Abstract
The carbon storage regulator A (CsrA) controls a wide variety of bacterial processes, including metabolism, adherence, stress responses, and virulence. Haemophilus ducreyi, the causative agent of chancroid, harbors a homolog of csrA. Here, we generated an unmarked, in-frame deletion mutant of csrA to assess its contribution to H. ducreyi pathogenesis. In human inoculation experiments, the csrA mutant was partially attenuated for pustule formation compared to its parent. Deletion of csrA resulted in decreased adherence of H. ducreyi to human foreskin fibroblasts (HFF); Flp1 and Flp2, the determinants of H. ducreyi adherence to HFF cells, were downregulated in the csrA mutant. Compared to its parent, the csrA mutant had a significantly reduced ability to tolerate oxidative stress and heat shock. The enhanced sensitivity of the mutant to oxidative stress was more pronounced in bacteria grown to stationary phase compared to that in bacteria grown to mid-log phase. The csrA mutant also had a significant survival defect within human macrophages when the bacteria were grown to stationary phase but not to mid-log phase. Complementation in trans partially or fully restored the mutant phenotypes. These data suggest that CsrA contributes to virulence by multiple mechanisms and that these contributions may be more profound in bacterial cell populations that are not rapidly dividing in the human host.
INTRODUCTION
Haemophilus ducreyi is a fastidious, Gram-negative bacterium that causes chancroid. Chancroid is a highly contagious sexually transmitted disease that manifests as painful genital ulcers and regional lymphadenopathy. Although rare in the United States, chancroid is endemic in the resource-poor countries of Africa, Asia, and Latin America (1). Due to an emphasis on the syndromic management of genital ulcer diseases, the global prevalence of chancroid is now unknown (2). Chancroid facilitates the acquisition and transmission of human immunodeficiency virus type 1 (HIV-1) (3). In addition to chancroid, H. ducreyi also causes a nonsexually transmitted chronic lower limb ulceration syndrome that is reported from Samoa to New Guinea in the South Pacific (4–6).
H. ducreyi is an obligate human pathogen that lacks any known animal or environmental reservoir. To understand the pathogenesis of H. ducreyi in its natural host, our laboratory developed a human challenge model of infection (7). Using this model, we found that several genes contribute to virulence in human volunteers, including those that encode proteins involved in hemoglobin uptake (hgbA), outer membrane stability (pal), serum resistance (dsrA and dltA), microcolony formation and adherence (tadA and flp1 to flp3), resistance to phagocytosis (lspA1-lspA2), collagen binding (ncaA), the synthesis of glycoconjugates (wecA), quorum sensing (luxS), fibrinogen binding (fgbA), antimicrobial peptide resistance (sapA, sapB, and sapC), and the downregulation of multiple virulence determinants (cpxA) (7–12).
During infection, H. ducreyi is exposed to multiple stresses orchestrated by the host immune response, including toxic products released by phagocytes, the hypoxic environment of an abscess, and nutrient limitation. The ability of H. ducreyi to sense and respond to such adverse conditions is likely crucial for its survival in the human host. However, little is known about how the virulence determinants of the organism are regulated in response to host signals.
In response to changing environments, Gram-negative bacteria usually employ a wide variety of regulatory systems to coordinate gene expression, including two-component systems (TCS) and alternative sigma factors. CpxRA is the only obvious TCS in the genome of H. ducreyi. Although activation of CpxRA by deletion of cpxA fully attenuates the virulence of H. ducreyi in human volunteers (12), CpxR is dispensable for human infection (13). In addition to the housekeeping sigma factor RpoD, the H. ducreyi genome (GenBank accession no. AE017143) contains obvious homologs of only two sigma factors: RpoE and RpoH. The paucity of regulatory elements suggests that H. ducreyi utilizes alternative mechanisms for controlling gene expression.
In many Gram-negative bacteria, gene expression is also controlled at the posttranscriptional level (14). Posttranscriptional regulation generally occurs via multiple mechanisms, including cis-acting small RNAs, ligand-binding riboswitches, attenuators, trans-acting small RNAs, and the carbon storage regulator (Csr) systems (15). The Csr system controls a wide variety of processes in many bacterial pathogens, including carbon metabolism, motility, biofilm formation, quorum sensing, production of secondary metabolites and cytotoxic factors, stress tolerance, and virulence (14, 16–19).
In Escherichia coli, the Csr system contains four components: CsrA, CsrB, CsrC, and CsrD (20, 21). CsrA, the principal component of the system, is a homodimeric RNA-binding protein (20, 22). By binding to conserved sequences near the ribosome-binding site, CsrA either represses or activates the translation initiation and/or stability of its mRNA targets (23–25). The small RNAs, CsrB and CsrC, antagonize the function of CsrA by sequestering CsrA dimers (26, 27); the TCS BarA/UvrY positively regulates CsrB and CsrC (28, 29). By marking them for degradation, CsrD negatively controls the function of the CsrA-regulating small RNAs (21).
The genome of H. ducreyi contains a homolog of csrA; surprisingly, it lacks obvious homologs of csrB, csrC, barA-uvrY, and csrD. Given the key role of CsrA in regulating stress- and virulence-linked traits in other bacteria, here we examined the contribution of CsrA to H. ducreyi pathogenesis. To our knowledge, this is the first study describing the contribution of CsrA to the virulence of a bacterial pathogen in humans.
MATERIALS AND METHODS
Bacterial strains, plasmids, and culture conditions.
The bacterial strains and plasmids used in this study are listed in Table 1. All the H. ducreyi strains were grown on chocolate agar plates supplemented with 1% IsoVitalex at 33°C with 5% CO2 or in gonococcal (GC) broth supplemented with 5% fetal bovine serum (FBS; HyClone), 1% IsoVitalex, and 50 μg/ml of hemin (Aldrich Chemical Co.) at 33°C. In some experiments, H. ducreyi was grown to mid-log phase (optical density at 660 nm [OD660] = 0.2); in other experiments, H. ducreyi was grown to stationary phase (OD660 = 0.45 to 0.55). The E. coli strains were grown in Luria-Bertani medium at 37°C except for strain DY380, which was maintained in L broth or agar and grown at 32°C or 42°C for induction of the λ red recombinase. When necessary, the medium was supplemented with kanamycin (20 μg/ml for H. ducreyi; 50 μg/ml for Escherichia coli) or spectinomycin (200 μg/ml for H. ducreyi; 50 μg/ml for E. coli).
Table 1.
Bacterial strains and plasmids used in this study
| Strain(s) or plasmid | Description | Source or reference(s) |
|---|---|---|
| E. coli strains | ||
| DH5α and HB101 | Strains used for general cloning procedures | Invitrogen |
| DY380 | DH10B derivative containing a defective λ prophage in which the red, bet, and gam genes are controlled by the temp-sensitive λcI857 repressor | 30 |
| H. ducreyi strains | ||
| 35000HP | Human-passaged variant of strain 35000 | 31 |
| HD183 | Class I clinical isolate; Singapore, 1982 | 32, 33 |
| HD188 | Class I clinical isolate; Kenya, 1982 | 32, 33 |
| 82-029362 | Class I clinical isolate; California, 1982 | 32, 33 |
| 6644 | Class I clinical isolate; Massachusetts, 1989 | 32, 33 |
| 85-023233 | Class I clinical isolate; New York, 1985 | 32, 33 |
| CIP542 ATCC | Class II clinical isolate; Hanoi, Vietnam, 1954 | 34, 35 |
| HMC112 | Class II clinical isolate; 1984 | 35 |
| 33921 | Class II clinical isolate; Kenya | 32 |
| DMC64 | Class II clinical isolate; Bangladesh | 35 |
| 35000HPΔcsrA | 35000HPcsrA unmarked, in-frame deletion mutant | This study |
| FX517 | 35000dsrA::cat insertion mutant | 36 |
| Plasmids | ||
| pDG1 | pCR-XL-TOPO containing the csrA-coding region along with 0.5-kb flanking regions | This study |
| pRSM2832 | Plasmid containing spectinomycin resistance cassette flanked by the FRT sites | 40 |
| pRSM2072 | H. ducreyi suicide vector | 37 |
| pLS88 | H. ducreyi shuttle vector | 38 |
| pcsrA | pLS88 derivative containing the csrA ORF flanked by 200-bp upstream and 17-bp of downstream sequences | This study |
| pRSM2975 | Plasmid containing the origin of replication and kanamycin-resistance gene from pLS88 and the FLP recombinase gene from pFT-A and a point mutation conferring a temp-sensitive phenotype in H. ducreyi | 12 |
Reverse transcriptase PCR (RT-PCR) and quantitative RT-PCR (qRT-PCR).
Total RNA was extracted from bacterial cells using TRIzol reagent (Invitrogen) according to the manufacturer's protocol. The RNA was treated with the TURBO DNA-free DNase (Ambion) and purified using the RNeasy minikit (Qiagen). The integrity and concentration of RNA were determined using the Agilent Bioanalyser (Agilent Technologies) and NanoDrop ND-1000 (Thermo Scientific), respectively. cDNA was synthesized from total RNA using the Super SMART cDNA synthesis kit (Clontech).
qRT-PCR was performed using the QuantiTect SYBR green RT-PCR kit (Qiagen) in an ABI Prism 7000 sequence detector (Applied Biosystems). The primer pairs were designed to amplify internal gene-specific fragments ranging from 72 to 166 bp. For all qRT-PCR experiments, the amplification efficiency was determined for each primer pair (Table 2); all primer pairs had greater than 95% efficiency. The expression levels of target genes were normalized to that of dnaE, which was amplified using the primer pair P1/P2. The fold change in expression was calculated as follows: ratio = (Etarget)ΔCTtarget(35000HP − 35000HPΔcsrA)/(Ereference)ΔCTreference(35000HP − 35000HPΔcsrA), where E is the amplification efficiency (equal to 10−1/slope) and ΔCT is the change in cycle threshold.
Table 2.
Oligonucleotides used in this study
| Primer (gene) | Purpose | 5′ to 3′ sequencea |
|---|---|---|
| P1 (dnaE, 5′) | qRT-PCR | AACGTTACCTTCAGCAAGCGGTTC |
| P2 (dnaE, 3′) | qRT-PCR | GGCGTTTGGGATCGTCGAGTGTAT |
| P3 (uspA-alaS, 5′) | RT-PCR | CCGTTAATTGATGAATAATAGCCAC |
| P4 (uspA-alaS, 3′) | RT-PCR | TTCATTTACACTTTACTCTGGATG |
| P5 (alaS-csrA, 5′) | RT-PCR | AGATACTGCACTTGCCTTTGC |
| P6 (alaS-csrA, 3′) | RT-PCR | CGTGTTAGTACAAGCATTATACCACCTT |
| P7 (csrA-galU, 5′) | RT-PCR | AGCATTAGCAGATAATATACCGGA |
| P8 (csrA-galU, 3′) | RT-PCR | TCCTAAGCCTGCAACAGGAA |
| P9 (csrA, 5′) | qRT-PCR | GGCGATGATATTGAAATTACCGTGC |
| P10 (csrA, 3′) | qRT-PCR | TTTAGGTGCATTGACGCCCA |
| P11 (alaS-csrA, 5′) | Strain survey | GCAAGATCAAGGAAAGGTCTTGCT |
| P12 (galU, 3′) | Strain survey | GCTTTAGTAGCCGGAAGCATTCGT |
| P13 | csrA mutagenesis | CAAGATCAAGGAAAGGTCTTGCTATATTTTACAAACAAGGTGGTATAATGATTCCGGGGATCCGTCGACC |
| P14 | csrA mutagenesis | CAGGAATAATGACTTTCATTACGTAATCCTTATACTGATTCCGGTATATTTGTAGGCTGGAGCTGCTTCG |
| P15 | csrA mutagenesis | ATATATACTAGTTGCACAAGCAGGTGCTGAATTG |
| P16 | csrA mutagenesis | ATATATACTAGTCGGGTGCAACCATAATTTGACT |
| P17 | csrA mutagenesis | CTCATCTCTGAAAGTGCGGTAGCA |
| P18 | csrA mutagenesis | GGCTGTTTCTCCTGCACGAATGTT |
| P19 (galU, 5′) | qRT-PCR | CGTGGGTAAAGAGCCATTTGCAGT |
| P20 (galU, 3′) | qRT-PCR | GGCACGGGTGCAACCATAATTTGA |
| P21 | Trans complementation | ATATATGAATTCCAATTAGCAAGATCAAGGAAAGGTCT |
| P22 | Trans complementation | ATATATGAATTCCCTTATACTGATTCCGGTATATTATCTGCT |
| P23 (flp1, 5′) | qRT-PCR | GGCTTAATTGCAGTCGCAGTTGCT |
| P24 (flp1, 3′) | qRT-PCR | GTGCCATTAGCGCTACTTATACCAG |
| P25 (tadA, 5′) | qRT-PCR | AATCAATGCCTTGCGTATGCGTCC |
| P26 (tadA, 3′) | qRT-PCR | TGTATTGGCGTGCAGGGTAGACAT |
| P27 (groEL, 5′) | qRT-PCR | TAGCCGGTGGTGTGGCAGTTATTA |
| P28 (groEL, 3′) | qRT-PCR | TGGAGTGCATCATCCACACGATCT |
| P29 (oxyR, 5′) | qRT-PCR | CTTGTTGAACAGGCCAAAGCGGTA |
| P30 (oxyR, 3′) | qRT-PCR | GTGCAATGGGCCAGACATTTCCTT |
| P31 (sodC, 5′) | qRT-PCR | GGCCATTGGGATCCAAAGCAAACT |
| P32 (sodC, 3′) | qRT-PCR | CAGGCGTTGTTGCTGAACCATCAT |
| P33 (bcp, 5′) | qRT-PCR | CTGTACGACTCAAGCATGCGGTTT |
| P34 (bcp, 3′) | qRT-PCR | ATCTGGGCTAATGCCAAGCACAAC |
| P35 (rpoE, 5′) | qRT-PCR | GCGCGAGTTAGAAGGATTAAGCTACG |
| P36 (rpoE, 3′) | qRT-PCR | AATATTAACTCTGTTGCATCAGTGGATTG |
Boldfaced text represents sequences with homology to the mutagenic cassette. Underlining indicates regions corresponding to restriction enzyme sites as mentioned in the text. H. ducreyi sequences are from GenBank accession no. AE017143.
Characterization of the csrA gene.
The Basic Local Alignment Search Tool (BLAST) was used to identify a putative homolog of csrA in H. ducreyi (GenBank accession no. AE017143). RT-PCR was performed to determine if csrA is in an operon with neighboring genes. The intergenic regions were amplified with the primer pairs P3/P4 for uspA-alaS, P5/P6 for alaS-csrA, and P7/P8 for csrA-galU (Table 2). To determine if csrA expression was growth phase dependent, qRT-PCR was performed on RNA isolated from bacteria grown to mid-log and stationary phases using the primer pair P9/P10, which binds to a region within the csrA open reading frame (ORF) (Table 2).
To examine whether csrA was conserved among class I and class II H. ducreyi clinical isolates, we amplified csrA sequences using genomic DNA and the primer pair P11/P12, which bind to regions in the 5′ and 3′ flanking sequences of the csrA, respectively. The PCR product from one strain of each class was sequenced. The sequences were aligned using Clustal Omega (39).
Construction and complementation of an unmarked, in-frame csrA deletion mutant.
An unmarked, in-frame deletion mutant of H. ducreyi csrA was generated using the λ red and FLP recombinase-based methodology as described previously (12). Briefly, a pair of 70-bp primers, P13/P14 (Table 2), was used to amplify a spectinomycin (spec) resistance cassette flanked by the flippase recognition target (FRT) sites employing pRSM2832 as the template (40). P13 included 47 bp upstream of csrA, the ATG start codon, and 20 bp homologous to the 5′ end of the spec cassette; P14 included 21 bp at the 3′ end of csrA, 29 bp of the downstream region, and 20 bp corresponding to the 3′ end of the spec cassette. Using pRSM2832 as the template, the P13/P14 primers yielded a 2-kb amplicon.
The csrA-coding region along with a 0.5-kb sequence on either side of the target gene were amplified using the primer pair P15/P16 (Table 2). The amplified PCR fragment was cloned into pCR-XL-TOPO; the resulting construct (pDG1) was electroporated into E. coli DY380, which contains the temperature-sensitive λ red recombinase. The 2-kb mutagenic cassette amplified by P13/P14 was electroporated into DY380(pDG1). Following induction of λ red recombinase, the csrA gene was replaced with the spec cassette except for the start codon and the terminal 21 bp of the csrA ORF. An SpeI-digested fragment containing 0.5-kb flanking regions and the spec cassette was cloned into the suicide vector pRSM2072. The resulting construct was electroporated into 35000HP. Colonies that had resolved the cointegrates were selected on chocolate agar containing spectinomycin and 5-bromo-4-chloro-3-indoly-β-d-galactopyranoside (X-Gal). Allelic exchange was confirmed by PCR and sequence analysis using the primer pairs P11/P12 and P17/P18; P17 binds to a region upstream of the 5′ flanking sequence of the csrA, while P18 binds to a region downstream of the 3′ flanking sequence of the csrA (Table 2). Finally, FLP recombinase was used to excise the spec cassette exactly as described previously (12, 40). The csrA deletion was confirmed by PCR and sequence analysis (data not shown); the final mutant was designated 35000HPΔcsrA. The primer pair P19/P20, which binds within the galU ORF, (Table 2) was used to determine if the csrA deletion affected the expression of the downstream gene galU by qRT-PCR.
To complement the csrA mutation, the csrA gene was expressed under the control of its native promoter in the E. coli-H. ducreyi shuttle vector pLS88. Briefly, the csrA open reading frame, along with a 200-bp upstream region, was amplified using the primer pair P21/P22 (Table 2). The amplified PCR product was digested with EcoRV and ligated into pLS88 to generate pcsrA. After confirming by PCR and sequence analysis, pcsrA was electroporated into 35000HPΔcsrA. A kanamycin-resistant transformant was designated 35000HPΔcsrA(pcsrA). 35000HP and 35000HPΔcsrA were also electroporated with pLS88, and the resulting strains were designated 35000HP(pLS88) and 35000HPΔcsrA(pLS88), respectively.
Phenotypic comparisons.
Lipooligosaccharides (LOS) and outer membrane proteins (OMP) were isolated from 35000HP and 35000HPΔcsrA and analyzed as described previously (33, 41). Serum bactericidal assays were performed as described previously (12).
Human inoculation experiments.
Human inoculation experiments were performed according to the guidelines of the U.S. Department of Health and Human Services and the Indiana University Institutional Review Board. The study included seven healthy adults over 21 years of age. All the participants gave written, informed consent for participation and HIV serology. The experimental procedures were carried out as described previously, including the preparation and inoculation of H. ducreyi strains, calculation of the estimated delivered dose (EDD), clinical observations, surface cultures, definitions of clinical endpoints, biopsies, and treatment of the volunteers (7). Since site outcomes within the same individual are not independent, the papule and pustule formation rates for the parent and the mutant strains were calculated using logistic regression with generalized estimating equations (GEE) as described previously (7). For these papule and pustule formation rates, the 95% confidence intervals (95% CI) were calculated using the GEE-based sandwich standard errors.
To confirm that the inocula were correct and there was no cross-contamination of infected sites, colony hybridization was performed on the colonies derived from the inocula, surface cultures, and biopsy samples. The probes specific for dnaE and the deleted region of csrA were generated using the primer pairs P1/P2 and P9/P10 (Table 2), respectively. The probes were labeled with digoxigenin (DIG) using the DIG DNA labeling kit (Roche Applied Sciences) and detected using the DIG Easy Hyb protocol (Roche Applied Sciences) following the manufacturer's instructions.
Adherence assays.
Adherence to human foreskin fibroblasts (HFF) was performed as described previously (8). Briefly, 24-well tissue culture plates (Costar) were seeded with 105 HFF cells and allowed to reach confluence. 35000HP(pLS88), 35000HPΔcsrA(pLS88), 35000HPΔcsrA(pcsrA), and 35000HPΔflp1-3(pLS88) were grown to stationary phase and added to confluent HFF cells at a multiplicity of infection (MOI) of 10:1 at 33°C for 2 h. After being washed, the HFF cells were lysed with 0.2% saponin (Sigma-Aldrich) and quantitatively cultured. Percent adherence of H. ducreyi to HFF cells was determined by calculating the ratio of HFF-adhered bacteria to initial CFU.
To determine if the deletion of csrA affected the expression of Flp proteins, total RNA was extracted from stationary-phase 35000HP and 35000HPΔcsrA as described above. qRT-PCR was performed using the primer pairs P23/P24 to amplify flp1 and P25/P26 to amplify tadA (Table 2) as described above. In addition, Western blots were performed on whole-cell lysates and probed with rabbit polyclonal sera specific to both Flp1 and Flp2 (kindly provided by E. Hansen) and a monclonal antibody to PAL, as described previously (33, 42).
Oxidative stress and heat shock assays.
35000HP(pLS88), 35000HPΔcsrA(pLS88), and 35000HPΔcsrA(pcsrA) were grown to mid-log or stationary phase; approximately 108 cells were either not treated or exposed to 0.2 or 2.0 mM H2O2 (Sigma-Aldrich) or 0.2 or 2.0 mM paraquat (Sigma-Aldrich) at 33°C for 1 h in GC broth and quantitatively cultured. In some experiments, the cultures were supplemented with sodium pyruvate at a final concentration of 10 mM. To assess the effect of the csrA mutation on the ability to survive heat shock, stationary-phase bacteria were incubated at 33°C or 37°C for 1 h in GC broth and quantitatively cultured. Percent survival was determined by calculating the ratio of recovered CFU to initial CFU.
To determine if the csrA mutation affected the transcript levels of known and putative oxidative stress and heat shock defense genes, total RNA was extracted from stationary-phase 35000HP and 35000HPΔcsrA as described above. qRT-PCR was performed using the primer pairs P27/P28 to amplify groEL; P29/P30, oxyR; P31/P32, sodC; P33/P34, bcp; and P35/P36, rpoE.
Macrophage survival assays.
Leukopacks were obtained from four anonymous donors from the Central Indiana Regional Blood Center. Human peripheral blood mononuclear cells (PBMC) were isolated from leukopacks by Ficoll-Paque Plus purification. CD14+ cells were isolated from PBMC by positive selection using CD14 magnetic microbeads (Miltenyi Biotech) by following the manufacturer's instructions. The CD14+ cells were differentiated into monocyte-derived macrophages (MDM) in X-Vivo 15 medium (Lonza) supplemented with 1% heat-inactivated human AB serum (Invitrogen) for 5 days. After being harvested by centrifugation, 2.5 × 105 to 4.0 × 105 MDM were seeded into wells of 24-well tissue culture plates and incubated for 1 day. Bacteria were grown to either mid-log or stationary phase and were either not opsonized or opsonized with 100% complement-replete normal human serum for 20 min at room temperature. After being washed with Hanks' balanced salt solution (HBSS), the MDM were infected with 35000HP(pLS88), 35000HPΔcsrA(pLS88), or 35000HPΔcsrA(pcsrA) at an MOI of 10:1. Following centrifugation at 180 × g for 5 min to synchronize infection, the cells were incubated in HBSS for 30 min at 35°C in 5% CO2. To kill extracellular bacteria, the cells were incubated in HBSS containing gentamicin (100 μg/ml) for 30 min and washed with HBSS. To determine bacterial uptake, the MDM were lysed with 0.2% saponin in HBSS at room temperature for 10 min and quantitatively cultured. The percentage of internalized bacteria was calculated as the ratio of gentamicin-protected CFU to initial CFU. To determine the survival of the internalized bacteria, the wells were incubated in antibiotic-free medium containing 10% FBS for an additional 6 h and quantitatively cultured. The percentage of H. ducreyi that survived at 7 h postinfection was calculated as the ratio of recovered to internalized CFU.
Statistical analysis.
The data in this study were analyzed using mixed-model analysis of variance (ANOVA) with experimental days as a random effect followed by Dunnett's or Tukey's procedure for comparisons between one group against all other groups and pairwise multiple comparisons, respectively. A P value of ≤0.05 was considered statistically significant. Throughout, the data are expressed as means ± standard deviations.
RESULTS
Identification of the csrA gene in H. ducreyi.
The H. ducreyi genome contains a homolog of csrA (HD1430) that is in a putative operon whose gene order is uspA→alaS→csrA→galU (Fig. 1A). The genes uspA, alaS, and galU are predicted to encode universal stress protein A, alanyl-tRNA synthetase, and UDP-glucose pyrophosphorylase, respectively. RT-PCR amplification of the uspA-alaS, alaS-csrA, and csrA-galU intergenic regions yielded products of 190, 122, and 77 bp, respectively, confirming that csrA was cotranscribed with uspA, alaS, and galU (Fig. 1B). By qRT-PCR, csrA transcript levels were similar in bacteria grown to mid-log phase and stationary phase (data not shown). The csrA gene was detected by PCR in both class I and class II H. ducreyi clinical isolates from different geographical regions (Fig. 1C). The csrA DNA sequences from one class I strain (35000HP) and one class II strain (CIP542 ATCC) were identical (data not shown).
Fig 1.
csrA locus in H. ducreyi. (A) Genomic organization of the csrA locus in H. ducreyi. The small arrows indicate the location of intergenic primers used for RT-PCR analysis. (B) Agarose gel electrophoresis of products amplified by RT-PCR. Lanes 1, 2, and 3 represent intergenic regions of csrA-galU, alaS-csrA, and uspA-alaS, respectively; lane 4, no reverse transcriptase control; lane 5, no template control. (C) PCR amplification of the csrA gene from class I and class II H. ducreyi clinical isolates. Lane 1, no template PCR control; lanes 2, 3, 4, 5, 6, and 7 represent class I strains 35000HP, HD183, HD188, 82-029362, 6644, and 85-023233, respectively; lanes 8, 9, 10, and 11 represent class II strains CIP542 ATCC, HMC112, 33921, and DMC64, respectively. (D) Alignment of CsrA amino acid sequence from different bacterial species. Conserved regions mentioned in the text are boxed. An asterisk (*) indicates conserved residues; colon (:) indicates conservation between strongly similar amino acids; and period (.) indicates conservation between weakly similar amino acids. EC, E. coli; HD, H. ducreyi; AP, A. pleuropneumoniae; and HI, H. influenzae.
By BLAST analysis, H. ducreyi CsrA had 80%, 77%, and 66%, amino acid identity to the CsrA protein of Actinobacillus pleuropneumoniae, H. influenzae, and E. coli, respectively (Fig. 1D). Similar to E. coli CsrA, H. ducreyi CsrA consisted of 61 amino acids. The two regions of the protein (residues 2 to 7 [LILTRR] and 40 to 47 [VSVHREEI]) that are critical for RNA binding and regulation in E. coli (43) were highly conserved in H. ducreyi CsrA (Fig. 1D).
To understand the role of CsrA in H. ducreyi pathogenesis, we generated an unmarked, in-frame deletion mutant of csrA. PCR and sequence analysis confirmed that the csrA gene was deleted except for the start codon and the terminal 21 bp of the csrA ORF; qRT-PCR analysis showed that the expression of the downstream gene, galU, was unchanged in the mutant compared to that in the wild type (data not shown). By quantitative culture, the growth of the mutant in GC broth was unchanged relative to that of the wild type (data not shown). Compared to the wild type, the OMP and LOS profiles and the serum resistance of the mutant were unaltered (data not shown).
CsrA contributes to H. ducreyi virulence in human volunteers.
To test if CsrA contributes to virulence in humans, we inoculated three groups of volunteers with 35000HP and the csrA mutant in dose ranging studies. In the model, papule formation signifies initiation of infection, while pustule formation signifies the ability of the organism to escape host defenses (7). The first group of three volunteers was inoculated at three sites with an EDD of 146 CFU of the parent in one arm and at three sites with an EDD of 39, 78, and 155 CFU of the mutant in the other arm. In the second iteration, one participant was inoculated at three sites with an EDD of 113 CFU of the parent and with an EDD of 47, 94, and 187 CFU of the mutant. An interim analysis indicated that the mutant could be partially attenuated for pustule formation. Thus, a third group of three participants was inoculated at three sites with equivalent doses of the parent (136 CFU) and the mutant (104 CFU). Overall, papules formed at 76.2% (95% CI, 58.9 to 93.5%) of the parent-inoculated sites and at 71.4% (95% CI, 47.0 to 95.9%) of the mutant-inoculated sites (P = 0.7) (Table 3). After 24 h of infection, the mean size of papules was 12.1 ± 8.7 mm2 at parent sites and 4.8 ± 4.5 mm2 at mutant sites (P = 0.0002). Pustules formed at 66.7% (95% CI, 43.8 to 89.5%) of parent sites and at 33.3% (95% CI, 6.9 to 59.7%) of mutant sites (P = 0.022) (Table 3). Thus, the csrA mutant met the criteria for partial attenuation in the model (7).
Table 3.
Response to inoculation with live H. ducreyi
| Volunteer (gender)a | Observation period (days) | Strainb | Dose (CFU)c | No. of initial papules | Final outcome of papule |
|
|---|---|---|---|---|---|---|
| No. resolved | No. of pustules | |||||
| 411 (M) | 6 | P | 146 | 2 | 2 | |
| M | 39-155 | 0 | 0 | |||
| 412 (M) | 8 | P | 146 | 3 | 2 | 1 |
| M | 39-155 | 2 | 2 | 0 | ||
| 413 (F) | 8 | P | 146 | 2 | 2 | |
| M | 39-155 | 3 | 3 | |||
| 414 (F) | 7 | P | 113 | 2 | 2 | 0 |
| M | 47-187 | 2 | 1 | 1 | ||
| 417 (F) | 8 | P | 136 | 2 | 2 | |
| M | 104 | 2 | 2 | 0 | ||
| 418 (M) | 6 | P | 136 | 3 | 3 | |
| M | 104 | 3 | 2 | 1 | ||
| 419 (M) | 7 | P | 136 | 3 | 3 | |
| M | 104 | 3 | 2 | |||
Volunteer 411, 412, and 413 were inoculated in the first iteration; volunteer 414 in the second iteration; volunteers 417, 418, and 419 in the third iteration. M, male; F, female.
P, parent strain 35000HP; M, mutant strain 35000HPΔcsrA.
Doses inoculated at 3 sites, except 39-155, one dose each of 39, 78, and 155 CFU; 47-187, one dose each of 47, 94, and 187 CFU.
At least one positive surface culture for H. ducreyi was obtained during follow-up visits from 38.1% of the parent-inoculated and 28.6% of the mutant-inoculated sites. All colonies recovered from the surface cultures of the parent sites (n = 211) and mutant sites (n = 72) were tested for the presence of csrA and dnaE sequences by colony hybridization. The dnaE probe hybridized to colonies from both parent and mutant sites, while the csrA probe hybridized to only colonies from parent sites. Of 3 biopsy specimens cultured from parent sites, 3 yielded H. ducreyi. Of 5 biopsy specimens cultured from mutant sites, 5 yielded H. ducreyi. By colony hybridization, the dnaE probe hybridized to all colonies recovered from biopsy specimens of both parent (n = 108) and mutant (n = 124) sites; the csrA probe hybridized to only colonies derived from parent sites. Similarly, the dnaE probe hybridized to all the colonies tested from the parent (n = 105) and mutant (n = 105) inocula, while the csrA probe hybridized only to colonies derived from parent inocula. Thus, there was no evidence of cross-contamination between mutant and parent sites.
Three participants (413, 418, and 419) developed pustules at both mutant-inoculated and parent-inoculated sites. One mutant site and one parent site were biopsied from each subject and stained with hematoxylin-eosin and anti-CD3 antibodies as described previously (44). All samples contained micropustules in the epidermis and a dermal infiltrate of perivascular CD3+ cells. Thus, pustules that formed at mutant sites were indistinguishable from those that formed at the parent sites, as has been described for other partially attenuated mutants (7).
CsrA is important for H. ducreyi adherence to HFF cells.
To understand the mechanisms underlying CsrA-mediated virulence in humans, we compared the csrA mutant to its parent in several in vitro models of pathogenesis. CsrA affects bacterial adherence to host cells (45, 46). Therefore, we compared the adherence of 35000HP(pLS88), 35000HPΔcsrA(pLS88), and 35000HPΔcsrA(pcsrA) to HFF cells. The csrA mutant attached to HFF cells at significantly lower levels than did the parent and the complemented strain (Fig. 2A). Thus, CsrA contributed to the adherence of H. ducreyi to HFF cells.
Fig 2.
H. ducreyi adherence to HFF cells. (A) Percent adherence of 35000HP(pLS88), 35000HPΔcsrA(pLS88), 35000HPΔcsrA(pcsrA), and 35000HPΔflp1-3(pLS88) to HFF cells calculated as follows: (geometric mean CFU of HFF-adherent bacteria/geometric mean CFU of initial bacteria added per well) × 100. The data represent the means ± SD from 4 independent experiments. *, P ≤ 0.05; **, P ≤ 0.01; and ***, P ≤ 0.001. (B) Western blot of Flp1 and Flp2 expression in 35000HP and 35000HPΔcsrA. Whole-cell lysates were separated by SDS-PAGE and probed with Flp1 antiserum, which binds to both Flp1 and Flp2, as the primary antibody. The PAL protein was detected by the monoclonal antibody 3B9 and served as a loading control. The relative level of expression of Flp1-2 for the csrA mutant was 49% that of the parent. The blot is representative of four independent experiments.
The adherence of H. ducreyi to HFF cells is primarily mediated by the Flp proteins, which are encoded by the flp-tad locus (8, 42). The flp-tad locus contains 15 genes (flp1-flp2-flp3-orfBC-rcpAB-orfD-tadABCDEFG), which are transcribed together in an operon. We also compared the adherence of 35000HPΔcsrA(pLS88) with that of 35000HPΔflp1-3(pLS88), which contains a deletion of the 3 flp genes. Both the csrA mutant and the flp1-3 mutant attached to HFF cells at similar levels; both mutants attached to HFF cells at significantly lower levels than the parent and the complemented strain (Fig. 2A). Thus, the adherence defect of the csrA mutant was comparable to that of the flp1-3 mutant.
To determine if the csrA deletion affected the expression of the flp-tad operon, we compared the expression of flp1 and tadA in the csrA mutant to that of the parent. Compared to the parent, expression of flp1 and tadA transcripts was 2 ± 0.3-fold and 5 ± 0.2-fold downregulated, respectively, in the csrA mutant. Western blot analysis confirmed the downregulation of Flp1 and Flp2 (Fig. 2B). Thus, downregulation of the expression of genes in the flp-tad locus correlated with the decreased adherence of the mutant.
CsrA contributes to resistance to oxidative stress and heat shock.
CsrA controls bacterial responses to oxidative stress (46, 47). During infection, H. ducreyi likely encounters oxidative stress in the form of reactive oxygen species (ROS). ROS are generated exogenously by the oxidative burst from phagocytic cells and endogenously by aerobic metabolism; these oxidative stress conditions can be mimicked by treatment with hydrogen peroxide and paraquat, respectively. Therefore, we compared the survival of 35000HP(pLS88), 35000HPΔcsrA(pLS88), and 35000HPΔcsrA(pcsrA) grown to mid-log and stationary phase after exposure to these oxidizing agents. When bacteria in either phase of growth were treated with 0.2 mM H2O2 or 0.2 mM paraquat, the mean ± standard deviation (SD) percent survival was not significantly different for the parent, the mutant, and the complemented strain (data not shown). When bacteria in either phase of growth were treated with 2 mM H2O2 or 2 mM paraquat, the csrA mutant survived at significantly lower levels than did the parent and the complemented strain (Fig. 3). The mutant bacteria grown to stationary phase seemed to be apparently more susceptible to H2O2- or paraquat-induced oxidative stress than those grown to mid-log phase (Fig. 3). Supplementation with 10 mM sodium pyruvate, an ROS scavenger, fully rescued both the H2O2- and paraquat-induced oxidative stress phenotypes in the mutant (Fig. 3). Exogenous sodium pyruvate did not enhance the growth of the parent or the complemented strain (data not shown). Thus, CsrA contributed to the ability of H. ducreyi to survive oxidative stress and seemed to have a more pronounced role in stationary-phase bacteria than in mid-log-phase bacteria.
Fig 3.
Percent survival of 35000HP(pLS88), 35000HPΔcsrA(pLS88), and 35000HPΔcsrA(pcsrA) following treatment with 2.0 mM H2O2 or 2.0 mM paraquat for 1 h calculated as follows: (geometric mean CFU after treatment/geometric mean CFU before treatment) × 100. Where indicated, 35000ΔcsrA(pLS88) was also treated with 10 mM sodium pyruvate. The data are means ± SD from 5 independent experiments. *, P ≤ 0.05; **, P ≤ 0.01; ***, P ≤ 0.001; and ****, P ≤ 0.0001.
In Helicobacter pylori, CsrA regulates responses to heat shock (47). Most H. ducreyi strains grow optimally at 33°C. Therefore, we compared the survival of 35000HP(pLS88), 35000HPΔcsrA(pLS88), and 35000HPΔcsrA(pcsrA) after incubation at 37°C for 1 h. When bacteria from either growth phase were heat shocked, the csrA mutant survived at significantly lower levels than did the parent and the complemented strain (Fig. 4). Thus, CsrA also plays a role in the H. ducreyi response to heat shock.
Fig 4.

Percent survival of 35000HP(pLS88), 35000HPΔcsrA(pLS88), and 35000HPΔcsrA(pcsrA) following heat shock at 37°C for 1 h calculated as follows: (geometric mean CFU after heat shock/geometric mean CFU before heat shock) × 100. The data are means ± SD from 4 independent experiments. **, P ≤ 0.01; and ***, P ≤ 0.001.
As the csrA mutant was more susceptible to oxidative stress and heat shock, we determined if CsrA regulated the expression of genes that may encode proteins that are involved in oxidative stress and heat shock defense. The genes sodC and groEL encode the periplasmic Cu-Zn superoxide dismutase (48) and the molecular chaperone GroEL (49), respectively, while oxyR, rpoE, and bcp are predicted to encode homologs of the hydrogen peroxide-inducible gene activator, sigma E, and the thioredoxin-dependent thiol peroxidase, respectively. Stationary-phase bacteria were used for the analysis of transcript levels. Compared to the parent, the transcript levels of the selected genes were unaltered in the csrA mutant (data not shown). Due to lack of available antibodies, we did not test the protein levels encoded by these genes in the csrA mutant. Thus, the mechanism by which H. ducreyi CsrA mediates responses to these stresses is unclear.
The csrA mutant is defective in intracellular survival within macrophages.
In both experimental pustules and naturally occurring chancroid ulcers, H. ducreyi colocalizes with neutrophils and macrophages (50, 51). Therefore, we compared the uptake of 35000HP(pLS88), 35000HPΔcsrA(pLS88), and 35000HPΔcsrA(pcsrA) by human macrophages 1 h after infection and the survival of the intracellular bacteria 6 h later. Similar patterns of uptake were obtained with nonopsonized H. ducreyi or bacteria opsonized with 100% complement-replete normal human serum (data not shown); the data presented here were generated using nonopsonized bacteria. For both mid-log and stationary-phase-grown cells, the mean ± SD percent uptake was similar for the parent, the mutant, and the complemented strain (Fig. 5). For mid-log-phase-grown cells, the mean ± SD percent survival in macrophages was not significantly different for the parent and the mutant (Fig. 5). However, for stationary-phase-grown cells, the csrA mutant survived at significantly lower levels than did the parent and the complemented strain (Fig. 5). Thus, CsrA contributed to the survival of stationary-phase H. ducreyi in macrophages.
Fig 5.
Percent uptake and survival of 35000HP(pLS88), 35000HPΔcsrA(pLS88), and 35000HPΔcsrA(pcsrA) within human macrophages. Human CD14+ cells were differentiated into monocyte-derived macrophages (MDM). MDM were infected with nonopsonized H. ducreyi for 30 min at an MOI of 10:1 and incubated with gentamicin for 30 min to kill extracellular bacteria. The percent uptake was calculated as follows: (geometric mean CFU of gentamicin-protected bacteria/geometric mean CFU of initial bacteria) × 100. The percentage of H. ducreyi that survived after uptake was calculated as follows: (geometric mean CFU of bacteria that survived at 6 h posttreatment with gentamicin/geometric mean CFU of bacteria initially internalized) × 100. The values represent the means ± SD from assays done with macrophages from 4 donors. **, P ≤ 0.01.
DISCUSSION
To establish a successful infection, H. ducreyi must be able to sense and respond to numerous environmental cues in the host. The posttranscriptional global regulator CsrA controls many properties that allow bacteria to rapidly adapt to new and changing microenvironments. Here, we showed that CsrA partially contributes to H. ducreyi virulence in humans. The in vivo defect in virulence correlated with the reduced ability of the csrA mutant to resist oxidative stress and heat shock and to survive within human macrophages in vitro. Overall, our findings suggest an important role for CsrA in H. ducreyi pathogenesis in humans.
The csrA mutant caused papules that were significantly smaller than its parent and formed pustules at a rate that was 50% less than its parent. The csrA mutant seemed more impaired in resisting oxidative stress and macrophage killing when grown to stationary phase compared to mid-log phase. Despite these in vitro phenotypes, the csrA mutant was only partially attenuated for virulence in humans. Based on quantitative culture of endpoint pustules, the estimated minimal doubling time of H. ducreyi in human skin is 16.5 ± 3.8 h (52). However, the rates at which individual bacteria grow in vivo are unknown. We speculate that the partial attenuation of the csrA mutant may be due to the fact that rapidly dividing cells can still escape host defenses in the absence of CsrA.
The ability of H. ducreyi to adhere to HFF cells has been correlated with virulence in humans (8, 42); mutants that do not express Flp proteins are fully attenuated in humans (8, 53). Deletion of csrA downregulated but did not fully eliminate Flp protein expression both at the transcript and protein levels and also downregulated the expression of tadA at the transcript level. The fact that the csrA mutant and the flp1-3 mutant bound to HFF cells at similar rates may reflect the downregulation of the Flp proteins and the tad-encoded secretory apparatus in the csrA mutant. Alternatively, deletion of csrA may reduce the expression of other unidentified adherence determinants. These data indicate that the ability of H. ducreyi to bind to HFF cells does not perfectly correlate with virulence, which is in agreement with previous findings that H. ducreyi does not colocalize with fibroblasts in both experimental and natural infection (50, 51). Partial expression of the Flp proteins in the csrA mutant may also have facilitated its partial virulence in humans.
Compared to its parent, the H. ducreyi csrA mutant was sensitive to both H2O2- and paraquat-induced oxidative stress. The addition of exogenous pyruvate fully rescued the oxidative stress phenotype of the H. ducreyi csrA mutant. CsrA is a global regulator of carbon metabolism. In E. coli, a csrA mutant has reduced glycolytic flux (54), suggesting that CsrA positively regulates glycolysis. Pyruvate, the end product of glycolysis, not only acts as an energy source but also is a well-known scavenger of oxidative-free radicals (55, 56). Therefore, H. ducreyi CsrA might contribute to oxidative stress defense via modulating intracellular pyruvate levels.
Compared to its parent, the H. ducreyi csrA mutant had a reduced ability to survive within human macrophages. In both experimental and natural infection, H. ducreyi colocalizes with macrophages and is found extracellularly (50, 51). Whether some of the bacteria are engulfed and cleared by macrophages is unknown. Macrophages are dynamic and heterogeneous cells (57). During infection, macrophages are polarized to classically activated M1 cells and alternatively activated M2 cells; macrophages at H. ducreyi-infected sites have mixed M1 and M2 phenotypes (58). Monocyte-derived macrophages polarized to the M2 phenotype take up to 20% of H. ducreyi; up to 4% of the internalized bacteria survive in macrophages 7 h postinfection (58), suggesting that H. ducreyi can resist intracellular killing to some extent. Macrophages primarily utilize the oxidative burst to kill internalized bacteria. Consistent with its increased sensitivity to oxidative stress, the reduced ability of the csrA mutant to survive within macrophages may be due to its relative inability to tolerate the oxidative burst.
In Campylobacter jejuni, CsrA is required for resistance to oxidative stress, motility, adherence, and virulence; CsrA affects mainly protein expression in cells grown to stationary phase (46, 59). In H. pylori, CsrA also positively regulates resistance to oxidative stress, motility, and virulence (47). In contrast, CsrA represses many phenotypes associated with the virulence of Legionella pneumophila, including stress resistance, motility, and the ability to infect macrophages (60). In a murine model of Pseudomonas aeruginosa acute pneumonia, the CsrA homolog RsmA is required for colonization and dissemination; however, in a murine model of chronic pneumonia, deletion of rsmA increases chronic persistence and inflammation (61). P. aeruginosa (62) and L. pneumophila (63) contain RpoS, which regulates stress and stationary-phase survival in many Gram-negative bacteria; but C. jejuni (64), H. pylori (47), and H. ducreyi lack an obvious homolog of RpoS. As CsrA positively regulates stress responses and virulence in C. jejuni, H. pylori, and H. ducreyi, the data suggest that CsrA may have evolved to regulate stationary phase and stress survival in the absence of RpoS. This hypothesis is also consistent with the more pronounced phenotypes of the H. ducreyi csrA mutant grown to stationary phase. These data also demonstrate that CsrA makes different contributions to virulence in different pathogens.
CsrA represses many genes and processes associated with stationary-phase growth of E. coli, including biofilm formation, cell morphology, and glycogen synthesis (20). In E. coli, csrA expression increases as the cells transition from logarithmic phase to stationary phase; this increase in csrA expression is due largely to RpoS-dependent transcription of csrA (65). The H. ducreyi csrA mutant also had more profound phenotypes in bacteria grown to stationary phase compared to bacteria grown to mid-log phase. However, the expression of H. ducreyi csrA was similar across growth phases. Therefore, the mechanism by which H. ducreyi CsrA causes more profound phenotypic changes in stationary phase is unclear.
In summary, the H. ducreyi csrA mutant was partially attenuated for virulence in humans, which correlated with its reduced ability to survive oxidative stress and in the intracellular environment of macrophages. To understand the molecular mechanisms underlying this attenuation, future studies will focus on defining the direct targets of H. ducreyi CsrA. In E. coli, CsrA is regulated by the small RNAs CsrB and CsrC. However, the H. ducreyi genome contains no obvious homologs of these small RNAs; it also will be interesting to determine how H. ducreyi CsrA is regulated.
ACKNOWLEDGMENTS
This work was supported by grant AI27863 to S.M.S. from the National Institutes of Allergy and Infectious Diseases (NIAID). The human challenge trials were also supported by the Indiana Clinical and Translational Sciences Institute and the Indiana Clinical Research Center (UL RR052761).
All authors have no relevant financial relationships to disclose.
We thank Margaret Bauer for her thoughtful criticism of the manuscript and the volunteers who participated in the trial.
Footnotes
Published ahead of print 10 December 2012
REFERENCES
- 1. Steen R. 2001. Eradicating chancroid. Bull. World Health Organ. 79:818–826 [PMC free article] [PubMed] [Google Scholar]
- 2. Spinola SM, Ballard RC. 2010. Chancroid, p 141–156 In Morse SA, Holmes KK, Ballard RC. (ed), Atlas of sexually transmitted diseases and AIDS, 4th ed Saunders, Philadelphia, PA [Google Scholar]
- 3. Spinola SM. 2008. Chancroid and Haemophilus ducreyi, p 689–699 In Holmes KK, Sparling PF, Stamm WE, Piot P, Wasserheit JN, Corey L, Cohen MS, Watts DH. (ed), Sexually transmitted diseases, 4th ed McGraw-Hill, New York, NY [Google Scholar]
- 4. McBride WJ, Hannah RC, Le Cornec GM, Bletchly C. 2008. Cutaneous chancroid in a visitor from Vanuatu. Australas. J. Dermatol. 49:98–99 [DOI] [PubMed] [Google Scholar]
- 5. Peel TN, Bhatti D, De Boer JC, Stratov I, Spelman DW. 2010. Chronic cutaneous ulcers secondary to Haemophilus ducreyi infection. Med. J. Aust. 192:348–350 [DOI] [PubMed] [Google Scholar]
- 6. Ussher JE, Wilson E, Campanella S, Taylor SL, Roberts SA. 2007. Haemophilus ducreyi causing chronic skin ulceration in children visiting Samoa. Clin. Infect. Dis. 44:e85–e87 [DOI] [PubMed] [Google Scholar]
- 7. Janowicz DM, Ofner S, Katz BP, Spinola SM. 2009. Experimental infection of human volunteers with Haemophilus ducreyi: fifteen years of clinical data and experience. J. Infect. Dis. 199:1671–1679 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Janowicz DM, Cooney SA, Walsh J, Baker B, Katz BP, Fortney KR, Zwickl B, Ellinger S, Munson JRS. 2011. Expression of the Flp proteins by Haemophilus ducreyi is necessary for virulence in human volunteers. BMC Microbiol. 11:208. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Labandeira-Rey M, Janowicz DM, Blick RJ, Fortney KR, Zwickl B, Katz BP, Spinola SM, Hansen EJ. 2009. Inactivation of the Haemophilus ducreyi luxS gene affects the virulence of this pathogen in human subjects. J. Infect. Dis. 200:409–416 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Mount KL, Townsend CA, Rinker SD, Gu X, Fortney KR, Zwickl BW, Janowicz DM, Spinola SM, Katz BP, Bauer ME. 2010. Haemophilus ducreyi SapA contributes to cathelicidin resistance and virulence in humans. Infect. Immun. 78:1176–1184 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Rinker SD, Gu X, Fortney KR, Zwickl BW, Katz BP, Janowicz DM, Spinola SM, Bauer ME. 2012. Permeases of the Sap transporter are required for cathelicidin resistance and virulence of Haemophilus ducreyi in humans. J. Infect. Dis. 206:1407–1414 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Spinola SM, Fortney KR, Baker B, Janowicz DM, Zwickl B, Katz BP, Blick RJ, Munson RS., Jr 2010. Activation of the CpxRA system by deletion of cpxA impairs the ability of Haemophilus ducreyi to infect humans. Infect. Immun. 78:3898–3904 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Labandeira-Rey M, Dodd D, Fortney KR, Zwickl B, Katz BP, Janowicz DM, Spinola SM, Hansen EJ. 2011. A Haemophilus ducreyi cpxR deletion mutant is virulent in human volunteers. J. Infect. Dis. 203:1859–1865 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Timmermans J, Van Melderen L. 2010. Post-transcriptional global regulation by CsrA in bacteria. Cell. Mol. Life Sci. 67:2897–2908 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Romeo T, Vakulskas CA, Babitzke P. 5 June 2012. Post-transcriptional regulation on a global scale: form and function of Csr/Rsm systems. Environ. Microbiol. [Epub ahead of print.] doi:10.1111/j.1462-2920.2012.02794.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Lucchetti-Miganeh C, Burrowes E, Baysse C, Ermel G. 2008. The post-transcriptional regulator CsrA plays a central role in the adaptation of bacterial pathogens to different stages of infection in animal hosts. Microbiology 154:16–29 [DOI] [PubMed] [Google Scholar]
- 17. Pannuri A, Yakhnin H, Vakulskas CA, Edwards AN, Babitzke P, Romeo T. 2012. Translational repression of NhaR, a novel pathway for multi-tier regulation of biofilm circuitry by CsrA. J. Bacteriol. 194:79–89 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Sze CW, Li C. 2011. Inactivation of bb0184, which encodes carbon storage regulator A, represses the infectivity of Borrelia burgdorferi. Infect. Immun. 79:1270–1279 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Williams JW, Ritter AL, Stevens AM. 2012. CsrA modulates luxR transcript levels in Vibrio fischeri. FEMS Microbiol. Lett. 329:28–35 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Romeo T. 1998. Global regulation by the small RNA-binding protein CsrA and the non-coding RNA molecule CsrB. Mol. Microbiol. 29:1321–1330 [DOI] [PubMed] [Google Scholar]
- 21. Suzuki K, Babitzke P, Kushner SR, Romeo T. 2006. Identification of a novel regulatory protein (CsrD) that targets the global regulatory RNAs CsrB and CsrC for degradation by RNase E. Genes Dev. 20:2605–2617 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Romeo T, Gong M, Liu MY, Brun-Zinkernagel AM. 1993. Identification and molecular characterization of csrA, a pleiotropic gene from Escherichia coli that affects glycogen biosynthesis, gluconeogenesis, cell size, and surface properties. J. Bacteriol. 175:4744–4755 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Baker CS, Morozov I, Suzuki K, Romeo T, Babitzke P. 2002. CsrA regulates glycogen biosynthesis by preventing translation of glgC in Escherichia coli. Mol. Microbiol. 44:1599–1610 [DOI] [PubMed] [Google Scholar]
- 24. Liu MY, Romeo T. 1997. The global regulator CsrA of Escherichia coli is a specific mRNA-binding protein. J. Bacteriol. 179:4639–4642 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Wei BL, Brun-Zinkernagel AM, Simecka JW, Pruss BM, Babitzke P, Romeo T. 2001. Positive regulation of motility and flhDC expression by the RNA-binding protein CsrA of Escherichia coli. Mol. Microbiol. 40:245–256 [DOI] [PubMed] [Google Scholar]
- 26. Liu MY, Gui G, Wei B, Preston JF, III, Oakford L, Yuksel U, Giedroc DP, Romeo T. 1997. The RNA molecule CsrB binds to the global regulatory protein CsrA and antagonizes its activity in Escherichia coli. J. Biol. Chem. 272:17502–17510 [DOI] [PubMed] [Google Scholar]
- 27. Weilbacher T, Suzuki K, Dubey AK, Wang X, Gudapaty S, Morozov I, Baker CS, Georgellis D, Babitzke P, Romeo T. 2003. A novel sRNA component of the carbon storage regulatory system of Escherichia coli. Mol. Microbiol. 48:657–670 [DOI] [PubMed] [Google Scholar]
- 28. Gudapaty S, Suzuki K, Wang X, Babitzke P, Romeo T. 2001. Regulatory interactions of Csr components: the RNA binding protein CsrA activates csrB transcription in Escherichia coli. J. Bacteriol. 183:6017–6027 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Suzuki K, Wang X, Weilbacher T, Pernestig AK, Melefors O, Georgellis D, Babitzke P, Romeo T. 2002. Regulatory circuitry of the CsrA/CsrB and BarA/UvrY systems of Escherichia coli. J. Bacteriol. 184:5130–5140 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Lee EC, Yu D, Martinez de Velasco J, Tessarollo L, Swing DA, Court DL, Jenkins NA, Copeland NG. 2001. A highly efficient Escherichia coli-based chromosome engineering system adapted for recombinogenic targeting and subcloning of BAC DNA. Genomics 73:56–65 [DOI] [PubMed] [Google Scholar]
- 31. Al-Tawfiq JA, Thornton AC, Katz BP, Fortney KR, Todd KD, Hood AF, Spinola SM. 1998. Standardization of the experimental model of Haemophilus ducreyi infection in human subjects. J. Infect. Dis. 178:1684–1687 [DOI] [PubMed] [Google Scholar]
- 32. Bauer ME, Townsend CA, Doster RS, Fortney KR, Zwickl BW, Katz BP, Spinola SM, Janowicz DM. 2009. A fibrinogen-binding lipoprotein contributes to the virulence of Haemophilus ducreyi in humans. J. Infect. Dis. 199:684–692 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Spinola SM, Griffiths GE, Bogdan JA, Menegus MA. 1992. Characterization of an 18,000 molecular-weight outer membrane protein of Haemophilus ducreyi that contains a conserved surface-exposed epitope. Infect. Immun. 60:385–391 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Hammond GW, Lian CJ, Wilt JC, Ronald AR. 1978. Antimicrobial susceptibility of Haemophilus ducreyi. Antimicrob. Agents Chemother. 13:608–612 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 35. White CD, Leduc I, Jeter C, Harris C, Elkins C. 2005. Haemophilus ducreyi outer membrane determinants, including DsrA, define two clonal populations. Infect. Immun. 73:2387–2399 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Elkins C, Morrow KJ, Olsen B. 2000. Serum resistance in Haemophilus ducreyi requires outer membrane protein DsrA. Infect. Immun. 68:1608–1619 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Bozue JA, Tarantino L, Munson RS., Jr 1998. Facile construction of mutations in Haemophilus ducreyi using lacz as a counter-selectable marker. FEMS Microbiol. Lett. 164:269–273 [DOI] [PubMed] [Google Scholar]
- 38. Dixon LG, Albritton WL, Willson PJ. 1994. An analysis of the complete nucleotide sequence of the Haemophilus ducreyi broad-host-range plasmid pLS88. Plasmid 32:228–232 [DOI] [PubMed] [Google Scholar]
- 39. Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, Lopez R, McWilliam H, Remmert M, Soding J, Thompson JD, Higgins DG. 2011. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Sys. Biol. 7:539. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40. Tracy E, Ye F, Baker BD, Munson RS., Jr 2008. Construction of non-polar mutants in Haemophilus influenzae using FLP recombinase technology. BMC Mol. Biol. 9:101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 41. Apicella MA, Griffiss JM, Schneider H. 1994. Isolation and characterization of lipopolysaccharides, lipooligosaccharides, and lipid A. Methods Enzymol. 235:242–252 [DOI] [PubMed] [Google Scholar]
- 42. Nika JR, Latimer JL, Ward CK, Blick RJ, Wagner NJ, Cope LD, Mahairas GG, Munson JRS, Hansen EJ. 2002. Haemophilus ducreyi requires the flp gene cluster for microcolony formation in vitro. Infect. Immun. 70:2965–2975 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Mercante J, Suzuki K, Cheng X, Babitzke P, Romeo T. 2006. Comprehensive alanine-scanning mutagenesis of Escherichia coli CsrA defines two subdomains of critical functional importance. J. Biol. Chem. 281:31832–31842 [DOI] [PubMed] [Google Scholar]
- 44. Young RS, Fortney K, Haley JC, Hood AF, Campagnari AA, Wang J, Bozue JA, Munson RSJ, Spinola SM. 1999. Expression of sialylated or paragloboside-like lipooligosaccharides are not required for pustule formation by Haemophilus ducreyi in human volunteers. Infect. Immun. 67:6335–6340 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Bhatt S, Edwards AN, Nguyen HT, Merlin D, Romeo T, Kalman D. 2009. The RNA binding protein CsrA is a pleiotropic regulator of the locus of enterocyte effacement pathogenicity island of enteropathogenic Escherichia coli. Infect. Immun. 77:3552–3568 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 46. Fields JA, Thompson SA. 2008. Campylobacter jejuni CsrA mediates oxidative stress responses, biofilm formation, and host cell invasion. J. Bacteriol. 190:3411–3416 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Barnard FM, Loughlin MF, Fainberg HP, Messenger MP, Ussery DW, Williams P, Jenks PJ. 2004. Global regulation of virulence and the stress response by CsrA in the highly adapted human gastric pathogen Helicobacter pylori. Mol. Microbiol. 51:15–32 [DOI] [PubMed] [Google Scholar]
- 48. San Mateo LR, Hobbs MM, Kawula TH. 1998. Periplasmic copper-zinc superoxide dismutase protects Haemophilus ducreyi from exogenous superoxide. Mol. Microbiol. 27:391–404 [DOI] [PubMed] [Google Scholar]
- 49. Parsons LM, Limberger RJ, Shayegani M. 1997. Alterations in levels of DnaK and GroEL result in diminished survival and adherence of stressed Haemophilus ducreyi. Infect. Immun. 65:2413–2419 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 50. Bauer ME, Goheen MP, Townsend CA, Spinola SM. 2001. Haemophilus ducreyi associates with phagocytes, collagen, and fibrin and remains extracellular throughout infection of human volunteers. Infect. Immun. 69:2549–2557 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Bauer ME, Townsend CA, Ronald AR, Spinola SM. 2006. Localization of Haemophilus ducreyi in naturally acquired chancroidal ulcers. Microbes Infect. 8:2465–2468 [DOI] [PubMed] [Google Scholar]
- 52. Throm RE, Spinola SM. 2001. Transcription of candidate virulence genes of Haemophilus ducreyi during infection of human volunteers. Infect. Immun. 69:1483–1487 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53. Spinola SM, Fortney KR, Katz BP, Latimer JL, Mock JR, Vakevainen M, Hansen EJ. 2003. Haemophilus ducreyi requires an intact flp gene cluster for virulence in humans. Infect. Immun. 71:7178–7182 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 54. Sabnis NA, Yang H, Romeo T. 1995. Pleiotropic regulation of central carbohydrate metabolism in Escherichia coli via the gene csrA. J. Biol. Chem. 270:29096–29104 [DOI] [PubMed] [Google Scholar]
- 55. Droge W. 2002. Free radicals in the physiological control of cell function. Physiol. Rev. 82:47–95 [DOI] [PubMed] [Google Scholar]
- 56. O'Donnell-Tormey J, Nathan CF, Lanks K, DeBoer CJ, de la Harpe J. 1987. Secretion of pyruvate. An antioxidant defense of mammalian cells. J. Exp. Med. 165:500–514 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57. Sica A, Mantovani A. 2012. Macrophage plasticity and polarization: in vivo veritas. J. Clin. Inv. 122:787–795 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58. Li W, Katz BP, Spinola SM. 2012. Haemophilus ducreyi-induced IL-10 promotes a mixed M1 and M2 activation program in human macrophages. Infect. Immun. 80:4426–4434 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59. Fields JA. 2012. Regulation of virulence in the human pathogen Campylobacter jejuni by the RNA binding protein CsrA. PhD Medical College of Georgia, Augusta, GA [Google Scholar]
- 60. Molofsky AB, Swanson MS. 2003. Legionella pneumophila CsrA is a pivotal repressor of transmission traits and activator of replication. Mol. Microbiol. 50:445–461 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 61. Mulcahy H, O'Callaghan J, O'Grady EP, Macia MD, Borrell N, Gomez C, Casey PG, Hill C, Adams C, Gahan CG, Oliver A, O'Gara F. 2008. Pseudomonas aeruginosa RsmA plays an important role during murine infection by influencing colonization, virulence, persistence, and pulmonary inflammation. Infect. Immun. 76:632–638 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62. Jorgensen F, Bally M, Chapon-Herve V, Michel G, Lazdunski A, Williams P, Stewart GS. 1999. RpoS-dependent stress tolerance in Pseudomonas aeruginosa. Microbiology 145(Part 4):835–844 [DOI] [PubMed] [Google Scholar]
- 63. Hovel-Miner G, Pampou S, Faucher SP, Clarke M, Morozova I, Morozov P, Russo JJ, Shuman HA, Kalachikov S. 2009. SigmaS controls multiple pathways associated with intracellular multiplication of Legionella pneumophila. J. Bacteriol. 191:2461–2473 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 64. Kelly AF, Park SF, Bovill R, Mackey BM. 2001. Survival of Campylobacter jejuni during stationary phase: evidence for the absence of a phenotypic stationary-phase response. Appl. Environ. Microbiol. 67:2248–2254 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65. Yakhnin H, Yakhnin AV, Baker CS, Sineva E, Berezin I, Romeo T, Babitzke P. 2011. Complex regulation of the global regulatory gene csrA: CsrA-mediated translational repression, transcription from five promoters by Eσ70 and Eσ(S), and indirect transcriptional activation by CsrA. Mol. Microbiol. 81:689–704 [DOI] [PMC free article] [PubMed] [Google Scholar]




