEA is a typical and preferred SULT2A1 substrate (21). The inductions of SULT2A1 in ROR-transfected HepG2 cells and further inductions upon cholesterol sulfate treatment were confirmed by enzymatic assay using DHEA as the substrate (Fig. 1B). The cholesterol sulfate responsive inductions of SULT2A1 at the mRNA (Fig. 1C) and enzymatic (data not shown) levels were also confirmed in primary human hepatocytes.

Fig. 1.

Fig. 1.

RORα and RORγ activated the hSULT2A1 gene promoter and induced the expression and activity of endogenous SULT2A1 and down-regulation of RORα/γ inhibited the expression of endogenous SULT2A1. A, HepG2 cells were transiently transfected with pGL-SULT2A1 (500 bp) reporter gene, together with the empty vector or indicated receptors, and the transfection efficiency control pCMX-β-gal. Transfected cells were treated with vehicle or TCPOBOP (5 μm) for 24 h and then harvested and assayed for luciferase and β-gal activities. The transfection efficiency was normalized against the β-gal activity. B, The inductions of SULT2A1 in ROR-transfected HepG2 cells and further inductions upon cholesterol sulfate (C.S.) treatment (10 μm, overnight) were confirmed by enzymatic assay using DHEA as the substrate. C, The C.S.-responsive inductions of SULT2A1 mRNA in three cases of primary human hepatocytes was confirmed by real-time PCR. The three cases included a 61-yr-old male, a 68-yr-old male, and a 91-yr-old female, all Caucasians. D, HepG2 cells were transfected with control scrambled siRNA (siControl) or RORα and RORγ siRNA. Forty-eight hours after the transfection, cells were harvested and subjected to real-time PCR analysis to detect the expression of the endogenous SULT2A1. TC, TCPOBOP. *, P < 0.05 (n = 3 for each group).

RORs are known to have substantial constitutive activities through their interactions with nuclear receptor coactivators without an exogenously added ligand (31). In loss-of-function models, we showed that the down-regulation of either RORα or RORγ by siRNA inhibited the expression of endogenous SULT2A1, and a more prominent inhibition was observed when both ROR isoforms were down-regulated (Fig. 1D). The efficiencies of ROR siRNA down-regulations were confirmed by Western blot analysis (Supplemental Fig. 1, published on The Endocrine Society's Journals Online web site at http://mend.endojournals.org). These results suggested that the endogenous SULT2A1 was regulated by RORs.

Identification and characterization of a RORE in the SULT2A1 gene promoter that overlaps the previously reported CARE

To understand the mechanism by which RORs regulate SULT2A1, we inspected the 500-bp promoter and found a putative RORE characterized by a GGGTCA half-site flanked by adjacent A/T-rich six nucleotides (Fig. 2A). An EMSA was performed to determine the binding of RORs to SULT2A1/RORE using synthesized receptor proteins and 32P-labeled oligonucleotide probe. Both RORα and RORγ bound to radiolabeled SULT2A1/RORE efficiently (Fig. 2B) but not to the radiolabeled mutant SULT2A1/RORE with the A/T-rich region mutated (RORE mutant, data not shown). This binding was specific because efficient competition of binding was achieved by excess unlabeled wild-type SULT2A1/RORE or ApoA-V/RORE but not by the RORE mutant (Fig. 2C). ApoA-V/RORE is a prototypic RORE derived from the ApoA-V gene promoter (34). Interestingly, although RORα appeared to have stronger binding than RORγ in the EMSA, the efficiencies of these two RORs in activating the pGL-SULT2A1 (550 bp) reporter gene were indistinguishable (Fig. 1A). Therefore, the binding affinity estimated by EMSA does not always agree with the transcriptional activity in reporter gene assays.

Fig. 2.

Fig. 2.

Identification and characterization of a RORE in the SULT2A1 gene promoter that overlaps the CARE. A, Sequence of the shared binding sites with the CARE and RORE (boxed). Mutations intended to disrupt individual or combined CAR and ROR bindings are listed with mutated nucleotides (underlined). B, Binding of in vitro synthesized RORα, RORγ, and CAR to 32P-labeled wild-type or mutant DNA was demonstrated by EMSA. The relative densities of the bands within the same probe are labeled. C, The binding of RORα and RORγ to the wild-type DNA was efficiently competed by unlabeled cold probes of self or ApoA-V/RORE but not by the RORE mutant. D, Competition of DNA binding by RORs and CAR. The protein ratios of receptors are indicated.

Interestingly, SULT2A1/RORE overlaps and shares a shared half-site with the previously reported inverted repeat spaced by two nucleotide (IR2)-type CARE in the same promoter (Fig. 2A and Ref. 28). As shown by the EMSA in Fig. 2B, mutation of the shared half-site (termed CORE mutant) abolished the binding of both RORs and CAR. Mutation of the other half-site of the IR2 (termed CARE mutant) nearly, although not completely, abolished CAR binding but retained ROR binding as judged by the relative density of the shift bands. In contrast, mutation of the AT-rich half-site of RORE (termed RORE mutant) abolished the RORγ binding and substantially decreased the RORα binding but retained CAR binding. In binding reactions that contained both CAR/RXR and RORα/γ, increasing amounts of either receptor enhanced their cognate binding (Fig. 2D). Interestingly, an increased amount of CAR/RXR was efficient to diminish RORα/γ binding, whereas increased amount of RORα/γ failed to abolish but rather increased the CAR/RXR binding (Fig. 2D). These results suggested that the binding of this shared site by CAR/RXR and RORα/γ may not be simply competitive. We cannot exclude the possibility that the RORα/γ and CAR binding is cooperative.

The ChIP assay was used to determine whether the endogenous RORs could be recruited onto the SULT2A1 gene promoter in cells. As shown in Fig. 3A, immunoprecipitation on Huh7 cell DNA lysate with an anti-RORα and an anti-CAR antibody revealed the specific recruitment of RORα and CAR to a 218-bp sequence encompassing the SULT2A1/RORE-CARE, respectively. In contrast, no amplification was observed when the same precipitate was amplified using a pair of control primers designed for a distal region approximately 5 kb upstream of SULT2A1/RORE. The recruitment of RORγ onto SULT2A1/RORE was also observed (Fig. 3A, right panel). A similar pattern of ROR recruitment onto SULT2A1/RORE was observed when the Huh7 cells were transiently transfected with RORα or RORγ (Fig. 3B). As a positive control and as expected, RORα and RORγ were also recruited onto ApoA-V/RORE in ROR-transfected cells (Fig. 3B). The recruitment of transfected hemagglutinin (HA)-CAR onto SULT2A1/RORE-CARE was also confirmed by ChIP analysis, in which the recruitment of HA-CAR onto CYP2B6/CARE was included as a positive control (Fig. 3C). The ChIP results showed that both the endogenous and transfected RORs and CAR can be recruited onto the SULT2A1 gene promoter.

Fig. 3.

Fig. 3.

Recruitment of RORα and RORγ to the SULT2A1 gene promoter as shown by a ChIP assay. A and B, Formaldehyde cross-linked DNA was extracted from Huh-7 cells without (A) or with (B and C) indicated receptor transfections using the indicated antibodies. The final DNA extracts were amplified by PCR using the primer pairs encompassing SULT2A1/RORE. The recruitment of the receptor to a distal promoter in A and ApoA-V/RORE in B was included as negative and positive controls, respectively. C, The recruitment of transfected HA-CAR onto the SULT2A1 gene promoter as shown by a ChIP assay. The recruitment of CAR to CYP2B6/CARE was included as a positive control.

We then used reporter gene assays and site-directed mutagenesis to determine the functional relevance of RORE and its overlap with CARE. Synthetic tk-SULT2A1 luciferase reporter genes, containing three copies of the wild-type (WT) or mutant RORE-CARE's, were constructed and transfected into HepG2 cells together with the expression vectors for RORα, RORγ, or CAR. As shown in Fig. 4Aa, cotransfection with CAR activated the tk-SULT2A1 WT reporter gene, and this activation was abolished by the CARE mutation (Fig. 4Ab), consistent with a previous report (31). However, the transactivation of the reporter gene by CAR was not affected by the RORE mutation (Fig. 4Ac). The RORE mutation, on the other hand, abolished the transactivation by RORα or RORγ without affecting the transactivation by CAR (Fig. 4Ac). When the shared half-site was mutated (the core mutation), the reporter gene was no longer activated by either CAR or RORs (Fig. 4Ad).

Fig. 4.

Fig. 4.

Functional characterization of RORE and its overlap with CARE using reporter gene assays. HepG2 cells were transiently transfected with the synthetic promoter reporter tk-WT (A) or the natural promoter reporter (pGL-SULT2A1) (B) or their respective mutant variants (A a-d and B a-c, respectively) together with the empty vector or indicated receptors. When applicable, transfected cells were treated with vehicle or TCPOBOP (5 μm) for 24 h before cell harvesting and assays for luciferase and β-gal activities. The transfection efficiency was normalized against the β-gal activity. All data in B are expressed relative to the basal WT promoter activity from Fig. 1A that was arbitrarily defined as 1. TC, TCPOBOP. *, P < 0.05 (n =3 for each group).

We then evaluated the functionality of RORE-CARE in the context of the natural promoter pGL-SULT2A1 that contains the 500-bp SULT2A1 gene promoter (Fig. 1). Consistent with the results of the synthetic tk reporter genes, the CARE mutation (Fig. 4Ba) and RORE mutation (Fig. 4Bb) abolished the transactivation by CAR and RORs, respectively. The core mutation abolished the transactivation by both CAR and RORs (Fig. 4Bc). In the context of pGL-SULT2A1, CARE mut and CORE mut, but not RORE mut, caused a modest but significant decrease in the basal activity of the reporter genes (data not shown).

The expression of SULT2A1 was positively correlated with the expression of RORα and RORγ in primary human hepatocytes and human livers

Having established SULT2A1 as a ROR target gene, we went on to hypothesize that the expression of SULT2A1 in primary human hepatocytes or human liver tissues may be positively correlated with the expression of RORα and RORγ. To test this hypothesis, total RNAs from 21 cases of primary human hepatocytes were collected and subjected to real-time PCR analysis for the expression of SULT2A1, RORα, and RORγ. The demographic information of the 21 subjects is summarized in Supplemental Table 1. Linear regression analysis showed that the expression of SULT2A1 was positively and significantly correlated with the expression of RORα and RORγ (Fig. 5A). The expression of SULT2A1 in human hepatocytes was also positively correlated with the expression of CAR (Fig. 5A), consistent with the notion that SULT2A1 is a CAR target gene (31). A positive correlation between the expression of SULT2A1 and RORs/CAR was also observed in 27 cases of human liver samples (Fig. 5B), further supporting our hypothesis that the expression of SULT2A1 was positively regulated by RORs in vivo.

Fig. 5.

Fig. 5.

The expression of SULT2A1 was positively correlated with the expression of RORα and RORγ in primary human hepatocytes and human livers. Twenty-one cases of primary human hepatocyte samples (A) and 27 cases of human livers (B) were analyzed for their mRNA expression of SULT2A1, RORα, RORγ, and CAR by real-time PCR analysis. Diamonds represent individual patients. The correlations were analyzed by linear regression.

In addition to the univariate linear regression analysis, we also performed a mixed-model analysis in which multiple predictors, namely RORα, RORγ, and CAR, were simultaneously used to predict the expression of SULT2A1 in primary human hepatocytes and human livers. As shown in Table 1, in the mixed model, the positive association of RORα remained significant and the association of CAR was close to being significant, but the association of RORγ was not significant in primary human hepatocytes. In the human liver samples, the mixed model found none of the associations significant (data not shown). The effect of correlated predictors and the small sample sizes may have compromised the predictive values of RORs and CAR in the mixed model. Because of the small sample sizes, we did not include interaction effects of three predictors in the mixed-model analysis. An additional compromising factor in the human liver samples is the multiple disease groups.

Table 1.

Mixed model analysis of 21 cases of primary human hepatocytes

Solution for fixed effects
Effect Estimate se DF t value P value
RORα 0.1319 0.02945 17 4.48 0.0003
RORγ 0.03457 0.02487 17 1.39 0.1825
CAR 0.07206 0.03673 17 1.96 0.0663

DF, Degrees of freedom.

The expression of RORα, RORγ, CAR, and SULT2A1 was affected by liver diseases

The 27 cases of human liver samples analyzed in Fig. 5B included seven cases of normal pathology, six cases of steatosis/steatohepatitis, eight cases of liver fibrosis, and six cases of hepatocellular carcinoma (HCC). The demographic information of the 27 subjects is summarized in Supplemental Table 2. The pathologies of the diseases were clinically defined. The expression profile of representative lipogenic gene stearoyl-CoA desaturase 1 and fibrogenic genes TGFβ and α-smooth muscle actin is shown in Supplemental Fig. 2. When the liver samples were grouped by diseases and compared with the normal subjects, we found that the mRNA expression of RORα (Fig. 6A) and RORγ (Fig. 6B) was significantly lower in patients of steatosis/steatohepatitis, liver fibrosis, and HCC. Interestingly, this disease effect showed certain receptor specificity because steatosis/steatohepatitis and liver fibrosis had little effect on the hepatic expression of CAR mRNA, although HCC also had a reduced but detectable expression of CAR (Fig. 6C). A substantially decreased CAR expression, especially in late-stage HCC, has also been reported by others (35). The mRNA levels of SULT2A1 were also reduced in HCC but not in patients of steatosis/steatohepatitis and liver fibrosis (Fig. 6D).

Fig. 6.

Fig. 6.

The expression of RORα, RORγ, CAR, and SULT2A1 was affected by liver diseases. The 27 cases of human livers were divided into normal and three disease groups, and the relative expression of RORα (A), RORγ (B), CAR (C), and SULT2A1 (D) in disease groups was compared with those of the normal group. *, P < 0.05. NS, Statistically not significant.

Discussion

In this study, we showed that RORα and RORγ positively regulated the expression of the human SULT2A1 gene, which was opposite to the previously reported negative regulation of the rodent Sult2a1 gene by the same receptors (16). Mechanistically, RORs regulated SULT2A1 gene expression by binding to a RORE that overlaps with a previously reported CARE. The expression of SULT2A1 was individually and positively correlated with the expression of RORα and RORγ in primary human hepatocytes and in human livers.

The species-specific effect of RORs on the expression of SULT2A1 is interesting. The mouse Sult2a1 was suggested to be negatively regulated by RORs because the expression of Sult2a1 was elevated in mice deficient of RORα and/or RORγ, whereas overexpression of the wild-type or constitutively activated ROR suppressed the expression of Sult2a1 in primary mouse hepatocytes or intact mouse livers (16). The mechanism for the negative regulation of mouse Sult2a1 by RORs remains to be defined. The positive regulation of the human SULT2A1 by RORs is supported by the promoter analysis as well as the positive correlation between the expression of SULT2A1 and RORs in human hepatocytes and human livers. Our promoter analysis showed that the RORE-CARE module was not conserved in the promoter of the mouse Sult2a1 gene (data not shown), providing a plausible explanation for the species-specific effect of RORs on the expression of this sulfotransferase isoform. However, we cannot exclude the possibility that mechanisms other than the lack of RORE in the mouse Sult2a1 gene promoter may have also contributed to the species specific effect of ROR on SULT2A1 regulation. The species-specific regulation of metabolic enzyme genes has been reported for other nuclear receptors, such as the rodent specific regulation of Sult1e1/Est (19) and Cyp7a1 (36) by LXR.

SULT2A1 has previously been reported to be positively regulated by CAR through an IR2-type CARE (31). Interestingly, we found the RORE shares a half-site with the CARE, and the essential role of individual half-sites was confirmed by our mutagenesis analysis in EMSA and reporter gene assays. Both RORs and CAR are known to exhibit considerable constitutive activity by their constitutive recruitment of nuclear receptor co-activators (33, 37). The hierarchy of these two receptors in their regulation of SULT2A1 remains to be defined. It is conceivable that the extent of this overlap would be dependent on a number of factors, such as relative affinity for receptors, availability of endogenous or exogenous ligands, and levels of receptor expression among different tissues. The shared regulation of CYP2C8 by ROR and CAR, through independent response DNA elements, has also been reported (38).

The in vivo significance of SULT2A1 being a transcriptional target of ROR and CAR was supported by positive correlation between the enzyme and the receptors in primary human hepatocytes and in human liver samples, suggesting that the expression of RORs or CAR had a value in predicting the expression of SULT2A1 in patients. The substrates for SULT2A1 include bile acids (20), hydroxysteroid dehydroepiandrosterone (21), and related androgens. The positive regulation of SULT2A1 by nuclear receptors, such as PXR (22, 39), CAR (23), and LXR (24, 40, 41), has been implicated in an animal's susceptibility to cholestasis, androgen homeostasis, and acetaminophen toxicity. Future studies are necessary to determine whether the expression of RORs and CAR, individually or in combination, can be used as a biomarker to predict susceptibility to these diseases in human patients. Our results also showed that the expression of RORα and RORγ was negatively affected by several liver diseases including steatosis/steatohepatitis, fibrosis, and HCC. It remains to be determined whether the decreased expression of RORs played a causal role of these conditions or whether it could be secondary to the initiation and progression of the diseases.

In summary, we have established RORs as positive transcriptional regulators of SULT2A1. Our results also suggested that the expression of RORα and RORγ may have values in predicting the expression of SULT2A1 as well as susceptibility to certain diseases and drug toxicity in which the expression and/or regulation of SULT2A1 plays a role. It is encouraging that substantial progress has been made in the identification, development, and characterization of chemical ROR modulators (13–15, 32), which may help to harness the therapeutic potentials of RORs.

Supplementary Material

Supplemental Data

Acknowledgments

We thank Linhao Li for his assistance in the hepatocyte work and Jiang Li for some of the real-time PCR probes.

This work was supported by a National Institutes of Health grant (ES019629) and a Visiting Student Scholarship from the Government of China's China Scholarship Council (no. 2008638059). Normal human hepatocytes were obtained through the Liver Tissue Procurement and Distribution System (Pittsburgh, PA), which was funded by National Institutes of Health Contract (N01-DK-7-0004/HHSN267200700004C).

Disclosure Summary: The authors have nothing to disclose.

Footnotes

Abbreviations:
Apo
Apolipoprotein
CAR
constitutive androstane receptor
CARE
CAR response element
ChIP
chromatin immunoprecipitation assay
DHEA
dehydroepiandrosterone
HA
hemagglutinin
HCC
hepatocellular carcinoma
IR2
inverted repeat spaced by two nucleotides
LXR
liver X receptor
PAPS
phosphoadenosine phosphosulfate
PXR
pregnane X receptor
ROR
retinoid-related orphan receptor
RORE
ROR response element
RXR
retinoid X receptor
siRNA
small interfering RNA
SULT
sulfotransferase
TCPOBOP
1, 4-bis-[2-(3, 5,-dichloropyridyloxy)] benzene
WT
wild type.

References

  • 1. Jetten AM, Kurebayashi S, Ueda E. 2001. The ROR nuclear orphan receptor subfamily: critical regulators of multiple biological processes. Prog Nucleic Acid Res Mol Biol 69:205–247 [DOI] [PubMed] [Google Scholar]
  • 2. Carlberg C, Hooft van Huijsduijnen R, Staple JK, DeLamarter JF, Becker-André M. 1994. RZRs, a new family of retinoid-related orphan receptors that function as both monomers and homodimers. Mol Endocrinol 8:757–770 [DOI] [PubMed] [Google Scholar]
  • 3. Hamilton BA, Frankel WN, Kerrebrock AW, Hawkins TL, FitzHugh W, Kusumi K, Russell LB, Mueller KL, van Berkel V, Birren BW, Kruglyak L, Lander ES. 1996. Disruption of the nuclear hormone receptor RORα in staggerer mice. Nature 379:736–739 [DOI] [PubMed] [Google Scholar]
  • 4. Steinmayr M, André E, Conquet F, Rondi-Reig L, Delhaye-Bouchaud N, Auclair N, Daniel H, Crépel F, Mariani J, Sotelo C, Becker-André M. 1998. Staggerer phenotype in retinoid-related orphan receptor alpha-deficient mice. Proc Natl Acad Sci USA 95:3960–3965 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. André E, Conquet F, Steinmayr M, Stratton SC, Porciatti V, Becker-André M. 1998. Disruption of retinoid-related orphan receptor β changes circadian behavior, causes retinal degeneration and leads to vacillans phenotype in mice. EMBO J 17:3867–3877 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Medvedev A, Yan ZH, Hirose T, Giguère V, Jetten AM. 1996. Cloning of a cDNA encoding the murine orphan receptor RZR/RORγ and characterization of its response element. Gene 181:199–206 [DOI] [PubMed] [Google Scholar]
  • 7. Giguère V, Tini M, Flock G, Ong E, Evans RM, Otulakowski G. 1994. Isoform-specific amino-terminal domains dictate DNA-binding properties of RORα, a novel family of orphan hormone nuclear receptors. Genes Dev 8:538–553 [DOI] [PubMed] [Google Scholar]
  • 8. Harding HP, Atkins GB, Jaffe AB, Seo WJ, Lazar MA. 1997. Transcriptional activation and repression by RORα, an orphan nuclear receptor required for cerebellar development. Mol Endocrinol 11:1737–1746 [DOI] [PubMed] [Google Scholar]
  • 9. Jarvis CI, Staels B, Brugg B, Lemaigre-Dubreuil Y, Tedgui A, Mariani J. 2002. Age-related phenotypes in the staggerer mouse expand the RORα nuclear receptor's role beyond the cerebellum. Mol Cell Endocrinol 186:1–5 [DOI] [PubMed] [Google Scholar]
  • 10. Mamontova A, Séguret-Macé S, Esposito B, Chaniale C, Bouly M, Delhaye-Bouchaud N, Luc G, Staels B, Duverger N, Mariani J, Tedgui A. 1998. Severe atherosclerosis and hypoalphalipoproteinemia in the staggerer mouse, a mutant of the nuclear receptor RORα. Circulation 98:2738–2743 [DOI] [PubMed] [Google Scholar]
  • 11. André E, Gawlas K, Becker-André M. 1998. A novel isoform of the orphan nuclear receptor RORβ is specifically expressed in pineal gland and retina. Gene 216:277–283 [DOI] [PubMed] [Google Scholar]
  • 12. Kurebayashi S, Ueda E, Sakaue M, Patel DD, Medvedev A, Zhang F, Jetten AM. 2000. Retinoid-related orphan receptor γ (RORγ) is essential for lymphoid organogenesis and controls apoptosis during thymopoiesis. Proc Natl Acad Sci USA 97:10132–10137 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Jin L, Martynowski D, Zheng S, Wada T, Xie W, Li Y. 2010. Structural basis for hydroxycholesterols as natural ligands of orphan nuclear receptor RORγ. Mol Endocrinol 24:923–929 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Wang Y, Kumar N, Solt LA, Richardson TI, Helvering LM, Crumbley C, Garcia-Ordonez RD, Stayrook KR, Zhang X, Novick S, Chalmers MJ, Griffin PR, Burris TP. 2010. Modulation of retinoic acid receptor-related orphan receptor α and gamma activity by 7-oxygenated sterol ligands. J Biol Chem 285:5013–5025 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Solt LA, Kumar N, Nuhant P, Wang Y, Lauer JL, Liu J, Istrate MA, Kamenecka TM, Roush WR, Vidoviç D, Schürer SC, Xu J, Wagoner G, Drew PD, Griffin PR, Burris TP. 2011. Suppression of TH17 differentiation and autoimmunity by a synthetic ROR ligand. Nature 472:491–494 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Kang HS, Angers M, Beak JY, Wu X, Gimble JM, Wada T, Xie W, Collins JB, Grissom SF, Jetten AM. 2007. Gene expression profiling reveals a regulatory role for RORα and RORγ in phase I and phase II metabolism. Physiol Genomics 31:281–294 [DOI] [PubMed] [Google Scholar]
  • 17. Wada T, Kang HS, Angers M, Gong H, Bhatia S, Khadem S, Ren S, Ellis E, Strom SC, Jetten AM, Xie W. 2008. Identification of oxysterol 7α-hydroxylase (Cyp7b1) as a novel retinoid-related orphan receptor α (RORα) (NR1F1) target gene and a functional cross-talk between RORα and liver X receptor (NR1H3). Mol Pharmacol 73:891–899 [DOI] [PubMed] [Google Scholar]
  • 18. Chen Y, Coulter S, Jetten AM, Goldstein JA. 2009. Identification of human CYP2C8 as a retinoid-related orphan nuclear receptor target gene. J Pharmacol Exp Ther 329:192–201 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Falany CN. 1997. Enzymology of human cytosolic sulfotransferases. FASEB J 11:206–216 [DOI] [PubMed] [Google Scholar]
  • 20. Radominska A, Comer KA, Zimniak P, Falany J, Iscan M, Falany CN. 1990. Human liver steroid sulphotransferase sulphates bile acids. Biochem J 272:597–604 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Otterness DM, Wieben ED, Wood TC, Watson WG, Madden BJ, McCormick DJ, Weinshilboum RM. 1992. Human liver dehydroepiandrosterone sulfotransferase: molecular cloning and expression of cDNA. Mol Pharmacol 41:865–872 [PubMed] [Google Scholar]
  • 22. Sonoda J, Xie W, Rosenfeld JM, Barwick JL, Guzelian PS, Evans RM. 2002. Regulation of a xenobiotic sulfonation cascade by nuclear pregnane X receptor (PXR). Proc Natl Acad Sci USA 99:13801–13806 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Saini SP, Sonoda J, Xu L, Toma D, Uppal H, Mu Y, Ren S, Moore DD, Evans RM, Xie W. 2004. A novel constitutive androstane receptor-mediated and CYP3A-independent pathway of bile acid detoxification. Mol Pharmacol 65:292–300 [DOI] [PubMed] [Google Scholar]
  • 24. Uppal H, Saini SP, Moschetta A, Mu Y, Zhou J, Gong H, Zhai Y, Ren S, Michalopoulos GK, Mangelsdorf DJ, Xie W. 2007. Activation of LXRs prevents bile acid toxicity and cholestasis in female mice. Hepatology 45:422–432 [DOI] [PubMed] [Google Scholar]
  • 25. Fang HL, Strom SC, Ellis E, Duanmu Z, Fu J, Duniec-Dmuchowski Z, Falany CN, Falany JL, Kocarek TA, Runge-Morris M. 2007. Positive and negative regulation of human hepatic hydroxysteroid sulfotransferase (SULT2A1) gene transcription by rifampicin: roles of hepatocyte nuclear factor 4α and pregnane X receptor. J Pharmacol Exp Ther 323:586–598 [DOI] [PubMed] [Google Scholar]
  • 26. Song CS, Echchgadda I, Baek BS, Ahn SC, Oh T, Roy AK, Chatterjee B. 2001. Dehydroepiandrosterone sulfotransferase gene induction by bile acid activated farnesoid X receptor. J Biol Chem 276:42549–42556 [DOI] [PubMed] [Google Scholar]
  • 27. Seely J, Amigh KS, Suzuki T, Mayhew B, Sasano H, Giguere V, Laganière J, Carr BR, Rainey WE. 2005. Transcriptional regulation of dehydroepiandrosterone sulfotransferase (SULT2A1) by estrogen-related receptor α. Endocrinology 146:3605–3613 [DOI] [PubMed] [Google Scholar]
  • 28. Ou Z, Wada T, Gramignoli R, Li S, Strom SC, Huang M, Xie W. 2011. MicroRNA hsa-miR-613 targets the human LXRα gene and mediates a feed-back loop of LXRα autoregulation. Mol Endocrinol 25:584–596 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Gong H, Guo P, Zhai Y, Zhou J, Uppal H, Jarzynka MJ, Song WC, Cheng SY, Xie W. 2007. Estrogen deprivation and inhibition of breast cancer growth in vivo through activation of the orphan nuclear receptor liver X receptor. Mol Endocrinol 21:1781–1790 [DOI] [PubMed] [Google Scholar]
  • 30. Zhou J, Zhai Y, Mu Y, Gong H, Uppal H, Toma D, Ren S, Evans RM, Xie W. 2006. A novel pregnane X receptor-mediated and sterol regulatory element-binding protein-independent lipogenic pathway. J Biol Chem 281:15013–15020 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Echchgadda I, Song CS, Oh T, Ahmed M, De La Cruz IJ, Chatterjee B. 2007. The xenobiotic-sensing nuclear receptors pregnane X receptor, constitutive androstane receptor, and orphan nuclear receptor hepatocyte nuclear factor 4α in the regulation of human steroid-/bile acid-sulfotransferase. Mol Endocrinol 21:2099–2111 [DOI] [PubMed] [Google Scholar]
  • 32. Kallen JA, Schlaeppi JM, Bitsch F, Geisse S, Geiser M, Delhon I, Fournier B. 2002. X-ray structure of the hRORα LBD at 1.63 A: structural and functional data that cholesterol or a cholesterol derivative is the natural ligand of RORα. Structure 10:1697–1707 [DOI] [PubMed] [Google Scholar]
  • 33. Delerive P, Chin WW, Suen CS. 2002. Identification of Reverb(α) as a novel ROR(α) target gene. J Biol Chem 277:35013–35018 [DOI] [PubMed] [Google Scholar]
  • 34. Lind U, Nilsson T, McPheat J, Strömstedt PE, Bamberg K, Balendran C, Kang D. 2005. Identification of the human ApoAV gene as a novel RORα target gene. Biochem Biophys Res Commun 330:233–241 [DOI] [PubMed] [Google Scholar]
  • 35. Pascussi JM, Robert A, Moreau A, Ramos J, Bioulac-Sage P, Navarro F, Blanc P, Assenat E, Maurel P, Vilarem MJ. 2007. Differential regulation of constitutive androstane receptor expression by hepatocyte nuclear factor4α isoforms. Hepatology 45:1146–1153 [DOI] [PubMed] [Google Scholar]
  • 36. Chiang JY, Kimmel R, Stroup D. 2001. Regulation of cholesterol 7α-hydroxylase gene (CYP7A1) transcription by the liver orphan receptor (LXRα). Gene 262:257–265 [DOI] [PubMed] [Google Scholar]
  • 37. Forman BM, Tzameli I, Choi HS, Chen J, Simha D, Seol W, Evans RM, Moore DD. 1998. Androstane metabolites bind to and deactivate the nuclear receptor CAR-β. Nature 395:612–615 [DOI] [PubMed] [Google Scholar]
  • 38. Chen Y, Goldstein JA. 2009. The transcriptional regulation of the human CYP2C genes. Curr Drug Metab 10:567–578 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Zhang B, Cheng Q, Ou Z, Lee JH, Xu M, Kochhar U, Ren S, Huang M, Pflug BR, Xie W. 2010. Pregnane X receptor as a therapeutic target to inhibit androgen activity. Endocrinology 151:5721–5729 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Lee JH, Gong H, Khadem S, Lu Y, Gao X, Li S, Zhang J, Xie W. 2008. Androgen deprivation by activating the liver X receptor. Endocrinology 149:3778–3788 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Saini SP, Zhang B, Niu Y, Jiang M, Gao J, Zhai Y, Lee JH, Uppal H, Tian H, Tortorici MA, Poloyac SM, Qin W, Venkataramanan R, Xie W. 2011. Activation of LXR increases acetaminophen clearance and prevents its toxicity in mice. Hepatology 54:2208–2217 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental Data

Articles from Molecular Endocrinology are provided here courtesy of The Endocrine Society

RESOURCES