Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2013 Jan;87(2):1049–1060. doi: 10.1128/JVI.02017-12

Influenza Virus Induces Apoptosis via BAD-Mediated Mitochondrial Dysregulation

Anh T Tran a,b, John P Cortens b, Qiujiang Du b, John A Wilkins b,c,d, Kevin M Coombs a,b,e,✉
PMCID: PMC3554053  PMID: 23135712

Abstract

Influenza virus infection results in host cell death and major tissue damage. Specific components of the apoptotic pathway, a signaling cascade that ultimately leads to cell death, are implicated in promoting influenza virus replication. BAD is a cell death regulator that constitutes a critical control point in the intrinsic apoptosis pathway, which occurs through the dysregulation of mitochondrial outer membrane permeabilization and the subsequent activation of downstream apoptogenic factors. Here we report a novel proviral role for the proapoptotic protein BAD in influenza virus replication. We show that influenza virus-induced cytopathology and cell death are considerably inhibited in BAD knockdown cells and that both virus replication and viral protein production are dramatically reduced, which suggests that virus-induced apoptosis is BAD dependent. Our data showed that influenza viruses induced phosphorylation of BAD at residues S112 and S136 in a temporal manner. Viral infection also induced BAD cleavage, late in the viral life cycle, to a truncated form that is reportedly a more potent inducer of apoptosis. We further demonstrate that knockdown of BAD resulted in reduced cytochrome c release and suppression of the intrinsic apoptotic pathway during influenza virus replication, as seen by an inhibition of caspases-3, caspase-7, and procyclic acidic repetitive protein (PARP) cleavage. Our data indicate that influenza viruses carefully modulate the activation of the apoptotic pathway that is dependent on the regulatory function of BAD and that failure of apoptosis activation resulted in unproductive viral replication.

INTRODUCTION

Apoptosis induced during influenza virus infection is a major contributing factor to cell death and tissue damage (1–5). Studies with the 1918 pandemic virus in macaques showed that activation of the apoptotic pathway was a source of tissue damage during infection (6, 7).

Apoptosis, or programmed cell death, is an important cellular signaling response often observed after viral infections. Apoptosis is the process whereby individual cells undergo regulated self-destruction in response to a variety of stimuli. In mammalian cells, the apoptotic pathway can be divided into two signaling cascades: the extrinsic and the intrinsic apoptotic pathways (8). Induction of the extrinsic apoptotic pathway involves the stimulation of death receptors belonging to the tumor necrosis factor receptor (TNFR) family, such as Fas and the tumor necrosis factor-related apoptosis-inducing ligand receptor (TRAIL-R) (8). The intrinsic apoptotic pathway acts through the mitochondria upon activation, and this signaling process is highly regulated by the Bcl-2 family of proteins (9).

The Bcl-2 protein family consists of both anti- and proapoptotic members that form a critical decision point within a common cell death signaling pathway (9). The delicate balance between anti- and proapoptotic protein activities dictates whether a cell will succumb to an apoptotic stimulus or not (10). Our current understanding of the canonical apoptosis mechanism involves activation of the signaling transduction pathway by an external cell death stimulus. The cell death signal is transmitted through proapoptotic factors such as Bax and Bak that go on to inflict mitochrondrial damage and cytochrome c release (11). Inhibition of apoptosis is mainly due to the activities of Bcl-2 and Bcl-xL, which sequester Bax and prevent it from inflicting mitochondrial damage (12). Bcl-2 and Bcl-xL are well-known targets of the proapoptotic protein Bcl-2 antagonist of cell death (BAD), which specifically blocks the activity of both antiapoptotic factors by forming heterodimeric complexes with either of the two proteins and displacing Bax (13, 14).

Apoptosis has long been considered a host cell defense response because various pathogenic viruses express antiapoptotic proteins to prevent this cellular response (15). However, evidence that strongly suggests a number of viruses, including influenza viruses, may manipulate the cell death signaling pathway to promote viral replication is accumulating (4, 16–23). Influenza virus infection resulted in the upregulation of proapoptotic factors, such as TRAIL and the death receptor Fas and its ligand FasL, reportedly via NF-κB induction (22). Blockage of TRAIL and Fas signaling with soluble monoclonal antibodies to their respective receptors resulted in significant reduction of viral titer (22). Proapoptotic factors also play critical proviral roles for other viruses such as HIV-1. A study reported that HIV-1 production was enhanced upon expression of FasL (24).

Several lines of evidence have revealed both an agonistic and an antagonistic role for the Bcl-2 family in influenza virus propagation. Early studies demonstrated that ectopically overexpressed antiapoptotic protein Bcl-2 resulted in impaired virus production and inhibition of influenza virus-induced apoptosis (2, 20). However, proapoptotic proteins Bak and Bax have been reported to have conflicting roles. The results of one study suggested that Bak has an antiviral role in influenza virus replication and was downregulated upon viral infection (17). Paradoxically, Bax activation was necessary for efficient influenza virus propagation (17). Thus, it is likely that only a subset of the proapoptotic Bcl-2 family members positively contribute to influenza virus infection.

BAD is a cell death regulator that constitutes a critical control point in the intrinsic pathway of apoptosis, which occurs through the dysregulation of the mitochondrial outer membrane permeabilization and the subsequent release of apoptogenic factors. We hypothesize that BAD plays an important regulatory role in influenza virus induction of the intrinsic apoptosis signaling cascade. Here we report a novel proviral role for the proapoptotic protein BAD in influenza virus replication. We show that influenza virus-induced cytopathology and cell death is considerably inhibited in BAD knockdown cells and that both virus replication and viral protein production are dramatically reduced in BAD-deficient cells. Knockdown of BAD resulted in reduced cytochrome c release and suppression of the intrinsic apoptotic pathway during influenza virus replication.

MATERIALS AND METHODS

Cells and virus.

HEK-293T cells and A549 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 1× nonessential amino acids (Gibco, Invitrogen), 10% fetal bovine serum (FBS), 1 mM sodium pyruvate, and 2 mM l-glutamine. Influenza virus strains A/New York/55/2004 (H3N2) (NY55), A/Puerto Rico/8/1934 (H1N1) (PR8), and the 2009 pandemic swine origin influenza virus (SOIV) (A/California/07/2009) were grown in 10-day-old embryonated chicken eggs, and the titers of the virus strains were determined on MDCK cells.

Lentivirus packaging and transduction.

Escherichia coli clones containing individual human microRNA-adapted short hairpin RNA (shRNAmir) or a nontargeting shRNAmir control in pGIPZ plasmids were obtained from Open Biosystems. These E. coli clones were cultured in 2× LB (low salt; 2% [wt/vol] Lennox broth, 1% [wt/vol] peptone, 0.5% [wt/vol] yeast extract, 100 μg/ml ampicillin) at 37°C overnight with shaking at 250 rpm. Plasmids were isolated by using the Qiagen Maxiprep kit according to the manufacturer's protocol. Individual shRNAs were packaged into lentivirus particles by cotransfection of each shRNAmir-pGIPZ with pMD2.G and psPAX2 (Addgene plasmids 12259 and 12260, respectively) in HEK-293T cells at a ratio of 2:2:1, respectively, with transfection reagent Arrest-In (Open Biosystems). Lentivirus-containing supernatants were harvested at 48 h and 72 h posttransfection. After the last harvest time point, supernatants were centrifuged at 64,000 × g for 1.5 h at 4°C, and lentivirus-containing pellets were resuspended in serum-free 1× Dulbecco's modified Eagle's medium. The titers of lentivirus particles were determined on A549 cells, and green fluorescent protein (GFP)-expressing cell colonies were enumerated with Axio Observer.Z1 fitted with EC Plan-NEOFLUAR 10×/0.3 Ph1 M27 objective (Carl Zeiss MicroImaging GmbH, Germany). Stable knockdown (KD) A549 cells were produced by transducing with lentivirus at a multiplicity of infection (MOI) of 0.5. At 72 h posttransduction, 3 μg/ml puromycin (Sigma) was added to the medium. The cells were passaged over a 2-week period in puromycin-supplemented complete 1× DMEM to select transductants before they were infected with virus (described under “Influenza virus infection and plaque assay” below). The shRNA sequences are given in Table 1.

Table 1.

shRNA and siRNA sequences to BAD mRNA

Oligonucleotide IDa shRNA sequence siRNA sequence
V2HS_262043 GACTTGGACTTGGATGTAA
V2HS_243025 CAGTGACCTTCGCTCCACA
V2HS_201511 GAGTTTGTGGACTCCTTTA
V2HS_202976 GTGCTCACTACCAAATGTT
V2HS_15289 CTCACTACCAAATGTTAAT
J-003870-09 GAUCGGAACUUGGGCAGGG
J-003870-10 CAGAGUUUGAGCCGAGUGA
J-003870-11 GAGCUCCGGAGGAUGAGUG
J-003870-12 UUGUGGACUCCUUUAAGAA
a

ID, identification.

siRNA transfection.

A549 cells were treated with 25 nM each of 4 ON-Targetplus small interfering RNA (siRNA) (Dharmacon)-targeting host gene or an ON-Targetplus nontargeting siRNA control. siRNAs were introduced into cells with Lipofectamine RNAiMAX (Invitrogen). Serum-free Opti-MEM medium (1×) (Invitrogen) was used to dilute the siRNAs and Lipofectamine RNAiMAX separately; the two diluents were combined and incubated at room temperature for 20 min. After incubation, the transfection mixture was added to the cells. Each cell set was treated again with the same siRNA 24 h later. After an additional 24 h (48 h after the initial transfection), the cells were infected with virus. The siRNA sequences are given in Table 1.

Influenza virus infection and plaque assay.

Sets of transduced or transfected A549 cells were infected with influenza virus strain A/New York/55/2004 (H3N2) at an MOI of 1 (shRNA) or 0.1 (siRNA) PFU/cell or with influenza virus strain A/PR/8/34 (H1N1) or SOIV at an MOI of 0.1. Cell monolayers were washed twice with 1× phosphate-buffered saline (PBS) (137 mM NaCl, 0.3 mM KCl, 0.8 mM Na2HPO4, 0.1 mM KH2PO4) and infected with viruses diluted in gel saline (137 mM NaCl, 0.2 mM CaCl2, 0.8 mM MgCl2, 19 mM HBO3, 0.1 mM Na2B4O7, 0.3% [wt/vol] gelatin). At 72 hours postinfection (hpi), supernatants were harvested, and virus yield was titrated by plaque assay on MDCK cells. MDCK cell monolayers were washed twice with 1× PBS, infected with 1:10 serial dilutions of viruses in gel saline, and overlaid with 0.6% type I agarose (Sigma-Aldrich) for 3 days. All cells were infected with influenza virus at 35°C in a 5% CO2 humidified environment, including the plaque assay. For Western blotting assays, cells were infected with NY55 at an MOI of 1 and processed at 24 hpi.

Western blot.

At specific time points after influenza virus infection and as indicated in the respective figure legends, whole-cell lysate was obtained by lysing cells in radioimmunoprecipitation assay (RIPA) buffer (50 mM Tris [pH 7.4], 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% SDS) with complete protease inhibitor (Roche). Twenty micrograms of lysate was solubilized in 1× protein sample buffer (0.3 M Tris [pH 6.8], 50% glycerol., 0.3 M SDS, 5 mM dithiothreitol [DTT], 10 mM bromophenol blue) and subjected to electrophoresis on 10% SDS-polyacrylamide gels (SDS-PAGE), transferred to Immobilon-P polyvinylidene difluoride (PVDF) membranes (Millipore), and blotted with mouse monoclonal antibody to nonstructural protein 1 (anti-NS1) (3F5), mouse monoclonal antibody to nucleoprotein (anti-NP) (F26-9 [25]; gift from Mingyi Li), rabbit polyclonal antibody to hemagglutinin (anti-HA) (Rockland), mouse monoclonal anti-BAD (C-7; Santa Cruz), mouse monoclonal antibody against cleaved caspase-3 (anti-cleaved caspase-3) (Asp175; R&D Systems), rabbit monoclonal antibody against phosphorylated BAD (anti-phospho-BAD) (Ser136; Cell Signaling), mouse monoclonal anti-phospho-BAD (Ser112; Cell Signaling), rabbit polyclonal anti-cleaved PARP (Asp214; Cell Signaling), rabbit monoclonal anti-cytochrome c (Cell Signaling), rabbit polyclonal anti-cleaved caspase-7 (Asp198; Cell Signaling), or rabbit polyclonal anti-β-actin (Cell Signaling) antibodies. Cytoplasmic lysate for caspase immunoblotting was obtained by lysing cells in caspase lysis buffer (20 mM Tris-HCl [pH 7.5], 0.5% NP-40, 0.5 mM phenylmethylsulfonyl fluoride [PMSF], 100 μM β-glycerol-3-phosphate, protease inhibitor cocktail [Roche]). Forty micrograms of lysate was solubilized in 1× protein sample buffer, electrophoresed on 15% SDS-polyacrylamide gels, and transferred to Immobilon-Psq PVDF membranes (Millipore). The blots were subjected to secondary anti-rabbit or anti-mouse polyclonal antibody conjugated to horseradish peroxidase (HRP) (Cell Signaling) and detected with in-house enhanced chemiluminescence (ECL) reagent. Blot image and protein band quantification was obtained with Alpha Innotech FluorChem Q imaging system and processed using Adobe Photoshop.

Caspase-Glo 3/7 assay.

Caspase-3/7 activity was detected using Caspase-Glo 3/7 assay (Promega) according to the manufacturer's protocol. A total of 5,000 cells were seeded per well in 96-well, white-walled plates. The cells were infected with NY55 virus at an MOI of 1. Staurosporine was used as a positive control for caspase activity. The cells were treated with 1 μM staurosporine for 24 h. Caspase substrate was added to each well at 72 hpi and 24 h after treatment with staurosporine. Luminescence was detected with a BioTek Synergy 4 plate reader, and data were processed with Gen5 software.

Real-time PCR.

Total mRNA was isolated using RNeasy minikit (Qiagen) according to the manufacturer's protocol. Five hundred nanograms of purified mRNA was used to generate cDNA with random hexamer primers (Applied Biosystems) and SuperScript II reverse transcriptase (Invitrogen) according to the manufacturer's protocol. The quantitative real-time PCR (qRT-PCR) reaction mixture (25 μl) consisted of the following: 12.5 μl of SYBR green PCR master mix (Invitrogen), 0.5 μl of cDNA template, and 1 μl of each primer (100 μM forward and reverse primers) (Table 2). Reactions were run in duplicate on Applied Biosystems 7300 real-time PCR system. The cycling conditions were as follows: 2 min at 50°C, 2 min at 95°C, and 50 cycles, with 1 cycle consisting of 15 s at 95°C and 30 s at 60°C. Threshold cycle (CT) values were normalized to the values for the 18S rRNA control and compared to nontargeting shRNA/siRNA negative controls.

Table 2.

Primers for real-time PCR of RNA transcripts

Target gene Directiona Sequence (5′→3′)
18S rRNAb Fwd TGAGAAACGGCTACCACATC
Rev TTACAGGGCCTCGAAAGAGT
BAD Fwd ACCCGGCAGACAGATGAG
Rev CTTCCTCTCCCACCGTAGC
a

Fwd, forward; Rev, reverse.

b

Data from reference 26.

Cell viability.

Cell viability was determined using cell proliferation reagent WST-1 (Roche) according to the manufacturer's protocol or trypan blue exclusion assay. For the trypan blue exclusion assay, ∼1 × 106 infected or uninfected cells were stained with 20 μl of trypan blue solution and ∼14 μl of the stained cells was placed on a hemocytometer. A total of 200 cells were counted, and the percentage of viable cells was calculated with the following formula: percent viable cells = [(total number of cells counted − total number of dead cells)/(total number of cells counted)] × 100.

Statistics.

Statistical analysis was calculated using analysis of variance (ANOVA) and Student's t test.

RESULTS

Influenza virus-induced cytopathology and cell death are inhibited in BAD-deficient cells.

Influenza virus killing of host cells is known to occur through the activation of the apoptotic signaling pathway (2, 17). BAD is an important regulator of antiapoptotic Bcl-2 and Bcl-xL proteins. Its blockage of Bcl-2 and Bcl-xL defines the fate of the host cell toward apoptosis. In order to determine the effect of BAD on influenza virus replication, we generated BAD knockdown (KD) cells. A549 cells were treated with shRNA or siRNA oligomers that target BAD transcripts to create stable or transient knockdown cells, respectively. BAD shRNA KD cells were infected with influenza virus strain A/New York/55/2004 (H3N2) (NY55), A/Puerto Rico/8/1934 (H1N1) (PR8), or the 2009 pandemic swine origin influenza virus (SOIV) (A/California/07/2009). Infected cells were examined visually for demonstration of cytopathic effect (CPE), which phenotypically manifests as rounding up and detachment of infected cells as well as abnormal cellular structural morphology. Nontransduced cells and nontargeting shRNA-transduced controls infected with any influenza virus strain tested (NY55, SOIV, or PR8) showed extensive CPE indicative of virus-induced cytopathology (Fig. 1A). In contrast, there was no observable CPE in influenza virus-infected cells that had been transduced with BAD-specific shRNAs. To ensure that our observation was not biased by artifacts derived from the use of shRNA constructs and lentivirus transductions and to determine whether the same observations would manifest in transient KD, we used siRNA duplexes to knock down BAD in another set of A549 cells and infected these cells with the same virus subtypes. Comparable results were observed with siRNA-treated cells (Fig. 1B). This lack of CPE development in virus-infected BAD KD cells suggests inhibition of the capacity of the virus to induce cytopathology in BAD-deficient cells.

Fig 1.

Fig 1

Influenza virus-induced cytopathology and cell death are inhibited in BAD knockdown cells. (A and B) Cytopathic effect in infected BAD shRNA (A) or BAD siRNA (B) knockdown A549 cells that were infected with NY55, PR8, or SOIV. At 72 hpi, the cytopathic effect of the cells were examined with a Nikon Eclipse TE2000-S inverted microscope, and images were obtained with a Canon PowerShot A700 digital camera. The images shown are representative of 3 independent replicates. shNSi, shRNA nontargeting control. (C and D) Cell viability at 72 h after influenza virus infection was determined for shRNA-treated cells by WST-1 assay (C) and by trypan blue exclusion assay (D). A total of 200 cells were counted, and the percentage of trypan blue-excluding (viable) cells was determined. NSi is the nontargeting shRNA or siRNA control. Values are means plus standard deviations (error bars) from 3 independent replicates. Values that are significantly different (P < 0.001) are indicated by a black bar and asterisk above the values.

CPE development does not necessarily correlate with cell viability; therefore, a more quantitative means of determining cell viability was carried out by measurement of mitochondrial activity (WST-1) and by trypan blue exclusion. Both assays showed greater viability of virus-infected BAD KD cells than nontargeting shRNA and untransduced cell controls. In NY55-infected cells, 100% of the BAD KD cells survived viral infection, as measured by mitochondrial activity, and over 93% of cells survived PR8 infection; this is compared to controls with less than 65% survival in nontargeting and untransduced cells (P < 0.001) (Fig. 1C).

Similarly, greater than 76% of the BAD KD cells survived influenza virus infection at 72 hpi for all three virus subtypes (Fig. 1D), as measured by trypan blue exclusion, compared to less than 40% of the cells surviving infection in the nontargeting and untransduced controls.

Efficient KD of endogenous BAD was validated by quantitative real-time PCR (qRT-PCR) and Western blotting to ensure the effectiveness of the shRNA or siRNA treatment. BAD mRNA KD was confirmed by qRT-PCR for both shRNA and siRNA treatments (Fig. 2A and B). The results of Western blotting for endogenous BAD protein support the real-time PCR results (Fig. 2C and D). BAD protein was significantly reduced for both shRNA species (Fig. 2C) as well as for all 4 siRNA oligomers tested (Fig. 2D). Treatment of A549 cells with shRNA or siRNA alone did not affect cell viability as determined by the WST-1 cell proliferation assay (Fig. 2E and F). For proper comparison of cell viability and BAD knockdown, both the determination of cell viability and isolation of BAD mRNA were carried out at the same time—2 weeks after shRNA transduction, which allows for the establishment of a stable knockdown cell line, and 48 h after the initial siRNA transfections.

Fig 2.

Fig 2

Efficiency of BAD knockdown in A549 cells. (A and B) BAD transcripts were determined by real-time PCR for stably transduced shRNA cells (P < 0.001) (A) or siRNA-transfected cells (P = 0.002) (B) and nontargeting (NSi) shRNA or siRNA control cells, respectively. CT values were normalized to the values for the 18S rRNA control and compared to the values for the nontargeting (NSi) control. (C and D) Western blot confirmation of BAD knockdown in shRNA (C)- and siRNA (D)-treated cells. The positions of molecular mass markers (in kilodaltons) are indicated to the right of the blots. αBAD, anti-BAD antibody; αactin, antiactin antibody. (E and F) Effect of BAD knockdown on cell viability was assessed by WST-1 for stably shRNA-transduced cells (E) and siRNA-treated cells (F). Both cell viability and BAD mRNA quantification were determined 2 weeks after stably transduced cells were produced and 48 h after transfection with siRNA. NSi is the nontargeting shRNA or siRNA control. Values are means plus standard deviations (error bars) from duplicate runs.

The greater percentage of cell survival and the lack of CPE development despite viral infection suggests that BAD is involved in promoting virus-induced cytopathology and cell death. Therefore, our next objective was to assess the capacity of influenza viruses to induce apoptosis in BAD KD cells.

BAD knockdown in A549 cells reduced influenza virus replication of different virus subtypes.

A number of studies have reported the importance apoptosis plays in promoting efficient influenza virus replication (22, 23). Given the critical proapoptotic nature of BAD and the lack of CPE and cell death development we observed in BAD KD cells, we hypothesize that influenza virus replication is suppressed in BAD-deficient cells. To explore this possibility, stable BAD KD and nontargeting shRNA A549 cells were infected with NY55, and virus replication was monitored over a 72-h period. Virus progeny yield was also determined for PR8 and SOIV. The titers of virus progeny produced were determined by plaque assay on MDCK cells.

The initial rounds of virus replication in shRNA BAD KD cells and shRNA nontargeting control (shNSi) cells from 0 hpi to 12 hpi were comparable (Fig. 3A). However, subsequent viral replication after 12 hpi was less efficient in BAD KD cells than in control cells (Fig. 3A). NY55 production was significantly reduced to less than 37% and 15% of the nontargeting shRNA control with BAD-specific 202976 shRNA and 15289 shRNA, respectively (P = 0.011) (Fig. 3B). Reduction of viral titer was much more dramatic with SOIV and PR8, which replicated to only about 1% of levels seen in the nontargeting control (P < 0.001) (Fig. 3D).

Fig 3.

Fig 3

Inhibition of influenza virus replication in BAD knockdown cells. (A) NY55 virus growth curve in shRNA knockdown cells. (B and D) NY55 virus yield was determined at 72 hpi in indicated shRNA (B) or siRNA (D) knockdown cells (P < 0.011). (C and E) Virus yields of NY55, PR8, and SOIV replication at 72 hpi in shRNA (C) or siRNA (E) knockdown cells (P < 0.001). NSi is the nontargeting shRNA or siRNA control. Values are means plus standard deviations (error bars) from 3 independent experiments.

To ensure that a reduction in viral replication was not due to the effect of shRNA and/or lentivirus treatment, we repeated the infections in transiently siRNA-transfected A549 cells. The cells were sequentially treated twice with each of four distinct siRNAs that target BAD (plus a nontargeting siRNA control) 24 h apart, and after an additional 24 h, were infected with NY55, PR8, or SOIV influenza virus. The titer of virus was determined at 72 hpi.

Replication of all three virus strains was dramatically reduced in siRNA BAD KD cells (Fig. 3C and E). NY55 production was reduced to less than 24% of the level in the nontargeting control by all four siRNA species (P < 0.001) (Fig. 3C). The titers of SOIV and PR8 were less than 10% and 11% of the controls, respectively; this was slightly lower than that detected for NY55 titer, which was ∼19% of the control (P < 0.001) (Fig. 3E). Our observation with siRNA confirms the results determined with the infection of lentivirus-mediated BAD shRNA knockdown. These data strongly indicate that BAD is a significant host factor required for efficient influenza virus replication. Thus, the role of BAD in the life cycles of different influenza virus subtypes appears important.

Influenza virus protein production is inhibited in BAD knockdown cells.

Influenza virus-induced cell death occurs late in the viral life cycle; as late as 15 hpi has been reported (27). The lack of cell death coupled with significant reduction in viral replication in BAD KD cells raises the question of whether influenza virus replication in BAD-deficient cells may be inhibited early in the viral life cycle. In order to explore this, we carried out Western blot assays on whole-cell lysates of stable shRNA BAD KD and nontargeting shRNA control cells that were infected with NY55. Viral protein production was determined at specific time points over a 72-h period. The membrane was probed for influenza virus proteins NS1, NP, and HA. The NS1 mouse monoclonal antibody was generated and characterized in our lab (M. N. Rahim, M. Selman, P. J. Sauder, W. Stecho, W. Xu, M. Lebar, E. G. Brown, and K. M. Coombs, submitted for publication), and the characterization of the mouse monoclonal NP antibody was previously described (25). In the stably expressing nontargeting shRNA control cells, NS1, NP, and HA viral proteins were detected as early as 4 hpi and strongly detected at 8 hpi onwards (Fig. 4A, left blots). Protein bands were faintly detected as early as 0 hpi for the HA viral protein. Since HA is incorporated into virion particles, the early detection could be due to the infecting viral population initially introduced. In contrast, the production of all three viral proteins was clearly reduced in infected BAD KD cells (Fig. 4A, right blots). Densitometric analysis of the viral protein bands showed an average of 5-fold and 4-fold reduction of NP and HA protein, respectively, in BAD KD cells compared to the nontargeting (shNSi) shRNA control (Fig. 4B and D). The levels of NS1 protein produced in BAD KD cells and nontargeting shRNA control were comparable from 8 hpi to 22 hpi, but the level of NS1 protein dramatically dipped lower in BAD KD cells between 24 and 72 hpi, with an average of 3-fold reduction in BAD KD cells (Fig. 4C). The results suggest that BAD KD significantly reduces the efficiency of viral replication.

Fig 4.

Fig 4

Influenza virus protein is reduced in BAD knockdown A549 cells. (A) Cells were infected with NY55 at an MOI of 1, and whole-cell lysate was obtained at the indicated times after infection. The Western blots were probed with anti-NS1 (αNS1), anti-NP, anti-HA, and antiactin antibodies. Results for an uninfected (mock-infected) control are shown. (B to D) Densitometric quantitation of bands in infected lanes was done with Alpha Innotech FluorChem Q imaging system and normalized to β-actin values. NSi is the nontargeting shRNA control.

Influenza virus induces phosphorylation and cleavage of BAD.

The capacity of BAD to bind and neutralize antiapoptotic proteins is inhibited upon phosphorylation (28). Given that our results showed BAD as a valuable cellular factor required for influenza virus replication, we suspected that viral replication might affect BAD activity and how BAD is regulated. We infected A549 cells with NY55 and harvested samples at specific time points postinfection. The samples were subjected to Western blot analysis and probed for BAD phosphorylation at sites S112 and S136. Total BAD was also determined.

Our results showed that influenza virus infection induces BAD phosphorylation at both S112 and S136 but in a sequential manner (Fig. 5). Phosphorylation at S112 occurred as early as 14 hpi, with the most intense bands observed at 20 to 22 hpi, and was gradually reduced after 24 hpi. Phosphorylation at S136 was not detected until 20 hpi; the signal was maintained until 48 hpi but then decreased by 72 hpi. Total BAD, including unphosphorylated BAD, showed a gradual increase toward the late time points. Interestingly, we detected the smaller cleaved form of BAD at 48 hpi and 72 hpi, with the latest time point showing the greatest cleavage of BAD (Fig. 5). All these modifications observed during influenza virus infection were not detected in uninfected (mock) controls. Our results suggest that influenza viruses tightly control BAD activity via phosphorylation and cleavage to regulate the intrinsic apoptotic signaling cascade.

Fig 5.

Fig 5

Influenza virus infection induces BAD phosphorylation and cleavage. A549 cells were infected with NY55 at an MOI of 3 and harvested at the indicated time points postinfection, and protein samples were probed for phosphorylated BAD at residues S112 and S136, total BAD, and viral NS1 protein. Results for an uninfected (mock-infected) control are shown.

BAD knockdown suppresses cytochrome c release during influenza virus infection.

Given that BAD is a well-known regulator of the mitochondrion-dependent apoptosis pathway (28, 29), we wanted to determine whether a deficiency in BAD would suppress the capacity of the influenza virus to induce this signaling pathway during infection. Cytochrome c release from the mitochondria as a result of the organelle's dysregulation is a hallmark of the intrinsic apoptosis signaling pathway (29). To address this issue, we carried out a cytochrome release assay, which briefly involved the following steps: infection of BAD KD and nontargeting control cells with NY55 and cells harvested at specific time points postinfection and lysed to obtain the cytosolic and organelle fractions (labeled as mitochondrial pellet in Fig. 6).

Fig 6.

Fig 6

Deficiency in BAD inhibits virus-induced cytochrome c release. Cytochrome c release was determined in NY55-infected cells at an MOI of 3. Cytosolic and mitochrondrial fractions were obtained and blotted for cytochrome c at specific time points postinfection. Results for an uninfected (mock-infected) control are shown. The nontargeting shRNA control is indicated by “(non-targeting)” after the antibody (anti-cytochrome c [αcyt c] or antiactin [αactin]).

We observed an increase in the release of cytochrome c into the cytosol of infected nontargeting control at 20 hpi to 48 hpi relative to the uninfected (mock-infected) samples (Fig. 6, row 1). As expected, the corresponding mitochondrial pellet of the infected nontargeting control showed a decrease in cytochrome c at 20 hpi to 48 hpi (Fig. 6, row 5). We did not observe a similar increase in cytochrome c release into the cytosol of infected BAD KD cells (Fig. 6, row 2), and the amounts of cytochrome c in the mitochondrial pellets were similar for the infected and uninfected BAD KD cells (Fig. 6, row 6). These data suggest that influenza viruses induce mitochondrial dysregulation late in the virus replication cycle, as observed by cytochrome c released into the cytosol of infected cells, and that BAD is required for virus-induced dysregulation of the mitochondria.

BAD is required for efficient induction of caspase activity after influenza virus infection.

Influenza virus infection results in the activation of apoptosis both in vivo and in vitro (5, 30). We determined caspase activity in BAD KD A549 cells infected with NY55 at an MOI of 1. Caspase activity was measured at 72 hpi using the Promega Caspase-Glo 3/7 kit. Nontransduced and stably transduced nontargeting shRNA cells were used as controls. Staurosporine-treated cells were included as positive controls for caspase-3/7 activity.

Infection of nontransduced and nontargeting shRNA cells resulted in an increase in caspase-3/7 activity by approximately 1.5-fold (P = 0.001) (Fig. 7A). We did not detect a significant difference in caspase activity induced by NY55 infection in BAD-deficient cells compared to uninfected (mock-infected) cells (Fig. 7A). Although there appeared to be a difference in caspase activity between the uninfected (mock-infected) nontargeting shRNA control and BAD KD cells, this difference was not statistically significant (P = 0.234). Overall, this indicates that BAD is necessary for influenza virus activation of caspase-3/7 activity.

Fig 7.

Fig 7

BAD is required for influenza virus-induced caspase-3 and caspase-7 activity. (A) Measurement of caspase-3/7 activity using Caspase-Glo 3/7 assay at 72 hpi in A549 cells infected with NY55 at an MOI of 1 or at 24 h after treatment of cells with 1 μM staurosporine. Values are means plus standard deviations (error bars) from 3 independent replicates. Values that are significantly different (P < 0.001) are indicated by a black bar and asterisk above the values. (B) Caspase-3 cleavage was assessed via Western blotting for the small, cleaved fragment of caspase-3. Nontargeting control (NSi) and BAD shRNA KD A549 cells were infected with NY55 at an MOI of 3, and cytoplasmic lysate was obtained at 72 hpi. NSi is the nontargeting shRNA control.

Influenza virus-induced cleavage of caspase-3 and caspase-7 is inhibited in BAD knockdown cells.

The Caspase-Glo 3/7 assay does not differentiate between the activities of caspase-3 and caspase-7. Given that caspase-3 activation is necessary for efficient influenza virus infection (23), we carried out immunoblotting for cleaved caspase-3 and caspase-7 protein products. Caspase activation requires proteolytic cleavage of zymogens into smaller, enzymatically active fragments (31). Cytoplasmic lysates were obtained from shRNA nontargeting control and BAD KD cells infected with NY55. Cleaved caspase-3 products were readily detected in the infected shRNA nontargeting control at 30 hpi and were most strongly visible at 72 hpi (Fig. 7B, left blots). However, caspase-3 cleavage was undetected at time points before 72 hpi, and significantly reduced cleaved caspase-3 was detected in the infected BAD KD lane at 72 hpi (Fig. 7B, right blots).

We also observed caspase-7 cleavage in the infected nontargeting control, with significant cleavage occurring between 30 and 72 hpi (Fig. 8A, left blots). Similar to our observation with caspase-3, cleavage of caspase-7 was suppressed in BAD KD cells compared to the nontargeting control (Fig. 8A, right blots). Densitometric analysis of cleaved caspase-7 in the infected lanes showed on average a 5-fold reduction in caspase-7 cleavage compared to the shRNA nontargeting control cells (Fig. 8B). These results suggest that influenza viruses need BAD in order to induce caspase activation.

Fig 8.

Fig 8

Cleavage of caspase-7 and PARP is inhibited in influenza virus-infected BAD knockdown cells. (A) Nontargeting shRNA control (NSi) and BAD knockdown cells were infected with NY55 at an MOI of 3, and cells were harvested at specific times points. Whole-cell lysates were subjected to Western blotting with antibodies to cleaved caspase-7, cleaved PARP, and viral NS1 proteins. Results for an uninfected (mock-infected) control are shown. (B and C) Densitometric quantitation of bands in infected lanes was done with Alpha Innotech FluorChem Q imaging system and normalized to the values for β-actin. NSi is the nontargeting shRNA control.

Caspase-3 and caspase-7 are effector caspases that cleave other proteins downstream of the apoptotic signaling pathway. One of these downstream substrates is PARP. We looked at PARP cleavage during influenza virus infection at specific time points late in the replication cycle in both the nontargeting control and BAD KD cells. Our results showed that influenza virus replication induces increasingly greater PARP cleavage from 14 hpi to 72 hpi (Fig. 8A). However, cleaved PARP was only faintly detected in Western blots of infected BAD KD cell lysates. Densitometric analysis showed a >10-fold reduction of PARP cleaved in the knockdown cells (Fig. 8C). Interestingly, greater caspase-7 and PARP cleavage in the nontargeting control corresponded with an elevated level of expression of NS1 (Fig. 4 and 8). The cleavage of both caspase-7 and PARP appeared to be the highest at 30 hpi, suggesting this to be a critical period for apoptosis induction and viral replication. Further studies will provide a greater understanding of the critical molecular changes that may occur around this time period. Similar to our observation earlier, NS1 expression is reduced in BAD KD cells. In all, our data suggest that influenza viruses require the presence of BAD to efficiently induce the intrinsic apoptotic signaling pathway.

DISCUSSION

Influenza virus induces cell death through activation of the apoptotic pathway, a process regarded as a major contributor to influenza virus pathogenesis that results in extensive lung tissue damage (1, 4). Blockage of the cell death pathway also leads to a significant decline in virus production (17). We report here that influenza virus-induced apoptosis requires BAD.

Our results showed that influenza viruses failed to induce cytopathology and cell death in BAD-deficient cells. Similar observations were reported for West Nile virus (WNV) infection, where inhibition of apoptosis prevents WNV induction of cell death (3). Infection of BAD KD cells resulted in significant reduction in virus yield for all three virus subtypes we looked at (H3N2, H1N1, pandemic H1N1), and both early and late viral protein production were dramatically reduced. It is possible that the observed low viral protein production was a result of low progeny yield from the initial infections, which then caused reduced viral spread and infection of other cells in the vicinity. However, a general reduction in overall viral protein produced during infection was also observed in cells that overexpressed Bcl-2 (20). Thus, it is highly possible that BAD-deficient cells may fail to properly inhibit Bcl-2 activity.

The ability of BAD to associate and inhibit antiapoptotic factors is regulated by phosphorylation at three residues, S112, S136, and S155 (28). A tiered phosphorylation and model of BAD inactivation has been proposed based on evidence that showed phosphorylation at S155 requires priming phosphorylation on S136 and S112 residues (28, 32). The S136 site and especially the S155 site are reported to be more-potent sites required for inactivating BAD activity (32, 33). Moreover, complete BAD inactivation requires phosphorylation of at least two serine residues (32). We determined that influenza viruses induce BAD phosphorylation of S112 and S136 sequentially from mid- to late viral replication cycle. S112 phosphorylation occurred before S136 phosphorylation, and both phosphorylation processes gradually tapered off after 48 hpi. A study has shown that viral NS1 protein interacts with Akt, which results in enhanced Akt activity (34). S136 phosphorylation occurs via Akt in the phosphatidylinositol 3-kinase (PI3K) signaling pathway (35, 36). We noticed an increase in NS1 protein production at 18 hpi to 20 hpi, whereas phosphorylation at S136 occurred from 20 hpi onward. This suggests that NS1 interaction with Akt may lead to the phosphorylation of BAD at residue S136. More studies are required to identify other cellular and/or viral factors that lead to the phosphorylation of BAD and how these temporal interactions regulate BAD activity and modulate apoptosis during influenza virus replication.

Interestingly, we also noticed the appearance of a truncated, or cleaved, form of BAD starting at 48 hpi, with the appearance of distinct cleavage at 72 hpi. BAD is cleaved by a number of caspases, including caspase-3 and caspase-7 (37). The truncated form of BAD is reported to be a more potent inducer of cytochrome c release and apoptosis than the full-length form due to its higher affinity for Bcl-xL and the mitochondrial membrane (37, 38). The N-terminally truncated BAD is poorly phosphorylated and has reduced affinity for 14-3-3 protein, a cellular factor that inhibits BAD through direct association (32). It is proposed that caspase cleavage of BAD initiates a mitochondrial amplification loop during apoptosis, similar to what has been observed with BID cleavage (39). It is possible that influenza viruses use BAD to moderate the degree of activation of the apoptotic pathway to enhance its replication but actively delays the complete onset of apoptosis that will lead to irreversible cell death. Thus, the virus moderates BAD activity by briefly inducing BAD phosphorylation and delays the appearance of the potent truncated form. Eventually, the death signaling factors will overwhelm the control of the virus and cell death will occur.

In the absence of BAD, we observed a suppression of cytochrome c release from the mitochondria, which is an early process of the intrinsic apoptotic cascade. Cytochrome c release will lead to the eventual downstream cleavage and activation of caspase-3 and caspase-7. Although the specific role of caspase-7 during influenza virus replication remains uncertain, it has been shown that caspase-3 cleavage is essential for influenza virus propagation (23). We show here that in BAD-deficient cells, virus-induced cleavage of both caspase-3 and caspase-7 was inhibited. It is likely that the absence of BAD permitted the antiapoptotic activity of Bcl-2 and Bcl-xL that resulted in blockage of cytochrome c release, and thus suppresses activation of downstream apoptotic factors such as the caspases. A reduction in caspase-3 activity would be a contributing factor to the inhibition of viral replication discussed above. The failure to activate caspase-3 in BAD KD cells was further supported by a reduction in PARP cleavage, which is a substrate of caspase-3 (40). Caspase-7 was considered to be functionally redundant with caspase-3, but recent studies have suggested that caspase-7 may be involved in the inflammatory response as well as apoptosis (41). Further studies are needed to clarify the role of caspase-7 during influenza virus replication. Nevertheless, our data showed that caspase-7 is activated upon viral replication and suggested a potentially significant role that this protease may play during influenza virus infection.

We have shown here that BAD is an important cellular factor required for influenza virus induction of the apoptotic signaling cascade that is essential for efficient viral replication. A deficiency in BAD resulted in significant reduction in viral yield and suppressed activation of the intrinsic apoptosis pathway. Our data suggest that BAD supports influenza virus replication through its innate role as a potent regulator of the mitochondrion-dependent apoptotic pathway and as an antagonist of antiapoptotic factors such as Bcl-2 and Bcl-xL. Our study presents evidence to further emphasize the importance of understanding the intricate relationship apoptosis has in promoting influenza virus propagation, and how its regulation may be key to controlling influenza virus infection and prevention of host tissue damage.

ACKNOWLEDGMENTS

This work was supported by grants ROP-104906 and MOP-106713 from the Canadian Institutes of Health Research awarded to K.M.C., as well as by National Science and Engineering Research Council, Manitoba Health Research Council, and Health Sciences Centre Foundation graduate studentships awarded to A.T.T.

We thank Kolawole Opanubi for expert technical assistance, James House, Animal Sciences, for embryonated chicken eggs in which some influenza virus stocks were grown, Ming Yang for anti-NP monoclonal antibodies, Patty Sauder and Niaz Rahim for anti-influenza virus NS1 monoclonal antibody production, and members of the laboratory for critical reviews.

We declare that we have no conflicts of interest.

Footnotes

Published ahead of print 7 November 2012

REFERENCES

  • 1. Brydon EWA, Morris SJ, Sweet C. 2005. Role of apoptosis and cytokines in influenza virus morbidity. FEMS Microbiol. Rev. 29:837–850 [DOI] [PubMed] [Google Scholar]
  • 2. Hinshaw VS, Olsen CW, Dybdahl-Sissoko NR, Evans D. 1994. Apoptosis: a mechanism of cell killing by influenza A and B viruses. J. Virol. 68:3667–3673 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Kleinschmidt MC, Michaelis M, Ogbomo H, Doerr H-W, Cinatl J., Jr 2007. Inhibition of apoptosis prevents West Nile virus induced cell death. BMC Microbiol. 7:49 doi:10.1186/1471-2180-7-49 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Ludwig S, Pleschka S, Planz O, Wolff T. 2006. Ringing the alarm bells: signalling and apoptosis in influenza virus infected cells. Cell. Microbiol. 8:375–386 [DOI] [PubMed] [Google Scholar]
  • 5. Takizawa T, Matsukawa S, Higuchi Y, Nakamura S, Nakanishi Y, Fukuda R. 1993. Induction of programmed cell death (apoptosis) by influenza virus infection in tissue culture cells. J. Gen. Virol. 74:2347–2355 [DOI] [PubMed] [Google Scholar]
  • 6. Baskin CR, Garcia-Sastre A, Tumpey TM, Bielefeldt-Ohmann H, Carter VS, Nistal-Villan E, Katze MG. 2004. Integration of clinical data, pathology, and cDNA microarrays in influenza virus-infected pigtailed macaques (Macaca nemestrina). J. Virol. 78:10420–10432 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Cillóniz C, Shinya K, Peng X, Korth MJ, Proll SC, Aicher LD, Carter VS, Chang JH, Kobasa D, Feldmann F, Strong JE, Feldmann H, Kawaoka Y, Katze MG. 2009. Lethal influenza virus infection in macaques is associated with early dysregulation of inflammatory related genes. PLoS Pathog. 5:e1000604 doi:10.1371/journal.ppat.1000604 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Duprez L, Wirawan E, Berghe TV, Vandenabeele P. 2009. Major cell death pathways at a glance. Microbes Infect. 11:1050–1062 [DOI] [PubMed] [Google Scholar]
  • 9. Levine B, Sinha S, Kroemer G. 2008. Bcl-2 family members. Autophagy 4:600–606 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Autret A, Martin SJ. 2009. Emerging role for members of the Bcl-2 family of mitochondrial morphogenesis. Mol. Cell 36:355–363 [DOI] [PubMed] [Google Scholar]
  • 11. Lomonosova E, Chinnadurai G. 2009. BH3-only proteins in apoptosis and beyond: an overview. Oncogene 27:S2–S19 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Kim R. 2005. Unknotting the roles of Bcl-2 and Bcl-xL in cell death. Biochem. Biophys. Res. Commun. 333:336–343 [DOI] [PubMed] [Google Scholar]
  • 13. Yang E, Zha J, Jockel J, Boise LH, Thompson CB, Korsmeyer SJ. 1995. Bad, a heterodimeric partner for Bcl-xL and Bcl-2. Cell 80:285–291 [DOI] [PubMed] [Google Scholar]
  • 14. Zha J, Harada H, Osipov K, Jockel J, Waksman G, Korsmeyer SJ. 1997. BH3 domain of BAD is required for heterodimerization with BCL-XL and pro-apoptotic activity. J. Biol. Chem. 272:24101–24104 [DOI] [PubMed] [Google Scholar]
  • 15. Mahalingam S, Meanger J, Foster PS, Lidbury BA. 2002. The viral manipulation of the host cellular and immune environments to enhance propagation and survival: a focus on RNA viruses. J. Leukoc. Biol. 72:429–439 [PubMed] [Google Scholar]
  • 16. Lin C, Zimmer SG, Lu Z, Holland RE, Jr, Dong Q, Chambers TM. 2001. The involvement of a stress-activated pathway in equine influenza virus-mediated apoptosis. Virology 287:202–213 [DOI] [PubMed] [Google Scholar]
  • 17. McLean JE, Datan E, Matassov D, Zakeri ZF. 2009. Lack of Bax prevents influenza A virus-induced apoptosis and causes diminished viral replication. J. Virol. 83:8233–8246 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. McLean JE, Ruck A, Shirazian A, Pooyaei-Mehr F, Zakeri ZF. 2008. Viral manipulation of cell death. Curr. Pharm. Des. 14:198–220 [DOI] [PubMed] [Google Scholar]
  • 19. Nencioni L, De Chiara G, Sgarbanti R, Amatore D, Aquilano K, Marcocci ME, Serafino A, Torcia M, Cozzolino F, Ciriolo MR, Garaci E, Palamara AT. 2009. Bcl-2 expression and p38MAPK activity in cells infected with influenza A virus. J. Biol. Chem. 284:16004–16015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Olsen CW, Kehren JC, Dybdahl-Sissoko NR, Hinshaw VS. 1996. bcl-2 alters influenza virus yield, spread and hemagglutinin glycosylation. J. Virol. 70:663–666 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Rossman JS, Lamb RA. 2009. Autophagy, apoptosis, and the influenza virus M2 protein. Cell Host Microbe 6:299–300 [DOI] [PubMed] [Google Scholar]
  • 22. Wurzer WJ, Ehrhardt C, Pleschka S, Berberich-Siebelt F, Wolff T, Walczak H, Planz O, Ludwig S. 2004. NF-κΒ-dependent induction of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) and Fas/FasL is crucial for efficient influenza virus propagation. J. Biol. Chem. 279:30931–30937 [DOI] [PubMed] [Google Scholar]
  • 23. Wurzer WJ, Planz O, Ehrhardt C, Giner M, Silberzahn T, Pleschka S, Ludwig S. 2003. Caspase 3 activation is essential for efficient influenza virus propagation. EMBO J. 22:2717–2728 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Wang X, Ragupathy V, Zhao J, Hewlett I. 2011. Molecules from apoptotic pathways modulate HIV-1 replication in Jurkat cells. Biochem. Biophys. Res. Commun. 414:20–24 [DOI] [PubMed] [Google Scholar]
  • 25. Yang M, Berhane Y, Salo T, Li M, Hole K, Clavijo A. 2008. Development and application of monoclonal antibodies against avian influenza virus nucleoprotein. J. Virol. Methods 147:265–274 [DOI] [PubMed] [Google Scholar]
  • 26. Giricz O, Lauer-Fields JL, Fields GB. 2008. The normalization of gene expression data in melanoma: investigating the use of glyceraldehyde 3-phosphate dehydrogenase and 18s ribosomal RNA as internal reference genes for quantitative real-time PCR. Anal. Biochem. 380:137–139 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Zhirnov OP, Klenk H-D. 2007. Control of apoptosis in influenza virus-infected cells by up-regulation of Akt and p53 signaling. Apoptosis 12:1419–1432 [DOI] [PubMed] [Google Scholar]
  • 28. Danial NN. 2008. BAD: undertaker by night, candyman by day. Oncogene 27:S53–S70 [DOI] [PubMed] [Google Scholar]
  • 29. Kroemer G, Galluzzi L, Brenner C. 2007. Mitochondrial membrane permeabilization in cell death. Physiol. Rev. 87:99–163 [DOI] [PubMed] [Google Scholar]
  • 30. Mori I, Komatsu T, Takeuchi K, Nakakuki K, Sudo M, Kimura Y. 1995. In vivo induction of apoptosis by influenza virus. J. Gen. Virol. 76:2869–2873 [DOI] [PubMed] [Google Scholar]
  • 31. Pop C, Salvesen GS. 2009. Human caspases: activation, specificity, and regulation. J. Biol. Chem. 284:2177–21781 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Datta SR, Katsov A, Hu L, Petros A, Fesik SW, Yaffe MB, Greenberg ME. 2000. 14-3-3 proteins and survival kinases cooperate to inactivate BAD by BH3 domain phosphorylation. Mol. Cell 6:41–51 [PubMed] [Google Scholar]
  • 33. Masters SC, Yang H, Datta SR, Greenberg ME, Fu H. 2001. 14-3-3 inhibits Bad-induced cell death through interaction with serine-136. Mol. Pharmacol. 60:1325–1331 [DOI] [PubMed] [Google Scholar]
  • 34. Matsuda M, Suizu F, Hirata N, Miyazaki T, Obuse C, Noguchi M. 2010. Characterization of the interaction of influenza virus NS1 with Akt. Biochem. Biophys. Res. Commun. 395:312–317 [DOI] [PubMed] [Google Scholar]
  • 35. Datta SR, Dudek H, Tao X, Masters S, Fu H, Gotoh Y, Greenberg ME. 1997. Akt phosphorylation of BAD couples survival signals to the cell-intrinsic death machinery. Cell 91:231–241 [DOI] [PubMed] [Google Scholar]
  • 36. Eves EM, Xiong W, Bellacosa A, Kennedy SG, Tsichlis PN, Rosner MR, Hay N. 1998. Akt, a target of phosphatidylinositol 3-kinase, inhibits apoptosis in a differentiating neuronal cell line. Mol. Cell. Biol. 18:2143–2152 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Condorelli F, Salomoni P, Cotteret S, Cesi V, Srinivasula SM, Alnemri ES, Calabretta B. 2001. Caspase cleavage enhances the apoptosis-inducing effects of BAD. Mol. Cell. Biol. 21:3025–3036 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Seo SY, Chen YB, Ivanovska I, Ranger AM, Hong SJ, Dawson VL, Korsmeyer SJ, Bellows DS, Fannjiang Y, Hardwick JM. 2004. BAD is a pro-survival factor prior to activation of its pro-apoptotic function. J. Biol. Chem. 279:42240–42249 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Li H, Zhu H, Xu CJ, Yuan J. 1998. Cleavage of BID by caspase 8 mediates the mitochondrial damage in the Fas pathway of apoptosis. Cell 94:491–501 [DOI] [PubMed] [Google Scholar]
  • 40. Kroemer G, Martin SJ. 2005. Caspase-independent cell death. Nat. Med. 11:725–730 [DOI] [PubMed] [Google Scholar]
  • 41. Lamkanfi M, Kanneganti TD. 2010. Caspase-7: a protease involved in apoptosis and inflammation. Int. J. Biochem. Cell Biol. 42:21–24 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES