Skip to main content
NCBI home page
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2014 Jan 15.
Published in final edited form as: Cancer Res. 2012 Oct 29;73(2):706–715. doi: 10.1158/0008-5472.CAN-12-3270

Nitric Oxide Dependent Downregulation of BRCA1 Expression Promotes Genetic Instability

Vasily A Yakovlev 1
PMCID: PMC3549017  NIHMSID: NIHMS418628  PMID: 23108140

Abstract

Elevated levels of nitric oxide (NO) and reactive nitrogen species (RNS) may link inflammation to the initiation, promotion and progression of cancer. Traditionally this link has been thought to be mediated by the effects of NO/RNS in generating DNA damage. However, this damage also stimulates DNA repair responses with subsequent blocks to cell proliferation and apoptosis, thereby preventing accumulation of NO/RNS-generated mutations. In addressing this conundrum, I describe here an alternative mechanism for understanding mutagenesis by NO/RNS. Moderate NO/RNS concentrations stimulated mutagenesis not directly by generating DNA damage, but indirectly by modifying the activities of DNA repair and genome stability factors without affecting cell proliferation. NO/RNS at concentrations physiological relevant to inflammation stimulated PP2A activity, leading to dephosphorylation of RBL2, its accumulation in the nucleus and formation of RBL2/E2F4 complexes. RBL2/E2F4 formation in turn led to a shift in BRCA1 promoter occupancy from complexes containing activator E2F1 to complexes containing repressor E2F4, downregulating BRCA1 expression. By inhibiting BRCA1 expression, NO/RNS thereby reduces the ability of cells to repair DNA double-strand breaks through homologous recombination repair, increasing the involvement of error-prone nonhomologous end joining (NHEJ). In summary, NO/RNS stimulates genetic instability by inhibiting BRCA1-expression and shifting DNA repair from high-fidelity to error-prone mechanisms.

Keywords: chronic inflammation, nitric oxide, BRCA1, genetic instability

Introduction

Epidemiological evidence accumulating over the years has provided the positive correlation between cancer incidence and chronic inflammation (1), and it is now a well-recognized hallmark of cancer development (2–4).

Generation of nitric oxide/reactive nitrogen species (NO/RNS) by inducible nitric oxide synthase (iNOS) is a critical feature of the inflammatory environment (5). Several studies have established that NO/RNS production leads to inflammation-stimulated carcinogenesis by generating various types of direct DNA damage (6–9). However, the DNA damage induced at high concentrations of NO/RNS also stimulates DNA repair responses with a subsequent block of cell proliferation and activation of apoptosis (10, 11). This response prevents accumulation of NO/RNS-generated mutations in subsequent cell generations and is inherently anti-carcinogenic.

NO/RNS mediate cellular regulation through the posttranslational modifications of a number of regulatory proteins. The best studied of these modifications are S-nitrosylation (reversible oxidation of cysteine) (12–14) and tyrosine nitration (15–17). Although tyrosine nitration is usually associated with ischemia-reperfusion conditions, other physiological conditions including chronic inflammation able to stimulate NO/RNS generation and also modulate the activity of many signal transduction proteins. Jaiswal et al (8) reported NO/RNS-dependent inhibition of DNA repair during inflammatory conditions without, however, describing the exact mechanism. These results suggest that under chronic inflammatory conditions an alternative mechanism of NO/RNS-dependent mutagenesis occurs.

The loss of BRCA1 protein function predisposes to the development of breast and ovarian cancers (18). BRCA1 contributes to cell viability in multiple ways, including homologous recombination repair (HRR) of DNA double-strand break (DSB), cell cycle checkpoint control, mitotic spindle assembly, and regulation of chromosome segregation (19–21). The present work demonstrates that inflammatory-relevant concentrations of NO/RNS can inhibit BRCA1 expression without affecting the cell proliferation. This inhibition significantly reduced the ability of cells to repair DNA DSBs through HRR and resulted in a moderate increase of error-prone nonhomologous end joining (NHEJ). Hence, moderate concentrations of NO/RNS, concentrations that result in low amounts of cell toxicity, stimulate genetic instability by inhibiting BRCA1-expression and shifting DNA DSB repair from high-fidelity HRR to error-prone NHEJ.

Materials and Methods

Antibodies, reagents, siRNAs

Primary antibodies used included anti-β Tubulin and anti-PP2Aa (Cell Signaling); anti-E2F1, anti-PP2Ac, and anti-Nitrotyrosine (Millipore); anti-BRCA1 (Calbiochem), anti-E2F4 and anti-I-SceI (Santa Cruz Biotechnology); anti-RBL2 (BD Transduction Laboratories); anti-TBP (Abcam); anti-VCP/p97 (Thermo Scientific). NO-donors SNAP and DETA NONOate (DETA) were purchased from Cayman Chemical (Ann Arbor, MI). SNAP and DETA were decomposed by allowing oxidation to occur at 37°C for 7 days, and both decomposed NO-donors were used as additional negative controls. Okadaic acid was purchased from Fisher Scientific (Pittsburg, PA). siRNA FlexiTube mixtures (QIAGEN) for siRNA transfection included Hs_BRCA1_13 (SI02654575), Hs_RBL2_6 (SI02664473), Hs_E2F4_5 (SI02654694), and AllStars Negative Control (SI03650318). Transfections with siRNAs (25 nM unless a specific concentration was stated) were performed according to the manufacturer’s recommendations.

Cell culture, transfection, subcellular fractionation, immunoprecipitation, and adenovirus treatment

Non-tumorigenic human breast epithelial cells (MCF-10A), human lung adenocarcinoma epithelial cells (A549), and mouse leukemic monocyte macrophage cells (RAW264.7) were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA) and grown as recommended. All cell lines were used within 6 months after resuscitation. MCF-10A and RAW264.7 cells were co-cultured at a 1:1 ratio in MCF-10A-specific medium. Stable and transient transfections were performed with LipofectAMINE Plus (Invitrogen). Subcellular fractionation and immunoprecipitation were performed as previously described (22, 23). The Ad-SceI-NG adenovirus was a generous gift of Dr. Kristoffer Valerie (VCU, Massey Cancer Center, VA) and has been described previously (24). Adenovirus was added to culture medium at a 30 virus particles (VP)/cell and incubated while rocking for 4 h at 37°C. Virus was then removed and fresh medium was applied.

Western blotting

Proteins were separated by SDS-PAGE and transferred to nitrocellulose membranes. The membranes were exposed to antibodies at specific dilutions. Specific protein bands were detected using infrared-emitting conjugated secondary antibodies: anti-mouse 680 Alexa Fluor® (Molecular Probes, Eugene, OR) or anti-rabbit IRDye® 800 (Rockland Immunochemicals, Gilbertsville, PA), using the Odyssey Infrared Imaging System and the Application software version 2.0 from Li-Cor Biosciences.

Proliferation and phosphatase assays

Cells were plated in 96-well microplates at a density of 2×103 cells/well. After culture for 24 h, different amounts of NO-donors were added. WST-1 reagent was added at 24, 48, and 72 h after the start of NO-donor treatment, and absorbance at 450 nm was measured following the manufacturer’s instructions (Roche Molecular Systems) after 3 h of incubation.

The PP2A Immunoprecipitation Phosphatase Activity kit (Millipore) was used according to the manufacturer’s instructions to estimate of PP2A activity.

Detection of tyrosine nitration

After sorting by flow cytometry, MCF-10A cells were centrifuged at 2,500 rpm for 5 min, washed 3 times with ice-cold 1xPBS, counted, and 5x106 cells resuspended in 1 ml of the ice-cold lysis buffer (50 mM Tris-HCl [pH 7.4], 150 mM NaCl, 1% Triton X-100, 0.1% SDS, 2.5 mM EDTA, Halt Cocktail of protease inhibitors [Thermo Scientific]). Cell lysates were collected after centrifugation at 12,000 rpm for 20 min. Ten microliter of rabbit anti-nitrotyrosine Ab (Millipore) and 15 μl of protein A agarose (Sigma) were added to each sample for immunoprecipitation. Samples were incubated overnight at 4°C with continuous rotation. The protein A agarose beads were then washed, resuspended in 1x Laemmli buffer, and boiled for 5 min. Protein bands were then resolved by SDS-PAGE, after which Western blotting was performed with mouse anti-nitrotyrosine Ab (Millipore).

Fluorescence-based DSB Repair Assay and Flow Cytometry

The role of NO/RNS-dependent BRCA1 downregulation in DSB repair was studied using a green fluorescent protein (GFP)-based DSB repair system in MCF-10A and A549 cell lines as described previously (24, 25), 41) For more details of DSB assay and Flow Cytometry methods see Supplemental data and Supplemental Figures S1, S2.

NHEJ DRGFP-based assay

NHEJ events were detected by a PCR-based assay using GFP-primers directed to sites flanking the I-SceI restriction site. At different time-points after Ad-SceI-NG infection of MCF-10A/DRGFP cells (incubated with different concentrations of DETA), genomic DNA was isolated and used as a template for PCR with primers in a reaction volume of 50 μl. The sequences of primers were as follows: DRGFP-R – AAGTCGTGCTGCTTCATGTG; DRGFP-F – TTTGGCAAAGAATTCAGATCC. PCRs were performed by using the PCR 2xMaster Mix (Promega) with PCR Sprint Thermal Cycler (Thermo Scientific). After PCR amplification, a half-volume of PCR products was digested for 6 h at +37°C with 10 units of each of I-SceI and BcgI (NEB). The non-digested controls and digested samples were separated on a 1.5% agarose gel. Cleaved products constitute HRR and SSA, and DNA remaining after cleavage with I-SceI+BcgI represents NHEJ events.

DNA and RNA extraction, Real-time quantitative PCR

Total DNA was extracted using the DNeasy Blood & Tissue kit (QIAGEN). Total RNA was isolated from the cultured cells following the manufacturer’s instructions with the RNeasy kit (QIAGEN). cDNA samples from breast cancer cells were amplified in triplicate from the same starting material of total RNA following the manufacturer’s instructions (High-Capacity cDNA Reverse Transcription Kit; Applied Biosystems). Samples were amplified using TaqMan MGB FAM dye-labeled probes from Applied Biosystems in an ABI7900HT model real-time PCR machine. The following probes were used: Hs99999901_s1 (18S rRNA), Hs00173233_m1 (BRCA1).

Chromatin immunoprecipitation (ChIP) assay

The Chromatin immunoprecipitation (ChIP) assay kit (Millipore) was used following the manufacturer’s instructions. ChIP assay primers for the proximal region of BRCA1 promoter: BRCA1 F – GATTGGGACCTCTTCTTACG; BRCA1 R – TACCCAGAGCAGAGGGTGAA (26, 27). ChIP assay antibodies: E2F1 (clone KH20&KH95, Upstate Biotech), E2F4 (clone C-20, Santa Cruz), RBL2/p130 (clone C-20, Santa Cruz).

Results

Cell proliferation and NO/RNS concentrations

Previous reports show that NO/RNS production correlates with NO-donor concentrations and time of incubation (28). Measurements, using an NO-specific electrode, of actual NO concentrations during cell exposure to 125–500 μM of DETA indicated relatively constant NO concentrations in the 150–400 nM range (28–30). The NO concentrations produced in vivo at sites of colonic crypt chronic inflammation and airway inflammation were<300 nM and <400 nM respectively (29, 31). In comparison, normal in vivo NO concentrations in the absent of inflammation are unlikely to exceed 50 nM (32). Hence, production of NO from 50–350 μM DETA is comparable to those produced in vivo at sites of chronic inflammation.

MCF-10A and A549 were incubated with a range of concentrations of two different NO-donors, DETA (half-life 20h) and SNAP (half-life ~6h), to study the effects of physiologically relevant NO/RNS concentrations. At 24, 48, and 72 h of incubation, the level of cell proliferation was estimated by a WST-1 assay (Figure 1). Both NO-donors, in a dose range 20–100 μM, moderately stimulated proliferation. At concentrations of 200 μM or higher, the NO-donors were progressively more toxic and demonstrated dose-dependent inhibition of proliferation, which was consistent with a previous report (28). Hence, inflammatory-relevant concentrations of NO-donors can be divided into a low toxicity subgroup (50–200μM) and a high toxicity subgroup (200–350μM). Based on these results, subsequent experiments used 100–200μM SNAP or DETA.

Figure 1. MCF-10A and A549 cell proliferation as a function of NO-donor concentration.

Figure 1

Open in a new tab

Cells were incubated with different doses of SNAP or DETA and were assayed at 24, 48, and 72 h time-points using the WST-1 cell proliferation reagent. Experimental data are presented as the mean ± SD for quadruplicate samples.

RNS-dependent activation of PP2A, RBL2 dephosphorylation, and BRCA1 downregulation

Studies by Ohama et al recently demonstrated one mechanism for NO/RNS-dependent stimulation of PP2A activity (33). Tyrosine nitration of PP2Ac released the PP2Aa scaffolding subunit from the VCP/p97-PP2Ac complex thereby increasing PP2A enzymatic activity. In the present study, treatment of MCF-10A cells with exogenous NO/RNS donor SNAP also stimulated tyrosine nitration of the PP2Ac subunit (Figure 2A) and a dose-dependent dissociation of PP2Aa subunit from the PP2Ac-VCP/p97 complex (Figure 2B). The SNAP-induced PP2Ac nitration and PP2Aa dissociation from the PP2Ac-VCP/p97 complex stimulated PP2A activity as shown for both MCF-10A and A549 cells (Figure 2C). 100–200 μM of the decomposed SNAP did not affect PP2A activity (data not shown).

Figure 2. NO/RNS stimulate PP2A activity by tyrosine nitration on the c-subunit.

Figure 2

Open in a new tab

(A) Incubation with NO-donor SNAP simulates PP2Ac tyrosine nitration. MCF-10A cells were incubated with 100μM SNAP for 6 hours. PP2Ac tyrosine nitration was demonstrated by immunoprecipitation with anti-nitrotyrosine Ab and Western blotting with anti-PP2Ac Ab (top panel). Equal amounts of incubated and non-incubated (negative control) samples were blotted with anti-PP2Ac Ab and anti-β-tubulin Ab. (B) Incubation with SNAP leads to dissociation of the PP2Aa subunit from the VCP/p97-PP2Ac complex. MCF-10A cells were incubated with 50–100μM SNAP for 6 hours. After immunoprecipitation of cell lysates with anti-VCP/p97 Ab, Western blots were run with anti-VCP/p97, anti-PP2Aa, and anti-PP2Ac antibodies. (C) PP2A activities of MCF-10A and A549 cells incubated with 100μM SNAP for 6 hours were measured colorimetrically. Results are presented as the mean ± SD of 3 experiments. The P-value was calculated with the Student’s t-test.

It was previously reported that two members of E2F group, activating E2F1 and repressive E2F4, bind the BRCA1 proximal promoter (26, 27). Transcriptional regulation by these factors is dependent on their interactions with members of the Dp family of nuclear factors and with the hypophosphorylated forms of the repressive pocket proteins Rb, RBL1/p107, and RBL2/p130 (34, 35). Repression of BRCA1 is regulated via dephosphorylation of RBL2 with subsequent stimulation of RBL2/E2F4 repressive complex formation and increase of RBL2/E2F4 occupancy at the BRCA1 proximal promoter (26, 27, 36) The phosphorylation status of the RBL2 protein is regulated by PP2A (37). In the present work, I tested if NO/RNS-dependent stimulation of PP2A activity affects RBL2 phosphorylation and BRCA1 protein levels. After 6 hours of incubation, SNAP (100μM) stimulated significant RBL2 dephosphorylation and decreased BRCA1 protein expression in the MCF-10A and A549 cell lines (Figure 3A). The same regime of the treatment with decomposed SNAP did not affect RBL2 and BRCA1 proteins (data not shown). Incubation with the different doses of SNAP showed that RBL2 dephosphorylation and BRCA1 downregulation are dose-dependent (Supplemental Figure S3). No significant changes were observed in E2F1, E2F4, and PP2Ac protein expression after treatment with SNAP (Figure 3A).

Figure 3. RNS-dependent stimulation of PP2A activates RBL2/E2F4 inhibitory complex formation and blocks BRCA1 protein expression.

Figure 3

Open in a new tab

(A) Incubation of MCF-10A and A549 cells with 100μM SNAP for 6 h down-regulates RBL2 phosphorylation and decreases the total amount of BRCA1 protein. Total cell lysates were probed with antibodies against BRCA1, E2F1, E2F4, PP2Ac, total RBL2 (phosphorylated and non-phosphorylated forms), and β-tubulin. (B) Stimulation of endogenous iNOS in RAW264.7 cell lines leads to RBL2 dephosphorylation and BRCA1 downregulation in co-cultured MCF-10A cells. Co-cultured MCF-10A/RAW264.7 cell lines were incubated with 0.5μg/ml of LPS for 18 h. (C) Incubation with SNAP (100μM for 6 h) activates the RBL2/E2F4 inhibitory complex formation (upper blots) and increases accumulation of RBL2 and E2F4 proteins in the nuclear extract (bottom blots). (D) ChIP assays were performed with MCF-10A and A549 cells using antibodies to E2F1, E2F4, or RBL2 to determine BRCA1 proximal promoter occupancy by these factors after treatment with 100μM SNAP for 6 h. A representative agarose gel containing BRCA1 promoter amplification products obtained by PCR is shown. (E) qPCR analysis of endogenous BRCA1 expression in MCF-10A and A549 cells lines treated with 100μM SNAP for 6 h. BRCA1 expression was normalized to 18S mRNA expression and shown as a relative expression level. Data are presented as the mean ± SD of 3 experiments. The P-value was calculated with the Student’s t-test. (F) Schematic representation of NO/RNS-dependent inhibition of BRCA1 protein expression.

The same result was achieved by stimulation of the endogenous iNOS. MCF-10A and RAW264.7 cells were co-cultured, and iNOS in the RAW264.7 cells stimulated by incubation with 0.5μg/ml of lipopolysaccharide (LPS) for 18 h. After iNOS stimulation, RAW264.7 cells were labeled with anti-mouse F4/80 antibody and non-labeled MCF-10A cells were isolated by flow cytometry (Supplemental Figure S2). A sufficient amount of NO/RNS, produced by activated iNOS in RAW264.7 cells, stimulated total tyrosine nitration, RBL2 dephosphorylation, and BRCA1 protein downregulation in co-cultured MCF-10A cells (Figure 3B).

Stimulatory E2F1 and repressive E2F4 proteins simultaneously bind to the proximal BRCA1 promoter and regulate BRCA1 expression (27). E2F4 is a weak repressor in the absence of the pocket protein binding, RBL2 (34). RBL2 dephosphorylation and its nuclear accumulation leads to the formation of RBL2/E2F4 inhibitory complex, increasing E2F4 occupancy at the BRCA1 proximal promoter, resulting in a dynamic shift of promoter occupancy from stimulatory E2F1 to repressive E2F4 (26, 27). To test if NO/RNS-dependent RBL2 dephosphorylation stimulates the same effect, MCF-10A and A549 cells were incubated with 100μM SNAP for 6 h and nuclear extracts analyzed for RBL2/E2F4 complex formation, E2F1/E2F4 BRCA1 promoter occupancy, and BRCA1 mRNA expression. SNAP treatment stimulates significant RBL2 nuclear accumulation and RBL2/E2F4 inhibitory complex formation in both cell lines (Figure 3C). SNAP treatment also stimulated a moderate nuclear accumulation of E2F4 but with had no effect on E2F1 nuclear accumulation.

A chromatin immunoprecipitation (ChIP) assay was used to determine if the treatment with NO-donor induces changes in the binding activity of the E2F1, E2F4, and RBL2 proteins to the BRCA1 promoter. Following incubation with SNAP, ChIP assay results revealed a significant increase in promoter occupancy by RBL2 and E2F4 and a significant decrease in promoter occupancy by E2F1 (Figure 3D). These effects were observed in both MCF-10A and A549 cell lines.

To further elucidate the mechanism by which NO/RNS repress BRCA1 gene expression, mRNA levels of BRCA1 were measured after incubation with SNAP. Results of quantitative real-time polymerase chain reaction (qRT-PCR) showed decreases in BRCA1 mRNA expression of 2.5-fold (p=0.002) and 2.2-fold (p<0.001) respectively for the MCF-10A and A549 cell lines.

In summary, these data provide evidence for a mechanism of NO/RNS-dependent inhibition of BRCA1 gene expression. Figure 3F schematically illustrates this mechanism.

NO/RNS reduces HRR, but not NHEJ

To estimate the impact of RNS-dependent BRCA1 downregulation on the level of HRR and NHEJ, MCF-10A and A549 clones stably transfected with a DR-GFP reporter construct (MCF-10A/DRGFP and A549/DRGFP) were generated. The reporter construct and the fluorescence-based assay for measuring the frequency of HRR at a single chromosomal DSB have been described (25, 38), Supplemental Figure S1A). In cells incubated with different doses of an NO-donor, as well as in control cells, infection with an I-SceI expression adenovirus (Ad-SceI-NG) generates equal amount of I-SceI endonuclease (Supplemental Figure S4). I-SceI produces a DSB in the SceGFP sequence that can be repaired by two general mechanisms: HRR or NHEJ. In this assay, a functional GFP sequence can only be restored if the DSB is repaired in an error-free manner using the downstream GFP fragment (iGFP) as a template for HRR (39) (Supplemental Figures S1A, S1B). The percentage of GFP positive cells after infection with Ad-SceI-NG represents the level of HRR in the test.

Initially, I tested if downregulating BRCA1 expression by targeted siRNA inhibition also attenuated the level of HHR. MCF-10A/DRGFP cells were transfected with 12.5, 25, or 50nM of BRCA1 siRNA. Transfection with 50nM of non-specific siRNA was used as a positive control. BRCA1 protein levels were measured by Western blot 48 h after siRNA transfection (Supplemental Figure S1C). Cells were infected with Ad-SceI-NG 48 h and after transfection, and after an additional 48 h GFP expression was analyzed by flow cytometry. After transfection with BRCA1 siRNA, a dose-dependent decrease of HRR was observed, with a 9.4-fold decrease at 50nM of siRNA (Supplemental Figure S1D).

Next, HRR was then measured in MCF-10A/DRGFP and A549/DRGFP cells treated with NO-donors. Incubation with 100μM or 200μM of SNAP inhibited HRR 1.9-fold and 7.4-fold respectively for MCF-10A/DRGFP cells and 2.3-fold and 5.1-fold respectively for A549/DRGFP cells. Incubation with 100μM or 200μM of DETA was more effective at inhibiting HRR, with a 3.4-fold and 24.7-fold respective reduction in HRR for MCF-10A/DRGFP cells and a 2.7-fold and 20.9-fold respective reduction in HRR respectively for A549/DRGFP cells (Figure 4). Incubation with 100–200 μM of decomposed NO-donors (DETA or SNAP) did not affect HRR level in both cell lines (data not shown).

Figure 4. HRR level in MCF-10A/DRGFP and A549/DRGFP cells after treatment with NO-donors.

Figure 4

Open in a new tab

MCF-10A and A549 cell line were incubated at different doses of SNAP and DETA, and 8 hours after the start of the treatment, the cells were infected with Ad-SceI-NG adenovirus. After 48 h of infection, flow cytometry was used to determine the fraction of GFP+ cells in each sample. The amount of HRR was calculated as a percentage of the GFP+ cells in 50,000 cells counted. Non-treated cells infected with Ad-SceI-NG were used as a positive control. Non-treated non-infected cells were used as a negative control. Green numbers represent the level of HRR.

To determine if NHEJ is also affected by RNS, the DSB repair products were analyzed by a PCR assay (Figure 5A). MCF-10A/DRGFP cells were incubated with of DETA (100 μM or 200 μM) and 6h after the start of this incubation were infected with Ad-SceI-NG. At different time-points after Ad-SceI-NG infection, total DNA was extracted from the cells and the 590bp genomic region surrounding the I-SceI site in the DR-GFP construct was amplified by PCR. The PCR amplification products are indicative of the types of repair – for HRR, the I-SceI restriction site is replaced by BcgI site whereas the imprecise repair of NHEJ is characterized by the absence of restriction sites for I-SceI and BcgI (Figure 5A). To determine the level of NHEJ in each sample, the PCR amplification products were cleaved with I-SceI and BcgI (Figure 5B). For each sample, uncleaved 590bp DNA fragment represented the level of NHEJ repair, whereas 440bp cleaved DNA fragment represented the level of HRR and original DR-GFP construct in which DSB was not generated.

Figure 5. NHEJ level in MCF-10A/DRGFP cells after treatment with different doses of DETA.

Figure 5

Open in a new tab

(A) After expression of I-SceI in MCF-10A/DRGFP cells, repair of the DSB can proceed through HRR or NHEJ. The level of NHEJ is measured by PCR amplification and digestion with I-SceI and BcgI. The 590 bp DNA fragment in the I-SceI-digest represents the original PCR product amplified from cells that have undergone HRR or imprecise NHEJ. The 440 bp DNA fragment in the I-SceI+BcgI digest represents the product amplified from cells that have undergone HRR or from uncleaved original DR-GFP construct. The 590 bp band in the I-SceI+BcgI-digest represents the product amplified from cells that have undergone imprecise NHEJ and have lost both restriction sites. (B) NHEJ level (590 bp band) at different times following Ad-SceI-NG infection of MCF-10A/DRGFP cells incubated with different concentrations of DETA. Non-treated/non-infected cells were used as a negative control (top panel).

Cells incubated with DETA showed a higher level of NHEJ than did the non-treated controls. Not only did incubation with DETA increase the level of NHEJ, but also the rate of repair. At 12 h, both samples incubated with 100–200 μM of DETA showed significant levels of NHEJ, whereas in controls the first indication of NHEJ (uncleaved DNA fragment after restriction with I-SceI+BcgI) appeared at 24 h.

NO/RNS-stimulated RBL2 dephosphorylation and BRCA1 downregulation are cell cycle-independent

MCF10A cells were incubated with 100–200μM DETA and cell cycle distributions analyzed by flow cytometry (Figure 6). A 6 h incubation with 100μM or 200μM DETA resulted in moderate accumulations of G0-G1 cells (65.7% and 70.3% respectively vs 52.5% in control). After a 12 h with 100μM DETA or a 24h incubation with 200 μM DETA, the cells entered into S-phase. This was followed by G2/M accumulation at 24 h and 48 h after treatment with 100 and 200 μM DETA respectively.

Figure 6. Cell cycle analysis compared with phosphorylation status of RBL2 and total BRCA1 protein levels.

Figure 6

Open in a new tab

MCF-10A cells were incubated with different doses of DETA and analyzed at the different time-points of incubation. Cell cycle analysis, performed on one-half of each sample, was performed by flow cytometry on propidium iodide-stained cells. Another half of each sample used for blotting with anti-BRCA1 Ab, anti-RBL2 (total) Ab, and anti-β-tubulin Ab. Green color represents non-treated control; blue – 100μM of DETA; red – 200μM of DETA.

Both RBL2 dephosphorylation and BRCA1 expression downregulation were apparent by 6 h of incubation with 100μM or 200μM DETA and these effects continued throughout a 24 h of incubation at either DETA concentration (Figure 6). At the lower DETA concentration, BRCA1 expression and RBL2 phosphorylation levels returned to near normal by 48 h. At 200 μM DETA, the decreased BRCA1 expression and RBL2 phosphorylation persisted for at least 48h.

DETA-induced cell cycle re-distributions did not correlate with BRCA1 expression or RBL2 phosphorylation. For example, at the 12 h time point where cells accumulated in G1, BRCA1 expression and RBL2 phosphorylation were downregulated, whereas at 24 h BRCA1 expression inhibition and RBL2 dephosphorylation persisted with cells entering the S and G2/M cell cycle phases. The absence of any correlation with cell cycle phase is also apparent at the 48 h time-point after incubation with 200 μM DETA.

Inhibition of PP2A activity or RBL2/E2F4 proteins expression attenuates RNS-dependent BRCA1 downregulation

The above experiments indicate that RNS-dependent downregulation of BRCA1 expression pathway involves three the proteins PP2A, RBL2, and E2F4. Hence, blocking the activity or expression of the one of these proteins should inhibit the whole pathway and prevent RNS-dependent BRCA1 downregulation.

To determine if inhibiting PP2A activity abrogates NO/RNS-dependent BRCA1 downregulation, MCF-10A cells were pre-incubated with 0.3 nM Okadaic acid (OA) (2 h before the start of incubation with SNAP). Although OA is a specific inhibitor of both PP2A and PP1, at this dose OA selectively inhibits the activity of PP2A. Pre-incubation with OA inhibited SNAP-stimulated dephosphorylation of RBL2 and downregulation of BRCA1 (Figure 7A). Targeted siRNA inhibition of RBL2 or E2F4 expression also prevented SNAP-dependent BRCA1 downregulation (Figure 7B, 7C).

Figure 7. Inhibition of RBL2 expression, E2F4 proteins expression, or PP2A activity blocks NO/RNS-dependent downregulation of BRCA1 protein expression and reduction of HRR.

Figure 7

Open in a new tab

(A) Pretreatment of MCF-10A cells with 0.3 nM Okadaic acid prevents down-regulation of BRCA1 protein expression after treatment with SNAP (100μM for 6 hours). (B–C) Blocking of RBL2 or E2F4 expression by siRNA transfection prevents down-regulation of BRCA1 protein expression after treatment with SNAP (100μM for 6 h). (D) Blocking of RBL2 or E2F4 expression by siRNA transfection prevents the decrease of HRR after incubation with SNAP. MCF-10A cells were pre-incubated with 100μM SNAP and infected with Ad-SceI-NG adenovirus. After 48 h of infection, flow cytometry was used to calculate the fraction of GFP+ cells in 50,000 cells. The graph represents the non-treated control/SNAP-treated ratio of the GFP+ cells in each sample. Results are presented as the mean± SD of 3 experiments. ** P< 0.001; *** P = 0.002. P-values were calculated with the Student t-test.

Subsequent experiments tested whether attenuation of NO/RNS-dependent BRCA1 down-regulation prevented reduction of HRR. MCF-10A/DRGFP cells were transfected either with control-siRNA, RBL2 siRNA, or E2F4 siRNA. Incubation with 100μM SNAP was started 24 h after transfection, and the cells analyzed for HRR as described above (Figure 7). Cells transfected with control siRNA showed a 2.6-fold decrease of HRR level after incubation with SNAP compared with cells not treated with SNAP. Cells transfected with RBL2 siRNA showed a 1.2-fold decrease (p<0.001) of HRR level after incubation with SNAP compared to untreated controls. Cells transfected with E2F4 siRNA showed a 1.4-fold decrease (p=0.002) of HRR level after incubation with SNAP relative to untreated controls. In summary, these data demonstrate that PP2A inhibition, or the blocking of RBL2 or E2F4 expression inhibits NO/RNS-dependent BRCA1 downregulation, thereby preventing the NO/RNS-dependent decrease in HRR.

Discussion

The generation of NO/RNS under inflammatory conditions provides a critical link between inflammation and cancer initiation, promotion, and progression (6, 32). NO/RNS production is often associated with contradictory effects on cell proliferation and cytotoxicity, variably promoting and inhibiting apoptosis in normal and tumor cells (10, 40, 41). Wink and coworkers have examined these contradictory observations and have proposed a set of five graduated levels of NO/RNS cellular responses that range from the promotion of cell survival and proliferation at low concentrations of NO/RNS to the promotion of cell cycle arrest and apoptosis at high concentrations of NO/RNS (10).

While high concentrations of NO/RNS can cause direct DNA damage and stimulate DNA DSB, there is an emerging appreciation for determining the role of lower NO/RNS concentrations in signaling pathways related to apoptosis, cell cycle and other facets of cell functions. The present work demonstrates a mechanism whereby inflammatory relevant, low concentrations of NO/RNS inhibit of BRCA1 expression without affecting cell proliferation. This inhibition of BRCA1 expression significantly reduces the ability of cells to fix the DNA DSB through HRR with a moderate increase of error-prone NHEJ. Hence, inflammatory relevant concentrations of NO/RNS (associated with low cell toxicity and lack of interference with cell proliferation) stimulate genetic instability by inhibiting BRCA1 expression and shifting DNA DSB repair from high-fidelity HRR to error-prone NHEJ.

The key step of the mechanism described in the present work is the dephosphorylation of the RBL2 protein and the subsequent formation of the RBL2/E2F4 inhibitory complex. The RBL2/E2F4 complex has been previously shown to bind to the promoters of cell cycle-dependent genes and to suppress cell proliferation (42). However, to be able to suppress cell proliferation, RBL2 and E2F4 proteins have to be assembled into the DREAM complex with DP1 and five MuvB-like proteins (43). In contrast, the present paper demonstrates that formation of RBL2/E2F4 does not affect the cell cycle. Hence, it is possible that low toxic NO/RNS concentrations stimulate formation of RBL2/E2F4 inhibitory complex without its recruitment into the DREAM complex. Future investigations might shed light on how different concentrations of NO/RNS affect the DREAM complex formation.

The proposed model of NO/RNS-generated genetic instability is not restricted to the inflammatory environment. Different types of NOSs are activated after ionizing radiation (IR), and under hypoxia (44, 45). PP2A activation and stimulation of RBL2/E2F4 inhibitory complex formation were also shown after IR and under hypoxia (26, 27, 46). Aging, another condition connected to carcinogenesis, is also characterized by increased activity of NOSs and total protein nitration (47). Further investigation should determine if all these states (IR, hypoxia, and aging), which are critical for carcinogenesis and tumor development, have decreased genetic stability modulated through the same mechanism described in the present paper.

Supplementary Material

1

Acknowledgments

The author thanks Kevin T. Hogan and Heidi Sankala for editorial assistance with the manuscript. This work supported by grant #IRG-73-001-37 from the American Cancer Society, partially supported by RO1 CA 90881-08 from the NCI, and also partially supported from the Flow Cytometry Core NIH grant P30CA16059.

Footnotes

Conflicts of interest: The author has no conflicts of interest.

References

  • 1.Bouvard V, Baan R, Straif K, Grosse Y, Secretan B, El Ghissassi F, et al. A review of human carcinogens--Part B: biological agents. The lancet oncology. 2009;10:321–2. doi: 10.1016/s1470-2045(09)70096-8. [DOI] [PubMed] [Google Scholar]
  • 2.Coussens LM, Werb Z. Inflammation and cancer. Nature. 2002;420:860–7. doi: 10.1038/nature01322. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Balkwill F, Charles KA, Mantovani A. Smoldering and polarized inflammation in the initiation and promotion of malignant disease. Cancer cell. 2005;7:211–7. doi: 10.1016/j.ccr.2005.02.013. [DOI] [PubMed] [Google Scholar]
  • 4.Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell. 2011;144:646–74. doi: 10.1016/j.cell.2011.02.013. [DOI] [PubMed] [Google Scholar]
  • 5.Vane JR, Mitchell JA, Appleton I, Tomlinson A, Bishop-Bailey D, Croxtall J, et al. Inducible isoforms of cyclooxygenase and nitric-oxide synthase in inflammation. Proceedings of the National Academy of Sciences of the United States of America. 1994;91:2046–50. doi: 10.1073/pnas.91.6.2046. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Hussain SP, He P, Subleski J, Hofseth LJ, Trivers GE, Mechanic L, et al. Nitric oxide is a key component in inflammation-accelerated tumorigenesis. Cancer research. 2008;68:7130–6. doi: 10.1158/0008-5472.CAN-08-0410. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Wink DA, Kasprzak KS, Maragos CM, Elespuru RK, Misra M, Dunams TM, et al. DNA deaminating ability and genotoxicity of nitric oxide and its progenitors. Science. 1991;254:1001–3. doi: 10.1126/science.1948068. [DOI] [PubMed] [Google Scholar]
  • 8.Jaiswal M, LaRusso NF, Burgart LJ, Gores GJ. Inflammatory cytokines induce DNA damage and inhibit DNA repair in cholangiocarcinoma cells by a nitric oxide-dependent mechanism. Cancer research. 2000;60:184–90. [PubMed] [Google Scholar]
  • 9.Nguyen T, Brunson D, Crespi CL, Penman BW, Wishnok JS, Tannenbaum SR. DNA damage and mutation in human cells exposed to nitric oxide in vitro. Proceedings of the National Academy of Sciences of the United States of America. 1992;89:3030–4. doi: 10.1073/pnas.89.7.3030. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Thomas DD, Ridnour LA, Isenberg JS, Flores-Santana W, Switzer CH, Donzelli S, et al. The chemical biology of nitric oxide: implications in cellular signaling. Free Radic Biol Med. 2008;45:18–31. doi: 10.1016/j.freeradbiomed.2008.03.020. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Nakano T, Katafuchi A, Shimizu R, Terato H, Suzuki T, Tauchi H, et al. Repair activity of base and nucleotide excision repair enzymes for guanine lesions induced by nitrosative stress. Nucleic acids research. 2005;33:2181–91. doi: 10.1093/nar/gki513. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Stamler JS, Simon DI, Osborne JA, Mullins ME, Jaraki O, Michel T, et al. S-nitrosylation of proteins with nitric oxide: synthesis and characterization of biologically active compounds. Proceedings of the National Academy of Sciences of the United States of America. 1992;89:444–8. doi: 10.1073/pnas.89.1.444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Stamler JS, Meissner G. Physiology of nitric oxide in skeletal muscle. Physiol Rev. 2001;81:209–37. doi: 10.1152/physrev.2001.81.1.209. [DOI] [PubMed] [Google Scholar]
  • 14.Mikkelsen RB, Wardman P. Biological chemistry of reactive oxygen and nitrogen and radiation-induced signal transduction mechanisms. Oncogene. 2003;22:5734–54. doi: 10.1038/sj.onc.1206663. [DOI] [PubMed] [Google Scholar]
  • 15.Souza JM, Peluffo G, Radi R. Protein tyrosine nitration--functional alteration or just a biomarker? Free Radic Biol Med. 2008;45:357–66. doi: 10.1016/j.freeradbiomed.2008.04.010. [DOI] [PubMed] [Google Scholar]
  • 16.Radi R. Nitric oxide, oxidants, and protein tyrosine nitration. Proceedings of the National Academy of Sciences of the United States of America. 2004;101:4003–8. doi: 10.1073/pnas.0307446101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Yakovlev VA, Mikkelsen RB. Protein tyrosine nitration in cellular signal transduction pathways. J Recept Signal Transduct Res. 2010;30:420–9. doi: 10.3109/10799893.2010.513991. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Miki Y, Swensen J, Shattuck-Eidens D, Futreal PA, Harshman K, Tavtigian S, et al. A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1. Science. 1994;266:66–71. doi: 10.1126/science.7545954. [DOI] [PubMed] [Google Scholar]
  • 19.Venkitaraman AR. Cancer susceptibility and the functions of BRCA1 and BRCA2. Cell. 2002;108:171–82. doi: 10.1016/s0092-8674(02)00615-3. [DOI] [PubMed] [Google Scholar]
  • 20.Lou Z, Minter-Dykhouse K, Chen J. BRCA1 participates in DNA decatenation. Nat Struct Mol Biol. 2005;12:589–93. doi: 10.1038/nsmb953. [DOI] [PubMed] [Google Scholar]
  • 21.Joukov V, Groen AC, Prokhorova T, Gerson R, White E, Rodriguez A, et al. The BRCA1/BARD1 heterodimer modulates ran-dependent mitotic spindle assembly. Cell. 2006;127:539–52. doi: 10.1016/j.cell.2006.08.053. [DOI] [PubMed] [Google Scholar]
  • 22.Barrett DM, Black SM, Todor H, Schmidt-Ullrich RK, Dawson KS, Mikkelsen RB. Inhibition of protein-tyrosine phosphatases by mild oxidative stresses is dependent on S-nitrosylation. The Journal of biological chemistry. 2005;280:14453–61. doi: 10.1074/jbc.M411523200. [DOI] [PubMed] [Google Scholar]
  • 23.Yakovlev VA, Barani IJ, Rabender CS, Black SM, Leach JK, Graves PR, et al. Tyrosine nitration of IkappaBalpha: a novel mechanism for NF-kappaB activation. Biochemistry. 2007;46:11671–83. doi: 10.1021/bi701107z. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.Anglana M, Bacchetti S. Construction of a recombinant adenovirus for efficient delivery of the I-SceI yeast endonuclease to human cells and its application in the in vivo cleavage of chromosomes to expose new potential telomeres. Nucleic acids research. 1999;27:4276–81. doi: 10.1093/nar/27.21.4276. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Pierce AJ, Johnson RD, Thompson LH, Jasin M. XRCC3 promotes homology-directed repair of DNA damage in mammalian cells. Genes & development. 1999;13:2633–8. doi: 10.1101/gad.13.20.2633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Bindra RS, Glazer PM. Repression of RAD51 gene expression by E2F4/p130 complexes in hypoxia. Oncogene. 2007;26:2048–57. doi: 10.1038/sj.onc.1210001. [DOI] [PubMed] [Google Scholar]
  • 27.Bindra RS, Gibson SL, Meng A, Westermark U, Jasin M, Pierce AJ, et al. Hypoxia-induced down-regulation of BRCA1 expression by E2Fs. Cancer research. 2005;65:11597–604. doi: 10.1158/0008-5472.CAN-05-2119. [DOI] [PubMed] [Google Scholar]
  • 28.Wei L, Gravitt PE, Song H, Maldonado AM, Ozbun MA. Nitric oxide induces early viral transcription coincident with increased DNA damage and mutation rates in human papillomavirus-infected cells. Cancer research. 2009;69:4878–84. doi: 10.1158/0008-5472.CAN-08-4695. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Bove PF, Hristova M, Wesley UV, Olson N, Lounsbury KM, van der Vliet A. Inflammatory levels of nitric oxide inhibit airway epithelial cell migration by inhibition of the kinase ERK1/2 and activation of hypoxia-inducible factor-1 alpha. The Journal of biological chemistry. 2008;283:17919–28. doi: 10.1074/jbc.M709914200. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Thomas DD, Espey MG, Ridnour LA, Hofseth LJ, Mancardi D, Harris CC, et al. Hypoxic inducible factor 1alpha, extracellular signal-regulated kinase, and p53 are regulated by distinct threshold concentrations of nitric oxide. Proceedings of the National Academy of Sciences of the United States of America. 2004;101:8894–9. doi: 10.1073/pnas.0400453101. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Chin MP, Schauer DB, Deen WM. Prediction of nitric oxide concentrations in colonic crypts during inflammation. Nitric Oxide. 2008;19:266–75. doi: 10.1016/j.niox.2008.04.025. [DOI] [PubMed] [Google Scholar]
  • 32.Lala PK, Chakraborty C. Role of nitric oxide in carcinogenesis and tumour progression. The lancet oncology. 2001;2:149–56. doi: 10.1016/S1470-2045(00)00256-4. [DOI] [PubMed] [Google Scholar]
  • 33.Ohama T, Brautigan DL. Endotoxin conditioning induces VCP/p97-mediated and inducible nitric-oxide synthase-dependent Tyr284 nitration in protein phosphatase 2A. The Journal of biological chemistry. 2010;285:8711–8. doi: 10.1074/jbc.M109.099788. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Classon M, Dyson N. p107 and p130: versatile proteins with interesting pockets. Exp Cell Res. 2001;264:135–47. doi: 10.1006/excr.2000.5135. [DOI] [PubMed] [Google Scholar]
  • 35.Dimova DK, Dyson NJ. The E2F transcriptional network: old acquaintances with new faces. Oncogene. 2005;24:2810–26. doi: 10.1038/sj.onc.1208612. [DOI] [PubMed] [Google Scholar]
  • 36.Hegan DC, Lu Y, Stachelek GC, Crosby ME, Bindra RS, Glazer PM. Inhibition of poly(ADP-ribose) polymerase down-regulates BRCA1 and RAD51 in a pathway mediated by E2F4 and p130. Proceedings of the National Academy of Sciences of the United States of America. 2010;107:2201–6. doi: 10.1073/pnas.0904783107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Vuocolo S, Purev E, Zhang D, Bartek J, Hansen K, Soprano DR, et al. Protein phosphatase 2A associates with Rb2/p130 and mediates retinoic acid-induced growth suppression of ovarian carcinoma cells. The Journal of biological chemistry. 2003;278:41881–9. doi: 10.1074/jbc.M302715200. [DOI] [PubMed] [Google Scholar]
  • 38.Pierce AJ, Hu P, Han M, Ellis N, Jasin M. Ku DNA end-binding protein modulates homologous repair of double-strand breaks in mammalian cells. Genes & development. 2001;15:3237–42. doi: 10.1101/gad.946401. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Stark JM, Pierce AJ, Oh J, Pastink A, Jasin M. Genetic steps of mammalian homologous repair with distinct mutagenic consequences. Molecular and cellular biology. 2004;24:9305–16. doi: 10.1128/MCB.24.21.9305-9316.2004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Wink DA, Ridnour LA, Hussain SP, Harris CC. The reemergence of nitric oxide and cancer. Nitric Oxide. 2008;19:65–7. doi: 10.1016/j.niox.2008.05.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Wink DA, Mitchell JB. Nitric oxide and cancer: an introduction. Free Radic Biol Med. 2003;34:951–4. doi: 10.1016/s0891-5849(02)01362-x. [DOI] [PubMed] [Google Scholar]
  • 42.Cam H, Balciunaite E, Blais A, Spektor A, Scarpulla RC, Young R, et al. A common set of gene regulatory networks links metabolism and growth inhibition. Molecular cell. 2004;16:399–411. doi: 10.1016/j.molcel.2004.09.037. [DOI] [PubMed] [Google Scholar]
  • 43.Litovchick L, Florens LA, Swanson SK, Washburn MP, DeCaprio JA. DYRK1A protein kinase promotes quiescence and senescence through DREAM complex assembly. Genes & development. 2011;25:801–13. doi: 10.1101/gad.2034211. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Leach JK, Black SM, Schmidt-Ullrich RK, Mikkelsen RB. Activation of constitutive nitric-oxide synthase activity is an early signaling event induced by ionizing radiation. The Journal of biological chemistry. 2002;277:15400–6. doi: 10.1074/jbc.M110309200. [DOI] [PubMed] [Google Scholar]
  • 45.Melillo G, Musso T, Sica A, Taylor LS, Cox GW, Varesio L. A hypoxia-responsive element mediates a novel pathway of activation of the inducible nitric oxide synthase promoter. The Journal of experimental medicine. 1995;182:1683–93. doi: 10.1084/jem.182.6.1683. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.DuPree EL, Mazumder S, Almasan A. Genotoxic stress induces expression of E2F4, leading to its association with p130 in prostate carcinoma cells. Cancer research. 2004;64:4390–3. doi: 10.1158/0008-5472.CAN-03-3695. [DOI] [PubMed] [Google Scholar]
  • 47.Drew B, Leeuwenburgh C. Aging and the role of reactive nitrogen species. Annals of the New York Academy of Sciences. 2002;959:66–81. doi: 10.1111/j.1749-6632.2002.tb02084.x. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

1
NIHMS418628-supplement-1.pdf (2.8MB, pdf)

RESOURCES