Skip to main content
Antimicrobial Agents and Chemotherapy logoLink to Antimicrobial Agents and Chemotherapy
. 2013 Feb;57(2):833–839. doi: 10.1128/AAC.01006-12

Mefloquine Exposure Induces Cell Cycle Delay and Reveals Stage-Specific Expression of the pfmdr1 Gene

Elaine B Bohórquez a, Jonathan J Juliano b, Hyung-Suk Kim c, Steven R Meshnick a,✉
PMCID: PMC3553685  PMID: 23208721

Abstract

Drug-resistant Plasmodium falciparum malaria is a major public health problem. An elevated pfmdr1 gene copy number (CN) is known to decrease parasite sensitivity to the commonly used antimalarial mefloquine (MFQ). To understand the relationship between pfmdr1 CN and mefloquine resistance, we evaluated pfmdr1 transcript levels in three P. falciparum strains with different CNs in the presence and absence of MFQ. Parasite strains with multiple pfmdr1 gene copies exhibited higher relative transcript levels than single-copy parasites, and MFQ induced pfmdr1 expression above the levels without treatment in all three strains evaluated. Concomitant morphology analyses of the sampled cultures revealed that MFQ treatment of synchronized ring-stage parasites induced a delay in parasite maturation through the intraerythrocytic cycle. pfmdr1 expression peaks in the ring stage, and MFQ could be causing increased transcription by delaying parasite maturation. However, pretreatment with mefloquine did not affect the artemisinin in vitro half-maximal inhibitory concentration (IC50). These results suggest that MFQ-induced increases in pfmdr1 expression are the direct result of the maturation delay at the ring stage but that this change in expression does not affect the antimalarial activity of artemisinin.

INTRODUCTION

With 225 million estimated clinical infections that result in 781,000 deaths annually, the protozoan Plasmodium falciparum causes the most severe form of malaria (1). Efforts to control malaria have been hampered by the development of resistance to antimalarials such as chloroquine (CQ), sulfadoxine-pyrimethamine, and mefloquine (MFQ). Artemisinin-based combination therapies (ACT) are now the first-line treatment for P. falciparum malaria. Unfortunately, resistance to these new drugs is believed to be developing, based on the observation of slower in vivo parasite clearance times (2–4). The molecular basis for resistance is unclear; thus, a better understanding of the ACT resistance mechanism is needed.

Early investigations into antimalarial resistance led to the identification of a malaria homolog to the mammalian multidrug resistance gene (5–7). The P. falciparum multidrug resistance gene (pfmdr1) encodes an ATP-binding cassette protein called P-glycoprotein homolog 1 (Pgh1), which is located on the parasite food vacuole membrane (6) and functions as a transporter (8). The transporter function of Pgh1 couples ATP hydrolysis with solute import into the food vacuole (9). The pfmdr1 gene has been identified as a possible modulator of resistance to a number of antimalarials (10), and the Pgh1 protein has also been implicated as a specific target of antimalarial drugs, such as MFQ (11). Substantial data support a relationship between the pfmdr1 gene and MFQ resistance both in vitro and in vivo (12–21). Specifically, an abundance of in vitro and clinical data link higher pfmdr1 gene copy number and expression with reduced parasite susceptibility to drugs such as quinine (QN), MFQ, and, more recently, artemisinin (9, 12, 13, 16, 20–28).

The control of pfmdr1 gene expression is only partially understood. MFQ-resistant field isolates with higher pfmdr1 copy numbers overexpress the transcript compared to isolates with a single copy of pfmdr1 (8, 29), indicating a direct correlation where the presence of more gene copies results in higher constitutive expression. Expression may also be inducible; a recent study demonstrated higher pfmdr1 transcript levels in a strain bearing a single pfmdr1 gene copy after treatment with CQ, MFQ, and QN (30). This suggests that exposure to quinoline drugs can induce pfmdr1 expression and thereby possibly augment resistance to antimalarials such as artemisinin and its derivatives. This is of particular importance because artesunate-mefloquine is a common ACT. In this study, we sought to expand on these observations to better understand the mechanism of pfmdr1 induction and how this might affect parasite sensitivity to artemisinins.

MATERIALS AND METHODS

Parasite cultivation.

We used P. falciparum cultures of three clonal parasite lines obtained from the Malaria Research and Reference Reagent Resource Center (MR4) (Manassas, VA): (i) 3D7, which has one pfmdr1 copy and is sensitive to CQ and MFQ; (ii) FCB, which has 2 copies and is CQ resistant and MFQ sensitive; and (iii) Dd2, which has 4 pfmdr1 copies and is resistant to CQ and MFQ. Parasite cultures were maintained at 37°C using the standard Trager-Jenson method for malaria parasite culture (31). Pooled human type O+ serum at 10% and red blood cells (Research Blood Components, LLC, Boston, MA) at 2% hematocrit were used for all cultures and experimental conditions. Cultures were synchronized with 5% sorbitol solution every 48 h for three consecutive life cycles to obtain a uniform culture of parasites at a single stage (32).

Gene expression analysis.

Sorbitol-synchronized ring-stage parasites were exposed to 100 ng/ml MFQ for 48 h. Total RNA was isolated from cultures at 0, 6, 12, 24, and 48 h after addition of drug using TriReagent (Molecular Research Center, Inc., Cincinnati, OH), according to the manufacturer's instructions. Real-time reverse transcriptase PCR (RT-PCR) was employed to assess relative pfmdr1 (the reference identification number for pfmdr1 from the Plasmodium Genomics Database [PlasmoDB] is PFE1150w) mRNA levels between parasite lineages using the ΔΔCT analysis, as previously described (33). The threshold cycle (CT) value represents the PCR cycle at which DNA amplification crosses the threshold value. The ΔCT for each sample is defined as CTpfmdr1 − CTpfldh. Differences in pfmdr1 gene expression for untreated cultures were compared to expression from single-copy 3D7 untreated cultures. Differences in pfmdr1 expression for mefloquine-treated cultures were compared to the corresponding untreated culture of the same strain. In experiments involving drug exposure, untreated cultures were used as the negative control, and atovaquone (ATQ) (1 μM)-treated cultures were used to control for effects on gene expression due to the addition to the culture medium of a drug with a known site of action distinct from the pfmdr1-encoded protein. Expression of the developmentally regulated trophozoite antigen R45-like gene (PlasmoDB no. PFD1175w) (tar45-like gene), which is transcribed during the ring stage only, was assessed using a SYBR green assay as previously described (34). The single-copy P. falciparum lactate dehydrogenase gene (PlasmoDB no. PF13-0141), pfldh, was used as the reference gene for analysis.

The primers and fluorescent probes for pfmdr1 were designed using ABI's Primer Express software and are as follows (5′ to 3′): (i) pfmdr1 forward primer, TGCCCACAGAATTGCATCTATAA; (ii) pfmdr1 reverse primer, GACTGTACAAAGGTTCCATTTCGA; and (iii) pfmdr1 probe, 6-carboxyfluorescein (FAM)-ACGATCAGACAAAATT-MGB. The published primers and fluorescent probes for the pfldh and tar45-like genes (34) were as follows (5′ to 3′): (i) pfldh forward primer, ACGATTTGGCTGGAGCAGAT; (ii) pfldh reverse primer, TCTCTATTCCATTCTTTGTCACTCTTTC; (iii) pfldh probe, FAM-AGTAATAGTAACAGCTGGATTTACCAAGGCCCCA-6-carboxytetramethylrhodamine (TAMRA); (iv) tar45-like gene forward primer, ACGAGCTGACCCACCAAA; and (v) tar45-like gene reverse primer, CATTTAAGTCTGTCTTCATTCTACTTCT. Real-time RT-PCR amplifications were performed in a 96-well plate in the ABI Prism 7700 sequence detection system in a total volume of 30 μl (100 ng RNA plus PCR mixture to reach a total volume of 30 μl). Each real-time RT-PCR amplification was performed in duplicate using a previously reported method that combines cDNA synthesis and real-time PCR in one reaction: 30 min at 48°C for the RT reaction and then 10 min at 94°C, followed by a total of 40 PCR cycles (15 s at 94°C and 1 min at 60°C) (33). During the amplification, the fluorescence of FAM, TAMRA, and ROX (a passive reference dye) was measured by the 7700 sequence detector in each well of the 96-well plate. All experiments were conducted a minimum of 3 times for statistical analysis.

Morphology analysis.

Thin blood smears were prepared and stained with Giemsa stain (Sigma-Aldrich Co., St. Louis, MO) at 0, 6, 12, 24, and 48 h after the addition of MFQ. Parasitemia and parasite morphology were assessed via light microscopy. Parasitemia was calculated as the number of parasitized red blood cells per 1,000 total red blood cells. Morphology was examined and the number of parasites at each asexual blood stage was assessed for a minimum of 100 parasites. Parasite morphologies were classified as follows: (i) parasites with a single nucleus and characteristic ring appearance were classified as rings, (ii) parasites containing a single nucleus and hemozoin were considered trophozoites, and (iii) multinucleated parasites with ample hemozoin represented schizonts.

IC50 determinations.

Parasite drug susceptibility was determined using a modification of a published SYBR green I flow cytometry assay (35). The drug concentration required to inhibit 50% of parasite growth (IC50) was calculated using the sigmoidal dose-response nonlinear regression equation in GraphPad Prism software.

Statistical analysis.

Each experiment was conducted a minimum of three times for statistical analysis. All statistical analyses were conducted on the raw data (ΔCT) for each condition using JMP software (SAS Institute, Inc., Cary, NC). Tukey's test was used to determine significant differences at a P value of ≤0.05 between the parasite strains because significance is determined for all possible pairwise comparisons of the three strains. Student's t test was used to determine significant differences at a P value of ≤0.05 between untreated and drug-treated expression levels.

RESULTS

pfmdr1 expression is proportional to copy number in untreated parasites.

Synchronized parasites from three clonal strains of P. falciparum with different pfmdr1 gene copy numbers were cultured for 24 h and sampled at 0, 6, 12, and 24 h. pfmdr1 gene expression increased proportionally with the number of pfmdr1 gene copies present in the parasite at all time points: Dd2 parasites (four pfmdr1 gene copies) had 3- to 8-times-higher expression levels than 3D7 (one copy), while FCB (two copies) had 2- to 3-fold-higher levels of expression than 3D7, (Fig. 1). The differences between Dd2 and 3D7 are significant (P < 0.05) throughout the 24-hour time period; the difference between FCB and 3D7 was significant only at the 0 h time point. The results indicate that there is a direct relationship between pfmdr1 copy number and expression of the pfmdr1 transcript.

Fig 1.

Fig 1

Fold differences in pfmdr1 gene expression over time in parasite strains with different pfmdr1 copy numbers. Transcript levels of pfmdr1 relative to the single-copy P. falciparum lactate dehydrogenase gene were evaluated over time following synchronization using real-time RT-PCR. Fold differences in pfmdr1 expression are relative to 3D7 expression at each time point (not shown), which was set to 1 (black line). Parasite strains with more than one pfmdr1 copy had higher levels of transcript than single-copy 3D7 parasites. These results were significant for Dd2 through the 24-hour time point. Results are from 6 independent experiments. Statistics were done on the raw data (ΔCT) at each time point. *, P < 0.05 by Tukey's test.

Mefloquine exposure causes increased pfmdr1 gene expression.

Our results show that, compared with pfmdr1 transcript levels in the respective untreated culture for each strain, the exposure to mefloquine (MFQ) in all three strains tended to upregulate the expression of pfmdr1, with the increase appearing to be an early response that occurred within the first 6 h (Fig. 2). Although we consistently saw higher pfmdr1 expression in MFQ-exposed parasites than in untreated parasites of the same strain, these results were significant only after synchronized rings of 3D7 with one copy of pfmdr1 (P < 0.005) and of Dd2 with four copies of pfmdr1 (P < 0.05) were exposed to MFQ for 12 h. Gene expression analysis of pfmdr1 following parasite exposure to the structurally unrelated antimalarial compound atovaquone (ATQ) yielded no significant difference in pfmdr1 transcript levels compared with those in untreated controls of the same parasite strain (see Fig. S1 in the supplemental material). pfmdr1 upregulation was observed only after exposure to MFQ not after exposure to ATQ, suggesting that increased pfmdr1 expression is a specific P. falciparum response to MFQ and not a generalized response to antiparasitic drug treatment. Upregulation of pfmdr1 expression in MFQ-treated parasites compared to untreated parasites was also observed when MFQ was added to synchronized trophozoite stage parasites; however, these results were not significant (see Fig. S2 in the supplemental material).

Fig 2.

Fig 2

Fold change in pfmdr1 gene expression in parasites with different pfmdr1 copy numbers over time following mefloquine exposure. Fold changes in pfmdr1 expression are relative to that for the corresponding untreated culture for each strain at each time point (not shown), which was set to 1.0 (black line). Significant increases in pfmdr1 expression upon mefloquine exposure (100 ng/ml) were observed at the 12-hour time point for 3D7 and Dd2 cultures. Results are from 6 independent experiments. Statistics were done on the raw data (ΔCT) at each time point. *, P < 0.05; **, P < 0.005 (by Student's t test).

Mefloquine induces P. falciparum cell cycle delay.

Parasite maturation through the asexual blood stages was evaluated by thin blood smears using light microscopy. For all 3 strains, untreated parasite populations progressed from predominantly rings to predominantly trophozoites over 24 h. In contrast, the addition of MFQ to synchronized ring-stage parasites delayed parasite maturation at the ring stage (Fig. 3). In all strains tested, the delay in maturation began at 6 h posttreatment and became more pronounced by the 12-hour time point. This phenotype occurred following exposure to MFQ only. The addition of ATQ did not result in the same delay in maturation. Figure 4 shows that when MFQ was added to cultures containing predominantly synchronized trophozoites, maturation proceeded normally until the ring stage (24 h), at which point maturation again stalled. Thus, MFQ appears to have a selective effect on ring-stage parasites.

Fig 3.

Fig 3

Morphology stage development of untreated and drug-treated ring-stage parasites. Synchronized ring-stage 3D7 (1 pfmdr1 copy), FCB (2 copies), and Dd2 (4 copies) parasites that were untreated or treated with atovaquone (ATQ) (1 μM) or mefloquine (MFQ) (100 ng/ml) were monitored over time. Untreated and ATQ-treated cultures progressed through the normal asexual cell cycle. MFQ treatment caused a delay in parasite maturation, resulting in a persistence of ring stages. All strains exhibited this delay.

Fig 4.

Fig 4

Morphology stage development of untreated and MFQ-treated synchronized trophozoite parasites. Synchronized trophozoites of 3D7 (1 pfmdr1 copy), FCB (2 copies), and Dd2 (4 copies) parasites that were untreated or mefloquine (MFQ) (100 ng/ml) treated were monitored over time. Untreated cultures (top graph) progressed through the normal asexual cell cycle. MFQ treatment caused a delay in parasite maturation at the ring stage (bottom graph), resulting in a persistence of ring-stage parasites. All strains exhibited this delay.

MFQ treatment results in increased expression of ring-stage genes.

To confirm the effects of MFQ on parasite development, we measured, in duplicate, the expression of the developmentally regulated trophozoite antigen R45-like (tar45-like) gene (PlasmoDB no. PFD1175w), which is transcribed during the ring stage only (34). Compared with tar45-like gene expression in untreated controls of each strain (which was set to 1.00), the fold difference in tar45-like gene expression relative to that of pfldh was higher for all three strains at 12 h after MFQ treatment (3D7, 5.73; FCB, 6.14; Dd2, 6.48). Expression of the tar45-like gene was not affected by ATQ (3D7, 1.31; FCB, 1.02; Dd2, 1.47). These data confirm that MFQ-treated parasites remained in the ring stage for a longer period of time than untreated parasites.

pfmdr1 is expressed primarily during the ring stage of the intraerythrocytic cycle.

Untreated cultures of each parasite strain were assessed for morphology and pfmdr1 gene expression as described above. A direct relationship was observed between the proportion of ring-stage parasites in the culture and the fold difference in pfmdr1 transcript levels (Fig. 5). These data suggest that ring-stage parasites express higher levels of the pfmdr1 transcript than later stages and that the MFQ-induced increase in pfmdr1 expression could be due to the maturation delay.

Fig 5.

Fig 5

Ring-stage-specific expression of pfmdr1 in untreated parasite strains containing different pfmdr1 copy numbers. Untreated cultures of each parasite strain were assessed for morphology (lines) and for pfmdr1 gene expression (bars) relative to that of the P. falciparum lactate dehydrogenase gene. A direct relationship between the proportion of ring-stage parasites in the culture and the relative expression of pfmdr1 was observed.

MFQ-induced maturation delay has no effect on artesunate IC50.

Because MFQ-treated parasites expressed more pfmdr1, we tested to see whether MFQ treatment might antagonize its common partner drug artesunate. Parasites were exposed to MFQ for 12 h to induce the maturation delay. The half-maximal inhibitory concentration (IC50) of artesunate was assessed with MFQ-exposed parasites. A SYBR green I flow cytometry assay was used to quantify parasite growth inhibition by artesunate, as previously reported (35). We found no difference in artesunate IC50 values between untreated and MFQ-treated parasites (Table 1).

Table 1.

Half-maximal inhibitory concentration of artesunate in parasite cultures before and after exposure to mefloquine

Parasite strain Mean IC50 (nM) ± SD in:
Untreated cultures MFQ-treated culturesc
3D7a 0.61 ± 0.04 0.62 ± 0.07
Dd2b 0.39 ± 0.05 0.40 ± 0.02
a

3D7 parasites contain one pfmdr1 gene copy.

b

Dd2 parasites contain four pfmdr1 gene copies.

c

MFQ-treated cultures were exposed for 12 h to 100 ng/ml MFQ prior to IC50 analysis.

DISCUSSION

The objective of this study was to determine how mefloquine (MFQ) treatment affects pfmdr1 gene expression in parasites with different pfmdr1 gene copy numbers. We found that the expression of pfmdr1 was upregulated following MFQ treatment, and parasites with four pfmdr1 copies expressed higher transcript levels than single-copy parasites. Interestingly, cultures of MFQ-sensitive FCB parasites (two pfmdr1 gene copies) did not exhibit a significant increase in pfmdr1 expression following MFQ treatment compared with single-copy 3D7 parasites at any of the time points assessed. One possible explanation is that there may be a threshold for the number of pfmdr1 gene copies required for a parasite to exhibit the MFQ-resistant phenotype. Because these parasite strains are not isogenic, it is also possible that other genes could exert an effect on the parasite response to MFQ. Studies in which the expression from the additional pfmdr1 gene copies is reduced or eliminated in Dd2 parasites would be useful in evaluating the possibility of a threshold number of pfmdr1 gene copies being necessary to cause the Dd2 MFQ-resistant phenotype.

Statistically significant upregulation of pfmdr1 following MFQ treatment was observed in 3D7 and Dd2 parasites at the 12-hour time point. Although the reason for this upregulation in 3D7 and Dd2 but not FCB is unclear, subsequent analysis of parasite morphology on the sampled cultures to correlate our pfmdr1 expression data with the parasite life cycle revealed an interesting phenotype. In agreement with a recent study that examined MFQ exposure on synchronized rings only (36), our results revealed that MFQ treatment of synchronized ring-stage parasites resulted in a delay in parasite maturation at the ring stage of development. When we analyzed the morphology of synchronized trophozoites, we observed that MFQ exposure at the trophozoite stage also caused the parasites to stall but only after the parasites matured through the intraerythrocytic cycle to the ring stage. This indicates that MFQ affected the parasites' ability to proceed through the asexual intraerythrocytic cycle only when ring-stage parasites were exposed to the drug.

Two theories can explain the increase in pfmdr1 expression in response to MFQ exposure: (i) direct induction of pfmdr1 gene expression by MFQ or (ii) an indirect upregulation due to the maturation delay. At each time point assessed, a direct relationship between pfmdr1 expression levels and the proportion of ring-stage parasites in the culture was observed. In one interval, between 12 and 24 h, the change in pfmdr1 expression was consistently greater than the change in the proportion of ring-stage parasites. This could be due to the difficulty in distinguishing late rings and early trophozoites by light microscopy.

To demonstrate that MFQ-treated parasites were stalled at the ring stage and were not dying parasites, we investigated the expression levels of the developmentally regulated trophozoite antigen R45-like (tar45-like) gene, which is normally expressed in the ring stage. Transcripts of the tar45-like gene also increased, peaking at 12 h after the addition of MFQ. This increase was not observed in untreated or atovaquone-treated cultures, which also did not exhibit a maturation delay. Thus, the observed increases in pfmdr1 transcript levels in the persistent rings found in MFQ-treated cultures are likely due to an overall increase in the expression of ring-stage genes. Ring-stage-dependent transcription of pfmdr1 would explain the apparent induction of expression after treatment with a drug that slows the cell cycle at the ring stage.

Cell cycle delay upon drug exposure is a common phenomenon, most often seen in cancer cells (37–40). Recently, such delays have been described for P. falciparum treated with other drugs (34, 36, 41, 42). A drug-induced delay in parasite maturation through the intraerythrocytic cycle was seen after short-term MFQ exposure in MFQ-sensitive strains (36). Similarly, we showed that treatment of synchronized ring-stage parasites with MFQ induced a delay in parasite maturation in both the MFQ-sensitive (3D7 and FCB) and MFQ-resistant (Dd2) P. falciparum strains tested. Our data revealed that this delay was only slightly altered in Dd2 parasites, which have four pfmdr1 copies. The MFQ-induced maturation delay occurred as early as 6 h posttreatment, and the delay was observed after MFQ treatment but not after ATQ treatment, which indicates that it not a generalized response to the presence of any antimalarial compound. Because decreased sensitivity to other quinoline drugs has also been linked to elevated pfmdr1 copy number, studies to evaluate the effects of other quinoline compounds, such as quinine, on parasite maturation would be useful to understand if this delay is due to a certain structural class of antimalarial drugs.

There are two possible explanations for the observed effects of MFQ on parasite maturation: (i) the presence of MFQ exerts an effect on the parasites' ability to progress through the asexual cell cycle, or (ii) the maturation delay is an active response by the parasite to adverse conditions caused by mefloquine. If the maturation delay is caused by MFQ, then it would likely be a nonspecific response, perhaps due to a disruption in the availability of nutrients or energy for the parasite to be able to continue through its normal asexual cycle. The addition of chemical agents that inhibit protein synthesis, such as cycloheximide, for example, could shed light on this as a possibility. However, if the maturation delay is an active response by the parasite, one possible consequence of the disruption in the parasite cell cycle is to allow time for parasites to survive peak serum drug concentrations by preventing the maturation to intraerythrocytic stages that express the drug target. Such is the case for certain chemoresistant or radioresistant phenotypes observed in cancer cells (43, 44). For example, 5-fluorouracil (5-FU) is a chemotherapeutic agent that specifically targets the S phase of the eukaryotic cell cycle. Cancer cells resistant to 5-FU are known to arrest at the G1 phase following 5-FU exposure, thus preventing the drug from engaging its S-phase target (43). These delays are directly linked to the treatment dose and duration, and the removal of the therapy restores the normal cell cycle. In P. falciparum, MFQ-induced cell cycle delay is also dose dependent, and removal of MFQ drug pressure restores cell cycle proliferation (36). This would explain the maturation delay if MFQ activity is in one of the later intraerythrocytic stages.

A second explanation for the maturation delay and expression increase could be that the delay is an initial response to the adverse conditions caused by mefloquine but not by atovaquone. Parasites could have evolved this delay mechanism to allow them to survive a specific type of stress. All in all, further work is needed to understand the etiology of this response.

Despite the rapid evolution of resistance to MFQ, its use has gained new life in combination with artemisinin derivatives. Some evidence suggests that the activity of artemisinin and its derivatives is stage specific, with greater plasmocidal activity on late-stage rings and trophozoites than on schizonts or early rings (45–48), whereas other evidence indicates activity on all blood stages (48–50). If the former is true, then MFQ should be additive or synergistic with artesunate. On the other hand, elevated pfmdr1 copy numbers have been implicated as a cause of artesunate resistance as well. Thus, if MFQ leads to increased pfmdr1 expression, then it could be antagonistic with artesunate. Whereas our artesunate IC50 values for 3D7 fell within the range of reported artesunate sensitivity levels (3), our IC50 for Dd2 was slightly lower than reported values. However, we found no differences in the artesunate IC50 for untreated parasites compared with parasites of the same strain that had been exposed to MFQ. This suggests that (i) artesunate is neither synergistic nor antagonistic and (ii) the effect of MFQ on parasite maturation does not alter its sensitivity to artesunate. Thus, no evidence against combining artesunate and mefloquine in malaria treatment was found.

An abundance of in vitro and clinical evidence links copy number increases in the P. falciparum multidrug resistance gene with resistance to several antimalarial compounds (3, 12, 16, 20–22, 24, 25, 27). Our results on the maturation delay and the stage-dependent transcription of pfmdr1 provide new insight into possible resistance mechanisms mediated by copy number changes. The slowing of the parasite intraerythrocytic cell cycle in response to MFQ appears to be a general survival response by all P. falciparum strains tested. This delay could function to alleviate time constraints by prolonging the ring stage, providing the opportunity for higher production of drug transporter proteins in parasites containing multiple pfmdr1 gene copies. This study was limited to the investigation of pfmdr1. Experiments to explore the expression of other important drug resistance transporter genes, such as pfcrt, would be worthwhile. Additionally, further studies are needed to fully understand the mechanism by which MFQ slows cell cycle progression and whether this does increase the relative amount of pfmdr1-encoded transporter expressed in each parasite. Particularly, investigation into whether or not MFQ has an effect on cell cycle regulators, such as P. falciparum homologs for cyclin-dependent kinases (51–57), would be worthwhile to determine if MFQ delays maturation by interfering with one or more cell cycle enzymes.

Supplementary Material

Supplemental material

ACKNOWLEDGMENT

This work was funded by the National Institutes of Health (grant 1R21AI076785).

Footnotes

Published ahead of print 3 December 2012

Supplemental material for this article may be found at http://dx.doi.org/10.1128/AAC.01006-12.

REFERENCES

  • 1. WHO 2010. World malaria report. World Health Organization, Geneva, Switzerland [Google Scholar]
  • 2. Dondorp AM, Nosten F, Yi P, Das D, Phyo AP, Tarning J, Lwin KM, Ariey F, Hanpithakpong W, Lee SJ, Ringwald P, Silamut K, Imwong M, Chotivanich K, Lim P, Herdman T, An SS, Yeung S, Singhasivanon P, Day NP, Lindegardh N, Socheat D, White NJ. 2009. Artemisinin resistance in Plasmodium falciparum malaria. N. Engl. J. Med. 361:455–467 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Lim P, Wongsrichanalai C, Chim P, Khim N, Kim S, Chy S, Sem R, Nhem S, Yi P, Duong S, Bouth DM, Genton B, Beck HP, Gobert JG, Rogers WO, Coppee JY, Fandeur T, Mercereau-Puijalon O, Ringwald P, Le Bras J, Ariey F. 2010. Decreased in vitro susceptibility of Plasmodium falciparum isolates to artesunate, mefloquine, chloroquine, and quinine in Cambodia from to 2007. Antimicrob. Agents Chemother. 54:2135–2142 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Wongsrichanalai C, Pickard AL, Wernsdorfer WH, Meshnick SR. 2002. Epidemiology of drug-resistant malaria. Lancet Infect. Dis. 2:209–218 [DOI] [PubMed] [Google Scholar]
  • 5. Cowman AF. 1991. The P-glycoprotein homologues of Plasmodium falciparum: are they involved in chloroquine resistance? Parasitol. Today 7:70–76 [DOI] [PubMed] [Google Scholar]
  • 6. Cowman AF, Karcz S, Galatis D, Culvenor JG. 1991. A P-glycoprotein homologue of Plasmodium falciparum is localized on the digestive vacuole. J. Cell Biol. 113:1033–1042 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Foote SJ, Kyle DE, Martin RK, Oduola AM, Forsyth K, Kemp DJ, Cowman AF. 1990. Several alleles of the multidrug-resistance gene are closely linked to chloroquine resistance in Plasmodium falciparum. Nature 345:255–258 [DOI] [PubMed] [Google Scholar]
  • 8. Rohrbach P, Sanchez CP, Hayton K, Friedrich O, Patel J, Sidhu AB, Ferdig MT, Fidock DA, Lanzer M. 2006. Genetic linkage of pfmdr1 with food vacuolar solute import in Plasmodium falciparum. EMBO J. 25:3000–3011 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Sauvage V, Aubert D, Escotte-Binet S, Villena I. 2009. The role of ATP-binding cassette (ABC) proteins in protozoan parasites. Mol. Biochem. Parasitol. 167:81–94 [DOI] [PubMed] [Google Scholar]
  • 10. Endicott JA, Ling V. 1989. The biochemistry of P-glycoprotein-mediated multidrug resistance. Annu. Rev. Biochem. 58:137–171 [DOI] [PubMed] [Google Scholar]
  • 11. Gavigan CS, Shen M, Machado SG, Bell A. 2007. Influence of the Plasmodium falciparum P-glycoprotein homologue 1 (pfmdr1 gene product) on the antimalarial action of cyclosporin. J. Antimicrob. Chemother. 59:197–203 [DOI] [PubMed] [Google Scholar]
  • 12. Alker AP, Lim P, Sem R, Shah NK, Yi P, Bouth DM, Tsuyuoka R, Maguire JD, Fandeur T, Ariey F, Wongsrichanalai C, Meshnick SR. 2007. Pfmdr1 and in vivo resistance to artesunate-mefloquine in falciparum malaria on the Cambodian-Thai border. Am. J. Trop. Med. Hyg. 76:641–647 [PubMed] [Google Scholar]
  • 13. Barnes DA, Foote SJ, Galatis D, Kemp DJ, Cowman AF. 1992. Selection for high-level chloroquine resistance results in deamplification of the pfmdr1 gene and increased sensitivity to mefloquine in Plasmodium falciparum. EMBO J. 11:3067–3075 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Begum K, Kim HS, Okuda Y, Wataya Y, Kimura M, Huruta T. 2002. Genomic analysis of mefloquine-resistant Plasmodium falciparum. Nucleic Acids Res. Suppl. 2002:223–224 [DOI] [PubMed] [Google Scholar]
  • 15. Chaiyaroj SC, Buranakiti A, Angkasekwinai P, Looressuwan S, Cowman AF. 1999. Analysis of mefloquine resistance and amplification of pfmdr1 in multidrug-resistant Plasmodium falciparum isolates from Thailand. Am. J. Trop. Med. Hyg. 61:780–783 [DOI] [PubMed] [Google Scholar]
  • 16. Cowman AF, Galatis D, Thompson JK. 1994. Selection for mefloquine resistance in Plasmodium falciparum is linked to amplification of the pfmdr1 gene and cross-resistance to halofantrine and quinine. Proc. Natl. Acad. Sci. U. S. A. 91:1143–1147 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Nelson AL, Purfield A, McDaniel P, Uthaimongkol N, Buathong N, Sriwichai S, Miller RS, Wongsrichanalai C, Meshnick SR. 2005. pfmdr1 genotyping and in vivo mefloquine resistance on the Thai-Myanmar border. Am. J. Trop. Med. Hyg. 72:586–592 [PubMed] [Google Scholar]
  • 18. Nishiyama Y, Okuda Y, Kim HS, Huruta T, Kimura M, Wataya Y. 2004. Genetic analysis of mefloquine-resistant mechanism of Plasmodium falciparum. Nucleic Acids Symp. Ser. (Oxf.) 2004:163–164 [DOI] [PubMed] [Google Scholar]
  • 19. Peel SA, Bright P, Yount B, Handy J, Baric RS. 1994. A strong association between mefloquine and halofantrine resistance and amplification, overexpression, and mutation in the P-glycoprotein gene homolog (pfmdr) of Plasmodium falciparum in vitro. Am. J. Trop. Med. Hyg. 51:648–658 [DOI] [PubMed] [Google Scholar]
  • 20. Preechapornkul P, Imwong M, Chotivanich K, Pongtavornpinyo W, Dondorp AM, Day NP, White NJ, Pukrittayakamee S. 2009. Plasmodium falciparum pfmdr1 amplification, mefloquine resistance, and parasite fitness. Antimicrob. Agents Chemother. 53:1509–1515 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Price RN, Uhlemann AC, Brockman A, McGready R, Ashley E, Phaipun L, Patel R, Laing K, Looareesuwan S, White NJ, Nosten F, Krishna S. 2004. Mefloquine resistance in Plasmodium falciparum and increased pfmdr1 gene copy number. Lancet 364:438–447 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Chavchich M, Gerena L, Peters J, Chen N, Cheng Q, Kyle DE. 2010. Role of pfmdr1 amplification and expression in induction of resistance to artemisinin derivatives in Plasmodium falciparum. Antimicrob. Agents Chemother. 54:2455–2464 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Ferreira ID, Rosario VE, Cravo PV. 2006. Real-time quantitative PCR with SYBR Green I detection for estimating copy numbers of nine drug resistance candidate genes in Plasmodium falciparum. Malar J. 5:1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Nair S, Nash D, Sudimack D, Jaidee A, Barends M, Uhlemann AC, Krishna S, Nosten F, Anderson TJ. 2007. Recurrent gene amplification and soft selective sweeps during evolution of multidrug resistance in malaria parasites. Mol. Biol. Evol. 24:562–573 [DOI] [PubMed] [Google Scholar]
  • 25. Price R, Robinson G, Brockman A, Cowman A, Krishna S. 1997. Assessment of pfmdr 1 gene copy number by tandem competitive polymerase chain reaction. Mol. Biochem. Parasitol. 85:161–169 [DOI] [PubMed] [Google Scholar]
  • 26. Rogers WO, Sem R, Tero T, Chim P, Lim P, Muth S, Socheat D, Ariey F, Wongsrichanalai C. 2009. Failure of artesunate-mefloquine combination therapy for uncomplicated Plasmodium falciparum malaria in southern Cambodia. Malar J. 8:10. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Sidhu AB, Uhlemann AC, Valderramos SG, Valderramos JC, Krishna S, Fidock DA. 2006. Decreasing pfmdr1 copy number in Plasmodium falciparum malaria heightens susceptibility to mefloquine, lumefantrine, halofantrine, quinine, and artemisinin. J. Infect. Dis. 194:528–535 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Vinayak S, Alam MT, Sem R, Shah NK, Susanti AI, Lim P, Muth S, Maguire JD, Rogers WO, Fandeur T, Barnwell JW, Escalante AA, Wongsrichanalai C, Ariey F, Meshnick SR, Udhayakumar V. 2010. Multiple genetic backgrounds of the amplified Plasmodium falciparum multidrug resistance (pfmdr1) gene and selective sweep of 184F mutation in Cambodia. J. Infect. Dis. 201:1551–1560 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Valderramos SG, Fidock DA. 2006. Transporters involved in resistance to antimalarial drugs. Trends Pharmacol. Sci. 27:594–601 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Myrick A, Munasinghe A, Patankar S, Wirth DF. 2003. Mapping of the Plasmodium falciparum multidrug resistance gene 5′-upstream region, and evidence of induction of transcript levels by antimalarial drugs in chloroquine sensitive parasites. Mol. Microbiol. 49:671–683 [DOI] [PubMed] [Google Scholar]
  • 31. Trager W, Jenson JB. 1978. Cultivation of malarial parasites. Nature 273:621–622 [DOI] [PubMed] [Google Scholar]
  • 32. Lambros C, Vanderberg JP. 1979. Synchronization of Plasmodium falciparum erythrocytic stages in culture. J. Parasitol. 65:418–420 [PubMed] [Google Scholar]
  • 33. Kim HS, Lee G, John SW, Maeda N, Smithies O. 2002. Molecular phenotyping for analyzing subtle genetic effects in mice: application to an angiotensinogen gene titration. Proc. Natl. Acad. Sci. U. S. A. 99:4602–4607 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Purfield AE, Tidwell RR, Meshnick SR. 2009. The diamidine DB75 targets the nucleus of Plasmodium falciparum. Malar J. 8:104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Izumiyama S, Omura M, Takasaki T, Ohmae H, Asahi H. 2009. Plasmodium falciparum: development and validation of a measure of intraerythrocytic growth using SYBR Green I in a flow cytometer. Exp. Parasitol. 121:144–150 [DOI] [PubMed] [Google Scholar]
  • 36. Veiga MI, Ferreira PE, Schmidt BA, Ribacke U, Bjorkman A, Tichopad A, Gil JP. 2010. Antimalarial exposure delays Plasmodium falciparum intra-erythrocytic cycle and drives drug transporter genes expression. PLoS One 5:e12408 doi:10.1371/journal.pone.0012408 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Chen Q, Van der Sluis PC, Boulware D, Hazlehurst LA, Dalton WS. 2005. The FA/BRCA pathway is involved in melphalan-induced DNA interstrand cross-link repair and accounts for melphalan resistance in multiple myeloma cells. Blood 106:698–705 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Epstein RJ, Watson JV, Smith PJ. 1988. Subpopulation analysis of drug-induced cell-cycle delay in human tumor cells using 90 degrees light scatter. Cytometry 9:349–358 [DOI] [PubMed] [Google Scholar]
  • 39. Lovejoy KS, Serova M, Bieche I, Emami S, D'Incalci M, Broggini M, Erba E, Gespach C, Cvitkovic E, Faivre S, Raymond E, Lippard SJ. 2011. Spectrum of cellular responses to pyriplatin, a monofunctional cationic antineoplastic platinum(II) compound, in human cancer cells. Mol. Cancer Ther. 10:1709–1719 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Smith PJ, Soues S, Gottlieb T, Falk SJ, Watson JV, Osborne RJ, Bleehen NM. 1994. Etoposide-induced cell cycle delay and arrest-dependent modulation of DNA topoisomerase II in small-cell lung cancer cells. Br. J. Cancer 70:914–921 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Nakazawa S, Kanbara H, Aikawa M. 1995. Plasmodium falciparum: recrudescence of parasites in culture. Exp. Parasitol. 81:556–563 [DOI] [PubMed] [Google Scholar]
  • 42. Thapar MM, Gil JP, Bjorkman A. 2005. In vitro recrudescence of Plasmodium falciparum parasites suppressed to dormant state by atovaquone alone and in combination with proguanil. Trans. R. Soc. Trop. Med. Hyg. 99:62–70 [DOI] [PubMed] [Google Scholar]
  • 43. Guo X, Goessl E, Jin G, Collie-Duguid ES, Cassidy J, Wang W, O'Brien V. 2008. Cell cycle perturbation and acquired 5-fluorouracil chemoresistance. Anticancer Res. 28:9–14 [PubMed] [Google Scholar]
  • 44. Su LN, Little JB. 1993. Prolonged cell cycle delay in radioresistant human cell lines transfected with activated ras oncogene and/or simian virus 40 T-antigen. Radiat Res. 133:73–79 [PubMed] [Google Scholar]
  • 45. Alin MH, Bjorkman A. 1994. Concentration and time dependency of artemisinin efficacy against Plasmodium falciparum in vitro. Am. J. Trop. Med. Hyg. 50:771–776 [DOI] [PubMed] [Google Scholar]
  • 46. Geary TG, Divo AA, Jensen JB. 1989. Stage specific actions of antimalarial drugs on Plasmodium falciparum in culture. Am. J. Trop. Med. Hyg. 40:240–244 [DOI] [PubMed] [Google Scholar]
  • 47. Meshnick SR, Taylor TE, Kamchonwongpaisan S. 1996. Artemisinin and the antimalarial endoperoxides: from herbal remedy to targeted chemotherapy. Microbiol. Rev. 60:301–315 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. ter Kuile F, White NJ, Holloway P, Pasvol G, Krishna S. 1993. Plasmodium falciparum: in vitro studies of the pharmacodynamic properties of drugs used for the treatment of severe malaria. Exp. Parasitol. 76:85–95 [DOI] [PubMed] [Google Scholar]
  • 49. Golenser J, Waknine JH, Krugliak M, Hunt NH, Grau GE. 2006. Current perspectives on the mechanism of action of artemisinins. Int. J. Parasitol. 36:1427–1441 [DOI] [PubMed] [Google Scholar]
  • 50. White NJ. 2008. Qinghaosu (artemisinin): the price of success. Science 320:330–334 [DOI] [PubMed] [Google Scholar]
  • 51. Bracchi-Ricard V, Barik S, Delvecchio C, Doerig C, Chakrabarti R, Chakrabarti D. 2000. PfPK6, a novel cyclin-dependent kinase/mitogen-activated protein kinase-related protein kinase from Plasmodium falciparum. Biochem. J. 347:255–263 [PMC free article] [PubMed] [Google Scholar]
  • 52. Doerig C, Endicott J, Chakrabarti D. 2002. Cyclin-dependent kinase homologues of Plasmodium falciparum. Int. J. Parasitol. 32:1575–1585 [DOI] [PubMed] [Google Scholar]
  • 53. Geyer JA, Prigge ST, Waters NC. 2005. Targeting malaria with specific CDK inhibitors. Biochim. Biophys. Acta 1754:160–170 [DOI] [PubMed] [Google Scholar]
  • 54. Graeser R, Wernli B, Franklin RM, Kappes B. 1996. Plasmodium falciparum protein kinase 5 and the malarial nuclear division cycles. Mol. Biochem. Parasitol. 82:37–49 [DOI] [PubMed] [Google Scholar]
  • 55. Halbert J, Ayong L, Equinet L, Le Roch K, Hardy M, Goldring D, Reininger L, Waters N, Chakrabarti D, Doerig C. 2010. A Plasmodium falciparum transcriptional cyclin-dependent kinase-related kinase with a crucial role in parasite proliferation associates with histone deacetylase activity. Eukaryot. Cell 9:952–959 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 56. Li JL, Robson KJ, Chen JL, Targett GA, Baker DA. 1996. Pfmrk, a MO15-related protein kinase from Plasmodium falciparum. Gene cloning, sequence, stage-specific expression and chromosome localization. Eur. J. Biochem. 241:805–813 [DOI] [PubMed] [Google Scholar]
  • 57. Waters NC, Geyer JA. 2003. Cyclin-dependent protein kinases as therapeutic drug targets for antimalarial drug development. Expert Opin. Ther. Targets. 7:7–17 [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Antimicrobial Agents and Chemotherapy are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES