Abstract
The purpose of this study was to assess the effects of berberine (BBR) on thermoregulation in mice exposed to hot (40°C) and cold (4°C) environmental conditions. Four groups of mice were assembled with three different dosages of BBR (0.2, 0.4, and 0.8 mg/kg) and normal saline (control). In room temperature, our largest dosage of BBR (0.8 mg/kg) can reduce rectal temperatures (Tc) of normal mice. In hot conditions, BBR can antagonize the increasing core body temperature and inhibit the expression of HSP70 and TNFα in mice; conversely, in cold conditions, BBR can antagonize the decreasing core body temperature and enhance the expression of TRPM8. This study demonstrates the dual ability of BBR in maintaining thermal balance, which is of great relevance to the regulation of HSP70, TNFα and TRPM8.
Introduction
Berberine (BBR) is the principal active compound of Coptidis rhizoma, which is called Huang Lian in Chinese medicine and has been used in clinical practice for thousands of years in China. According to original literature and principles of Chinese medicine, Coptidis rhizoma is used in therapies for dispelling heat within the body. It is also used for febrile diseases, such as gastrointestinal infectious disease [1]–[3]. In recent decades, many new pharmacological activities of BBR have been investigated, including anti-inflammatory and anti-apoptotic [4], [5], anti-diabetic [6], [7], anti-hyperlipidemic [8]–[11], and anti-cancer properties [12]–[19], as well as the ability to protect neurons from cerebral ischemia/reperfusion injury by triggering P55γ in the PI3K pathway [20]. Our recent studies have revealed that BBR acts as an intercalator on the TATA box and inhibits gene transcription in a non-specific way [21], indicating that DNA can be a target of BBR in vivo. Throughout our work with BBR, our researchers consistently observed a decreased body temperature. To further understand the potential role of BBR in the regulation of body temperature, the present work comprehensively studied the effect of BBR on environment-dependent thermogenesis in mice. Regulatory thermogenesis by BBR was observed: BBR can antagonize increasing body temperatures in hot environments and, conversely, antagonize decreasing body temperatures in cold environments, which demonstrates a balance in regulation. Moreover, factors such as HSP70 (heat shock protein 70) and TNFα (tumor necrosis factor) for hot stimulation as well as TRMP8 (transient receptor potential cation channel, member 8) for cold stimulation were also observed to be involved in this balance regulation because of their correlation with hot or cold thermal regulation [22], [23].
Materials and Methods
Animals
All studies were conducted under protocols approved by the Institutional Animal Care and Use Committee of Tsinghua University and the Animal Welfare and Ethics Committee of Tsinghua University (Approval ID: 2012-DuLJ-BBR). The male ICR mice (8–10 week old,weighing 21–23 g) used in this study were purchased from Vital River Laboratories (Beijing, China) and kept in the animal center of Tsinghua University. Mice were maintained under standard temperature and pressure with 12 h light/dark cycle at a controlled temperature (25°C) and relative humidity (45–55%) with access to standard food pellets and tap water ad libitum.
Dosages and Groups
Berberine (BBR) was purchased from the National Institutes for Food and Drug Control (Beijing, China) with a purity of 98% (HPLC test). Based on results of previous studies including that of our own laboratory, three dosages of BBR were selected (0.2, 0.4, and 0.8 mg/kg). BBR was administered via intravenous injection. All the thermal detection experiments consisted of all the thermal detection experiments contained 4 groups, which consisted of the three dosage groups of BBR and one control group (normal saline). For electrocardiography (ECG), the dosages used were 0.5, 1, and 10 mg/kg for safety reasons. For motor behavior testing, the mice were given two dosages of BBR, 0.4 and 0.8 mg/kg.
Experimental Procedures
Normal conditions
The mice were kept at room temperature (25°C) and were injected with BBR at three different dosages, 0.2, 0.4, and 0.8 mg/kg. Before BBR injection, the rectal temperature (Tr) of each mouse was measured using a micro-electronic thermal detector (SN2202 Thermal Detector, Sinan Thermal Instrument, Beijing, China) inserted about 1.5 cm into the rectum and held in position with adhesive tape [24]. Before BBR injection, Tr was recorded three times in order to determine the average, which was used as the baseline. Tr was detected and recorded at different points in time, 0.5, 1, 2, 4, 6, 8, and 10 hours after BBR injection. Normal saline was used as a control.
Hot conditions
The mice were kept at room temperature (25°C) and were injected with BBR at three different dosages (0.2, 0.4, and 0.8 mg/kg). Then, 0.5 to 2 hours after BBR injection, Ta was detected. In turn, the mice were exposed to different temperatures in a constant thermal incubator (40°C) (TS-1 Incubator, Huangshi Medical Instrument, Hubei, China) for heat conditioning [25]. During this time (2 hours), Tr was detected every 0.5 hours. After 2 hours of heat conditioning, mice were moved back to a room-temperature environment (25°C). Tr was assessed continuously for 6 hours. To determine whether BBR exerted any sustained action, the pre-BBR duration was set as 0.5, 1, and 2 hours before heat conditioning. Normal saline was used as a control. The experimental process is shown in Fig. 1.
Cold conditions
The mice were kept at room temperature (25°C) and were injected with BBR at three different dosages (0.2, 0.4, and 0.8 mg/kg). After BBR injection at room temperature at 0.5, 1, and 2 hours, the mice were exposed to cold conditions (4°C) (YC-1 Cold-Incubator, Boyikang Laboratory Instrument Ltd. Beijing, China). Cold conditioning lasted 6 hours [26], [27]. During the cold conditioning, Tr was detected every hour. After 6 hours of cold conditioning, mice were moved back to a room temperature environment (25°C). Tr was detected every hour at room temperature after the end of cold conditioning. Recovery time lasted 3 hours. To determine whether BBR exerted any sustained action, the pre-BBR duration was set as 0.5, 1, and 2 hours before cold conditioning. Normal saline was used as a control. The experimental process is shown in Fig. 2.
Use of HSP70 inhibitor in hot conditions
ICR mice were divided into five groups: BBR, KNK439, and KNK439 plus BBR were three of the groups. Normal saline was used as a control group (hot stimulation) and then we had one group of normal control mice (normal mice kept at room temperature). Based on prior literature, KNK437 (50 mg/kg) (Santa Cruz, USA) was administered via pre-intraperitoneal injection (i.p.) for 6 hours so that it reached a high concentration in blood [28], [29]. Thereafter, BBR (0.8 mg/kg) was administered via intravenous injection. One hour after BBR injection, mice were kept in hot conditions (40°C) for 2 hours. Tr was detected every half hour during hot conditions. At the end of hot conditions, mice were killed and their brains were removed. The hypothalamus was isolated and stored at −80°C for mRNA and protein expressions of HSP70.
Electrocardiography and motor behavior
Mice were divided into four groups. BBR was injected at three different dosages (0.5, 1, and 10 mg/kg). Our previous work determined that the LD50 of BBR was 9.0386 mg/kg [30]. Therefore, the dose of 10 mg/kg was used as the maximum dosage because of its toxicity to the heart by ECG (LCS-2012NK Cardifax, Nihon Koden, Japan) and its effects on cerebral blood flow (CBF) by microcirculation probe (MDL-1 Laser Doppler Analyzer, Nai Kai University, China). Mice were anesthetized by 10% urethane (1 g/kg, i.p.) and kept on the plate in the prone position for 5 min before the experiment. ECG was recorded by the standard II lead. Mouse CBF was detected by putting a laser probe on the bregma [31]. ECG and CBF were recorded prior to BBR injection as control for a within-subjects design. After BBR injection, ECG and CBF were recorded simultaneously at seven different points in time (1, 5, 10, 20, 30, 45, and 60 min). Normal saline was employed as a control.
The motor behavior was assessed via the motor movement and the exploit behavior (SH900 Motor Behavior Instrument, Institute of Meteria Medica, Beijing, China). The mice were allowed to familiarize themselves with a round cage for 2 min before recording. The motor movement was recorded in terms of the number of times each mouse crossed the electric beam-lines in 5 min. The exploit behavior was recorded as the number of times each mouse reared up onto its hind legs in 5 min. Two different dosages were used, 0.4 and 0.8 mg/kg. Then, 0.5 hours after BBR injection, mice were kept in a round cage. Mouse motor movement and exploit behavior were recorded during the first 5 min [32]–[35]. Normal saline was used as a control.
Real Time PCR and Western Blot
Mice were randomly separated into two groups (the control group with normal saline and BBR group with the dosage of 0.8 mg/kg). As mentioned previously in the experimental procedures of the hot and cold conditions, the brain samples were taken out at different time points. The nuclei of the hypothalamus [36], [37] were isolated quickly from the brains and stored at −80°C until use. In the hot experimental condition, the time points were set at 0, 0.5, 1, 1.5 and 2 hours. In the cold experimental condition, the time points were set at 0, 1, 2, 3, 4, 5 and 6 hours. Mice were injected with BBR 1 hour before hot or cold conditioning. Each time point consisted of six independent mice.
The mRNA levels were determined using SYBR Greenbased quantitative PCR. RNA was prepared by using a RNA simple kit (Tiangen, China) according to the protocol instructions. Total RNA was incubated with DNase to eliminate any residual DNA that might amplify during PCR. From each sample, 30 pg total RNA was reverse transcribed and amplified by using M-MuLV First Strand cDNA Synthesis Kit (Bio Basic, Canada). The Real Mater Mix (SYBR Green) kit (Tiangen, China) was used for PCR. Light Cycler 480II (Roche, USA) was used for detection of the products of PCR. The primer sequence of TRPM8 was designed by Primer Premier 5.0 software and blasted at NCBI GenBank. The primer sequences of HSP70, TNFα and β-actin were used from references, respectively. All primer sequences used in the analyses are produced by Sangon Biotechnology Ltd. (Shanghai, China). The cycling conditions were: 94 °C for 3 min; 45 cycles of 94 °C for 10 sec, 56 °C for 10 sec (TNF-α 58°C, HSP70 57 °C), 72 °C for 10 sec; 72 °C for 10 min and cooled to 4 °C. Data were processed using the Light Cycler 480 SW1.5 software program. β-actin served as the internal control. The primer sequences are as follows: HSP70: sense: 5’- AGCGAGGCTGACAAGAAGAAGGT-3’, antisense: 5’- ACCCTGGTACAGCCCACTGATGAT-3’ [22]; TNFα: sense: 5’- CACCACGCTCTTCTGTCTACTGAACT-3’, antisense: 5’- GGGCTACAGGCTTGTCACTCGAATTT-3’ [22]; TRPM8: sense: 5’- GGTCTTCTCCTGGAACGTGG -3’, antisense: 5’- GTCCCAGGGTGTCCATAACG -3’ generating a 209-bp DNA fragment (GenBank IC number: NM_134252.3); β-actin: sense: 5’-CCCCATTGAACATGGCATTG-3’, antisense: 5’-ACGACCAGAGGCATACAGG-3’ [20].
Total protein was prepared from mouse brain homogenate with 2% SDS. Protein concentration was measured using a Protein Assay Kit (Zhongsheng Biotech., China). Protein (10 µl) was loaded onto SDS-PAGE gels (TNF-α 12%, TRPM-8 and HSP70 10%), and transferred onto nitrocellulose membranes after electrophoresis. The membrane was blocked with 5% bovine serum albumin in PBST (PBS buffer containing 0.1% Tween-20) for 2 h, incubated with primary antibody in PBST overnight at 4 °C. The labeled membrane was washed three times (15 min each) with PBST and then incubated with horseradish peroxidase (HRP)-conjugated secondary antibody in PBST for 1 h at room temperature. The membrane was again washed three times (15 min each) with PBST. The targeted proteins were visualized with the super signal ECL Western blot Substrate (Pierce, China) and the intensity of visualized bands was measured using Quantity One software (Bio-Rad). β-actin was used as an internal control. Data were expressed by the ratio to β-actin. Horseradish peroxidase conjugated secondary antibodies of goat anti-mouse IgG-HRP and goat anti-rabbit IgG-HRP were purchased from Santa Cruz (USA). The primary antibody (monoclonal antibody) of HSP70, TNFα, TRPM8 were purchased from Zhongshan Jinqiao (Beijing, China), Abcam (UK) and Epitomics (USA), respectively. The primary antibody of β-actin was purchased from Santa Cruz (USA).
Data Analysis
All data are expressed as mean ± S.D. Data were statistically analyzed using one-way analysis of variance (ANOVA) with F value determination. The F test was carried out using Excel software for Office 2007 (Microsoft, USA). The student’s t-t test between two groups was performed after the F test. P values below 0.05 were considered statistically significant. The data regarding the change in rectal temperature (Tr) were expressed as ΔTr, the difference between Tr before BBR and Tr after BBR (ΔT = Tr before BBR- Tr after BBR). The thermal response index (TRI) (°C. h) was obtained via Graph Pad 5.0 software [38], [39]. The area under the ΔT curve (AUC) was defined as TRI [24]. The ordinate and abscissa refer to ΔT (°C) and time (hour) of thermal duration, respectively.
Results
Thermoregulation of Normal Mice
At room temperature, the body temperatures of mice could be regulated by BBR (Fig. 3A) during the 12 hours after drug administration (Fig. 3B). Within the two hours after drug administration, the body temperature of mice treated with BBR at the dosage of 0.4 mg/kg and 0.8 mg/kg decreased faster than other periods (Fig. 3C). Ten hours after BBR injection, the TRI attenuated in the group given 0.4 mg/kg BBR, but no positive effect was observed in the group given 0.8 mg/kg BBR (Fig. 3D). However, four hours after BBR administration, a decreased TRI was observed both in 0.4 mg/kg and 0.8 mg/kg BBR group (Fig. 3E). TRI stayed at a low level 4 hours after BBR injection, which lasted until 10 hours after BBR injection (Fig 3F). This suggested that BBR can distinctly decrease body temperature 4 hours after injection. BBR was able to decrease the body temperature of normal mice via dosages of 0.4 mg/kg and 0.8 mg/kg (Fig. 3).
Thermoregulation under Hot Conditions
In the hot experimental condition, the body temperature of mice in the control group increased by 3°C on average in comparison to normal conditions (Fig. 4). The increased body temperature was dose-dependently antagonized by BBR. The body temperature of the mice decreased sharply by about 3°C below body temperature of mice under normal condition, and it then increased slowly. BBR at the dosage of 0.4 mg/kg and 0.8 mg/kg was able to antagonize the increasing body temperature and kept the temperature close to normal baseline. Differences in the period before BBR administration (0.5, 1, and 2 hours before conditioning) had no discernible impact on the effect of BBR in its regulation of body temperature.
During the 2 hours of heat conditioning, the TRI of mice in two different dosage groups (0.4 and 0.8 mg/kg) was lower than that of control mice (Figs. 5A–C). Regarding mice treated with BBR 2 hours before exposure to hot conditions, the TRI of mice given 0.2 mg/kg BBR was much lower than that of control mice. After the heat conditioning, the mice were maintained at room temperature for recovery. During the 6 hours of recovery, the TRI of all BBR treated mice remained higher than that of control mice. Among mice treated with BBR 0.5 hours prior to heat conditioning, TRI of mice in all three dosage groups (0.2, 0.4, and 0.8 mg/kg) was significantly higher than that of control mice (Fig. 5D). However, among mice injected 1 and 2 hours before heat conditioning, the TRI of mice given 0.4 and 0.8 mg/kg was higher than that of control mice; the TRI of mice given 0.2 mg/kg was not higher (Figs. 5E–F). This suggests that 6 hours is sufficient time for BBR to affect heat conditioning.
During the first two hours when the mice situated in the hot environment, BBR dose-dependently decreased the animal’s body temperature (Figs. 6A–C). Compared to injection time-points at 0.5 and 1 h prior to heat exposure, injection of BBR at least 2 hours before exposure to hot conditions augmented the antagonistic effect of BBR on the increased body temperature within all three dosage groups (0.2, 0.4 and 0.8 mg/kg) used in this study. Furthermore, during the recovery process after heat conditioning, the body temperature of mice decreased to a lower level than normal baseline level. BBR at the dosage of 0.4 mg/kg and 0.8 mg/kg can antagonize the decrease in body temperature (Figs. 6D–F), and the time-points of drug administration (0.5, 1, and 2 hours) prior to heat conditioning are independent of this antagonistic effect of BBR.
Thermoregulation under Cold Conditions
The body temperature of mice under controlled cold conditions (4°C) decreased strikingly. During the 6 hours of cold conditioning, BBR at all three doses (0.2 mg/kg, 0.4 mg/kg, and 0.8 mg/kg) antagonized the body temperature drop. After cold conditioning, the mice were fed under room-temperature (25°C), and the body temperature of mice in all groups recovered quickly. No difference between BBR-administered and control groups was evident (Figs. 7A–C).
BBR was found to decrease the temperature 0.5 h after injection in a dose-dependent manner (Fig 8 A). One hour after injection, BBR at the dosages of 0.4 and 0.8 mg/kg decreased the normal temperature. Two hours after the injection, no effect of BBR on the body temperature was observed (Figs 8 D and G.). Four hours during cold conditioning, the body temperature decrease was suppressed by BBR in a dose-dependent manner, which was evident irrelevant to the time of BBR administration before cold conditioning (Figs. 8 B, E, and H). During the 6-hour cold conditioning, TRI remained higher than that of control mice at all three different dosages (0.2, 0.4, and 0.8 mg/kg) (Figs. 8 C, F, and J) suggesting that BBR can prevent temperature attenuation caused by cold conditions.
Thermo-balance between Hot and Cold Conditions
Under hot conditions (40°C), mouse body temperature increased dramatically and decreased sharply early during the recovery period (25°C). BBR was able to antagonize the changes in body temperature of mice, maintaining it around near normal temperatures.BBR also increased the body temperature to near normal levels during the cold condition, and maintained relatively low body temperature in the hot condition (Figs. 9A–C).
HSP70, TNFα and TRPM8 Expressions
The expression of mRNA and protein of HSP70 and TNFα was noticeably enhanced under hot conditions (40°C). The expression of HSP70 did not increase during the first 0.5 hour of heat stimulation, but increased markedly from one hour of heat stimulation and maintained itself at a high level until the end of heat stimulation. The regulation of HSP70 expression during this process in mRNA levels was in good accordance with its protein levels (compared to 0 hour, P = 0.034). The regulation of TNFα expression in mRNA level was similar to that of HSP70. After one hour of heat stimulation, TNFα expression was increased and then reduced gradually. However, the protein level of TNFα responded poorly to hot stimulation. There was only a trend towards an increase in TNFα protein compared to before heat conditioning (1 hour time point, P = 0.105). BBR inhibited the expressions of mRNA and protein of both HSP70 and TNFα during hot conditions, suggesting that these two factors are involved in the effect of BBR on high body temperatures induced by hot environments (Figs. 10A–D).
During the first two hours of cold conditions, the mRNA expression of TRPM8 in the control group increased evidently and then decreased to normal levels. However, the protein level of TRPM8 decreased in the first one hour after cold conditioning (compared to 0 hour, P = 0.035) and recovered, compared to the onset of cold conditioning (P = 0.175), until the end of cold stimulation (6 hours during cold conditioning). This indicates more complicated mechanisms in TRPM8 and temperature response. Therefore, after cold conditioning, only an increase in TRPM8 mRNA levels by BBR was evident, suggesting that TRPM8 is involved in the effect of BBR on cold environmental stimulation (Figs. 10E–F), but a more complicated mechanism exists.
HSP70 Inhibitor in Hot Conditions
KNK437 is a small molecule inhibitor of HSP70 [28]. After intraperitoneal injection of KNK437 in mice, Tr did not increased appreciably after heat conditioning. However, the body temperature of mice without KNK437 administration increased by 2°C. Therefore, BBR can attenuate body temperature under hot conditions, but is weaker than KNK437. In KNK437-BBR groups, Tr decreased evidently to temperatures close to that of the KNK437 groups (Figs. 11 A and B). Accordingly, the distinct expression of both mRNA and protein levels of HSP70 was upregulated in control groups with normal saline after hot conditions. Both KNK437 and BBR can inhibit the increased expression of mRNA and protein levels of HSP70. However, no synergistic effect was found between KNK437 and BBR (Figs. 11 C and D).
Motor and Exploiting Behavior
BBR was found to reduce heart rate (HR) at a dose of 10 mg/kg (Fig. 12C). However, with the BBR dosages we used (0.5 and 1 mg/kg), no inhibition of mouse heart rate or changes in the ECG relative to the control were observed (Fig. 12A). BBR also could not reduce mouse cerebral blood flow rate at the dosage of 0.5 and 1 mg/kg (Fig. 12B). At the dosage of 10 mg/kg, mouse HR reduced sharply within 5 min after intravenous BBR injection. Then, 60 minutes after drug administration, the mouse HR decreased from 580 beats/minute to 220 beats/minute. The cerebral blood flow rate decreased to 50% compared to the flow rate before BBR administration, which correlates with the reduction in HR. At the dosage of 1 mg/kg, BBR could not change the HR of the mice, indicating that the dosages used in hot/cold conditions were safe and did not affect mouse circulatory function.
The mouse movement and the exploit behavior reflect the function of central nervous system (CNS). No effect of BBR with the dosage of 0.4 and 0.8 mg/kg was observed in this experiment (Fig. 12 D).
Discussion
Berberine (BBR) is an antibacterial agent and is clinically used to treat intestinal inflammation. The antifebrile effect of BBR is thought to be in part due to some of its antibacterial effects. In our previous studies with BBR, we noticed the effect of BBR on body temperature and hypothesized that BBR could act directly on thermal regulation in vivo. Data from mice under room temperature verified that BBR was able to decrease the body temperature of mice in a dose dependent manner (0.2, 0.4, and 0.8 mg/kg). Physical models of high body temperature and low body temperature in mice induced by controlled environmental temperature were used in the present study to explore the potential effect of BBR on thermal regulation of mice under abnormal temperatures.
In the experimental system, BBR could dose-dependently antagonize the alteration of body temperature under hot or cold conditions and maintain the body temperature close to its baseline, indicating that BBR can balance the mouse body temperature under both hot and cold conditions. After completion of heat conditioning, mouse body temperature decreased immediately and then slowly returned to normal, which is consistent with previous reports [40]–[42], suggesting a need for the physiology of thermoregulatory control to be studied in more detail [43]. BBR was found to prevent the sharp decrease in body temperature in the post-heat conditioning process and promote recovery, maintaining the balance between heat conditioning and recovery. Therefore, thermo-balance via BBR under hot and cold conditions can be concluded (Fig. 9D).
It was reported that the distinct upregulation of HSP70 and TNFα correlate with the response of thermoregulation to heat stimulation [44], [45]. HSP70 was shown to be an intermediary in the thermal effects on TNFα expression, because the use of HSP70 inhibitors significantly eliminated the thermal-dependent enhancement of TNFα expression [22]. The present study found an upregulation of HSP70 and TNFα in the hypothalami of mice exposed to hot conditions; BBR was able to inhibit HSP70 and TNFα expression during heat conditioning, suggesting that the thermal mechanism of BBR correlates with these two factors. During hot conditions, KNK437, an inhibitor of HSP70, was found to clearly inhibit the body temperature, which confirms the previous study that HSP70 is a crucial factor in temperature response by heat stimulation [29]. Simultaneously, BBR was also found to inhibit the response of body temperature to environmental temperature. There was no synergistic effect when BBR was administered with KNK437 because Tr of the mice was not reduced significantly compared to that of KNK437 groups. The expression of mRNA and protein of HSP70 also decreased in KNK437 groups and BBR groups. We can, therefore, conclude that HSP70 is one of the crucial targets of BBR during hot conditions.
In recent studies, TRPM8 is recognized as a sensor in peripheral nerves for transporting the cold signal to the central nervous system (CNS) [46], [47]. However, there are few reports concerning TRPM8 and the hypothalami of mice during cold conditions. In our study, TRPM8 in control mice was found to be distinctly upregulated in mRNA levels after 2 hours in cold conditions and then decreased close to normal; however, the protein levels of TRPM8 were not responsive to cold stimulation as mRNA was, suggesting that there was a suppression of upregulation of TRPM8 protein during cold conditions. BBR was found to upregulate TRMP8 expression in both mRNA and protein levels, suggesting that the mechanism of thermal regulation via BBR under cold conditions is pertinent in affecting TRPM8 levels. Therefore, TRPM8 was considered as a potential target of BBR in mouse body temperature attenuation under cold conditions.
Normally, environmental hot and cold conditions was found to cause cutaneous thermal receptor to respond and send feed-forward afferent signals to brain thermo-sensitive neurons in hypothalamus [37]. They, in turn, activate specific populations of sympathetic and somatic afferents [46]. Under cold conditions, heat production in the body requires thermogenesis. While under hot conditions, heat loss fosters thermal balance. BBR disrupted both hot and cold responses, implying that it must target crucial factors by preventing the feed-forward afferent signals from activating the thermo-sensitive neurons. HSP70 is recognized as a factor in stress response to cell survival protection as well as in cell thermal response [48]. TRPM8 is recognized as the cold sensor for afferent signals to thermo-sensitive neurons. The results of HSP70, TNFα and TRPM8 in the hypothalami demonstrate that BBR may exert its thermal regulative effects by acting on these factors, interfering with the response of body temperature to the environmental change.
Regarding the toxicity of BBR, we conducted the ECG and the motor behavior experiments with mice. In ECG, 1 mg/kg of BBR did not influence mouse heart ECGs, indicating that this dose is safe for heart function. Our previous work suggests that the LD50 of BBR was at 9.0386 mg/kg by intravenous injection [30]. A dose of 10 mg/kg of BBR was found to inhibit the heart rate, which supported the previous LD50 conclusion. It has been reported that the depression of the CNS, such as that caused by diazepam, can reduce the stress-induced hyperthermic (SIH) response in rodents [49], and the motor movement and the exploit behavior are often used as an index of mouse CNS function [50]. The ECG and motor experiments confirmed that there is no such interference at any BBR dosage in our experiments.
In conclusion, BBR can influence the body temperature of mice and affect thermal regulation under hot and cold conditions. HSP70, TNFα and TRPM8 in the hypothalamus are involved in the mechanism of BBR thermal regulation. Since HSP70, TNFα and TRPM8 have not been thoroughly understood regarding their effects on thermoregulation, there are many challenges for comprehending the fundamental specificities of BBR that affect expression of these factors. Further research is, therefore, warranted to address these issues in more detail.
Acknowledgments
We thank all of the colleagues in our laboratory.
Funding Statement
This work was supported by the National Natural Science Foundation of China (30973896, 30801523 and 81073092) and the National S&T Major Special Project for New Drug R&D Program of China (2012ZX09103-201-041, 2011ZX09101-002-11 and 2012ZX09102-201-008). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Liu ZQ, Wang YW, Hu JX, Su C, Fan GH, et al. (1991) The febrifugal effects of Coptidis injection on leucocytic pyrogen fever and the changes of cAMP content in CSF in febrile rabbits. Chinese J of Pathophysiology 7: 264–266. [Google Scholar]
- 2. Xia JZ (2004) Medicinal herbs used in pairs for treatment of 98 cases of chronic gastritis. J of Traditional Chinese Medicine 24: 208–209. [PubMed] [Google Scholar]
- 3. Tang J, Feng YB, Tsao SW, Wang N, Curtain R, et al. (2009) Berberine and Coptidis Rhizoma as novel antineoplastic agents: A review of traditional use and biomedical investigations. J of Ethnopharmacology 126: 5–17. [DOI] [PubMed] [Google Scholar]
- 4. Kim JM, Jung HA, Choi JS, Lee NG (2010) Identification of anti-inflammatory target genes of Rhizoma coptidis extract in lipopolysaccharide-stimulated RAW264.7 murine macrophage-like cells. J of Ethnopharmacology 130: 354–362. [DOI] [PubMed] [Google Scholar]
- 5. Ho YT, Lu CC, Yang JS, Chiang JH, Li TC, et al. (2009) Berberine Induced Apoptosis via Promoting the Expression of Caspase-8, -9 and -3, Apoptosis-inducing Factor and Endonuclease G in SCC-4 Human Tongue Squamous Carcinoma Cancer Cells. Anticancer Res 29: 4063–4070. [PubMed] [Google Scholar]
- 6. Cok A, Plaisier C, Salie MJ, Oram DS, Chenge J, et al. (2011) Berberine acutely activates the glucose transport activity of GLUT1. Biochimie 93: 1187–1192. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Cui GL, Qin X, Zhang YB, Gong ZW, Ge BX, et al. (2009) Berberine Differentially Modulates the Activities of ERK, p38 MAPK, and JNK to Suppress Th17 and Th1 T Cell Differentiation in Type 1 Diabetic Mice. J of Biological Chemistry 284: 28420–28429. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Kong WJ, Wei J, Abidi P, Lin MH, Inaba S, et al. (2004) Berberine is a novel cholesterol- lowering drug working through a unique mechanism distinct from statins.Nature Medicine. 10: 1344–1351. [DOI] [PubMed] [Google Scholar]
- 9. Kim WS, Lee YS, Cha SH, Jeong HW, Choe SS, et al. (2009) Berberine improves lipid dysregulation in obesity by controlling central and peripheral AMPK activity. Am J Physiol Endocrinol Metab 296: E812–E819. [DOI] [PubMed] [Google Scholar]
- 10. Chang XX, Yan HM, Fei J, Jiang MH, Zhu HG, et al. (2010) Berberine reduces methylation of the MTTP promoter and alleviates fatty liver induced by a high-fat diet in rats. J Lipid Res 51: 2504–2515. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Li H, Dong B, Park SW, Lee HS, Chen W, et al. (2009) Hepatocyte Nuclear Factor 1α Plays a Critical Role in PCSK9 Gene Transcription and Regulation by the Natural Hypocholesterolemic Compound Berberine. J of Biological Chemistry 284: 28885–28895. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Yan KQ, Zhang C, Feng JB, Hou LF, Yan L, et al. (2011) Induction of G1 cell cycle arrest and apoptosis by berberine in bladder cancer cells. European J of Pharmacology 661: 1–7. [DOI] [PubMed] [Google Scholar]
- 13.Wang Y, Liu Q, Liu ZJ, Li BX, Sun ZL, et al. (2012) Berberine, a genotoxic alkaloid, induces ATM-Chk1 mediated G2 arrest in prostate cancer cells. Mutation Research, http://dx.doi.org/ 10.1016/ j.mrfmmm.2012.04.005. [DOI] [PubMed]
- 14. Kim JB, Yu JH, Ko E, Lee KW, Song AK, et al. (2010) The alkaloid Berberine inhibits the growth of Anoikis-resistant MCF-7 and MDA-MB-231 breast cancer cell lines by inducing cell cycle arrest. Phytomedicine 17: 436–440. [DOI] [PubMed] [Google Scholar]
- 15. Singh T, Vaid M, Katiyar N, Sharma S, Katiyar SK (2011) Berberine, an isoquinoline alkaloid, inhibits melanoma cancer cell migration by reducing the expressions of cyclooxygenase-2, prostaglandin E2 and prostaglandin E2 receptors. Carcinogenesis 32: 86–92. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 16. Kim HS, Kim MJ, Kim EJ, Yang Y, Lee MS, et al. (2012) Berberine-induced AMPK activation inhibits the metastatic potential of melanoma cells via reduction of ERK activity and COX-2 protein expression. Biochemical Pharmacology 83: 385–394. [DOI] [PubMed] [Google Scholar]
- 17. Lu BN, Hu MM, Liu KX, Peng JY (2010) Cytotoxicity of berberine on human cervical carcinoma HeLa cells through mitochondria, death receptor and MAPK pathways, and in-silico drug-target prediction. Toxicology in Vitro 24: 1482–1490. [DOI] [PubMed] [Google Scholar]
- 18. Patil JB, Kim J, Jayaprakasha GK (2010) Berberine induces apoptosis in breast cancer cells (MCF-7) through mitochondrial-dependent pathway. European J of Pharmacology 645: 70–78. [DOI] [PubMed] [Google Scholar]
- 19.Kim SM, Han JH, Lee SK, Choi MY, Kim JY, et al.. (2012) Berberine Suppresses the TPA-Induced MMP-1 and MMP-9 Expressions Through the Inhibition of PKC-a in Breast Cancer Cells. Journal of Surgical Research e1–e9. [DOI] [PubMed]
- 20. Hu J, Chai YS, Wang YG, Kheir MM, Li HY, et al. (2012) PI3K p55γ promoter activity enhancement is involved in the anti-apoptotic effect of berberine against cerebral ischemia–reperfusion. European J of Pharmacology 674: 132–142. [DOI] [PubMed] [Google Scholar]
- 21. Wang YG, Kheir MM, Chai YS, Hu J, Xing DM, et al. (2011) Comprehensive study in the inhibitory effect of berberine on gene transcription, including TATA box. PLoS One 6: e23495. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Lee CT, Zhong LW, Mace TA, Repasky EA (2012) Elevation in body temperature to fever range enhances and prolongs subsequent responsiveness of macrophages to endotoxin challenge. PLoS One 7: e30077. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Yudin Y, Rohacs T (2012) Regulation of TRPM8 channel activity. Molecular and Cellular Endocrinology 353: 68–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Milton AS, Wendlandt S (1971) Effects on body temperature of prostaglandings of the A, E and F on injection into the third ventricle of unanaesthetized cats and rabbits. J Physiol 218: 325–336. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Marais M, Maloney SK, Gray D (2011) The metabolic cost of fever in Peking ducks. Journal of Thermal Biology 36: 116–120. [Google Scholar]
- 26. Blondin DP, Péronnet F, Haman F (2010) Effects of ingesting [13C] glucose early or late into cold exposure on substrate Utilization. J Appl Physiol 109: 654–662. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Flouris AD, Cheung SS (2009) Influence of thermal balance on cold-induced vasodilation. J Appl Physiol 106: 1264–1271. [DOI] [PubMed] [Google Scholar]
- 28.Bharti S, Singh R, Kumar R, Malik S, Hussain T, et al. (2012) Hsp70 overexpression coordinately regulates myocardial hypertrophy, fibrosis and contractile function in 5-HT2B blockade mediated anti-hypertrophic effect. Biochimica et Biophysica Acta doi:10.1016/j.bbadis.2012.05.011. [DOI] [PubMed]
- 29. Koishi M, Yokota S, Mae T, Nishimura Y, Kanamori S, et al. (2001) The Effects of KNK437, a Novel Inhibitor of Heat Shock Protein Synthesis, on the Acquisition of Thermotolerance in a Murine Transplantable Tumor in Vivo. . Clinical Cancer Research 7: 215–219. [PubMed] [Google Scholar]
- 30. Kheir MM, Wang YG, Hua L, Hu J, Li LL, et al. (2010) Acute toxicity of berberine and its correlation with the blood concentration in mice. Food and Chemical Toxicology 48: 1105–1110. [DOI] [PubMed] [Google Scholar]
- 31. Du LJ, Yu L, Ma LY, Sun SM, Jin W (1997) Miningeal blood flow by incomplete reansient cerebral ischemia-reperfusion and the effect of nimodipine in mice. Chinese Pharmacological Bulletin 13: 223–226. [Google Scholar]
- 32. Hascoet M, Bourin M, Tertre ACD (1997) Influence of Prior Experience on Mice Behavior Using the Four-Plate Test. Pharmacology Biochemistry and Behavior 58: 1131–1138. [DOI] [PubMed] [Google Scholar]
- 33. Clark BJ, Hamilton DA, Whishaw IQ (2006) Motor activity (exploration) and formation of home bases in mice (C57BL/6) influenced by visual and tactile cues: Modification of movement distribution, distance, location, and speed. Physiology & Behavior 87: 805–816. [DOI] [PubMed] [Google Scholar]
- 34. Drai D, Kafkafi N, Benjamini Y, Elmer G, Golani I (2001) Rats and mice share common ethologically relevant parameters of exploratory behavior. Behavioural Brain Research 125: 133–140. [DOI] [PubMed] [Google Scholar]
- 35. Drai D, Benjamini Y, Golani I (2000) Statistical discrimination of natural modes of motion in rat exploratory behavior. Journal of Neuroscience Methods 96: 119–131. [DOI] [PubMed] [Google Scholar]
- 36. Fetsch CR, Heideman PD, Griffin JD (2006) Effects of melatonin on thermally classified anterior hypothalamic neurons in the white-footed mouse (Peromyscus leucopus). Journal of Thermal Biology 31: 40–49. [Google Scholar]
- 37.Cai CQ, Meng XJ, He JC, Wu HY, Zou F (2012) Effects of ZD7288 on firing pattern of thermosensitive neurons isolated from Hypothalamus. Neuroscience Letters 506: 336– 341. [DOI] [PubMed]
- 38. Küpeli E, Koşar M, Yeşilada E, Başer KHC, Başer CA (2002) comparative study on the anti-inflammatory, antinociceptive and antipyretic effects of isoquinoline alkaloids from the roots of Turkish Berberis species. Life Sciences 72: 645–657. [DOI] [PubMed] [Google Scholar]
- 39. Marais M, Maloney SK, Gray DA (2011) The metabolic cost of fever in Peking ducks. Journal of Thermal Biology 36: 116–120. [Google Scholar]
- 40. Bölcskei K, Horváth D, Szolcsányi J, Pethő G (2007) Heat injury-induced drop of the noxious heat threshold measured with an increasing-temperature water bath: A novel rat thermal hyperalgesia model. European J of Pharmacology 564: 80–87. [DOI] [PubMed] [Google Scholar]
- 41. Leon LR (2008) Thermoregulatory responses to environmental toxicants: The interaction of thermal stress and toxicant exposure. Toxicology and Applied Pharmacology 233: 146–161. [DOI] [PubMed] [Google Scholar]
- 42. Grosman B, Shaik OS, Helwig BG, Leon LR, Doyle FJ (2011) A physiological systems approach to modeling and resetting of mouse thermoregulation under heat stress. J Appl Physiol 111: 938–945. [DOI] [PubMed] [Google Scholar]
- 43. Leon LR, Gordon CJ, Helwig BG, Rufolo DM, Blaha MD (2010) Thermoregulatory, behavioral, and metabolic responses to heatstroke in a conscious mouse model. Am J Physiol Regul Integr Comp Physiol 299: R241–R248. [DOI] [PubMed] [Google Scholar]
- 44. Michel V, Peinnequin A, Alonso A, Buguet A, Cespuglio R, et al. (2007) Effect of glucocorticoid depletion on heat-induced Hsp70, IL-1β and TNF-α gene expression. Brain Research 1164: 63–71. [DOI] [PubMed] [Google Scholar]
- 45. Gong WJ, Golic KG (2006) Loss of Hsp70 in drosophila is pleiotropic, with effects on thermotolerance, recovery from heat shock and neurodegeneration. Genetics 172: 275–286. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Morrison SF, Nakamura K, Madden CJ (2008) Central control of thermogenesis in mammals. Exp Physiol 93 7: 773–797. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Mendoza KC, Griffin JD (2010) Thermoregulation. Encyclopedia of Behavioral Neuroscience 1: 400–404. [Google Scholar]
- 48. Kampinga HH, Craig EA (2010) The HSP70 chaperone machinery: J proteins as drivers of functional specificity. Nature Reviews: Molecular Cell Biology 11: 579–592. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 49. Vinkers CH, Groenink L, van Bogaert MJV, Westphal KGC, Kalkman CJ, et al. (2009) Stress-induced hyperthermia and infection-induced fever: Two of a kind? Physiology & Behavior 98: 37–43. [DOI] [PubMed] [Google Scholar]
- 50. Drai D, Glani I (2001) SEE: a tool for the visualization and analysis of rodent exploratory behavior. Neuroscience and biobehavioral reviews 25: 409–426. [DOI] [PubMed] [Google Scholar]