Fixation of Emerging Interviral Recombinants in Cucumber Mosaic Virus Populations

Justin S Pita; Marilyn J Roossinck

doi:10.1128/JVI.01892-12

. 2013 Jan;87(2):1264–1269. doi: 10.1128/JVI.01892-12

Fixation of Emerging Interviral Recombinants in Cucumber Mosaic Virus Populations

Justin S Pita ¹, Marilyn J Roossinck ^1,^✉

PMCID: PMC3554057 PMID: 23115282

Abstract

Interstrain recombinants were observed in the progenies of the Cucumber mosaic virus (CMV) reassortant L₁L₂F₃ containing RNAs 1 and 2 from LS-CMV and RNA 3 from Fny-CMV. We characterized these recombinants, and we found that their fixation was controlled by the nature of the replicating RNAs 1 and 2. We demonstrate that the 2b gene partially affects this fixation process, but only in the context of homologous RNAs 1 and 2.

TEXT

Single-stranded positive-sense RNA viruses are the most common described plant viruses, indicating their adaptability to a wide variety of hosts and environmental conditions. Several mechanisms underlying their extreme evolutionary capacities have been studied extensively, including processes involved in mutation, recombination, and reassortment. Comparatively less attention has been devoted to understanding the mechanisms underlying the fixation of newly generated variants in the viral population, even though this process constitutes a key aspect of evolutionary dynamics with important implications such as the emergence of drug resistance mutants in human diseases (AIDS, cancers, tuberculosis, etc.).

Cucumber mosaic virus (CMV; genus Cucumovirus, family Bromoviridae) is a well-established model for RNA virus evolution studies (1). CMV strains have been divided into subgroups IA, IB, and II (2, 3). CMV contains a single-stranded positive-sense RNA genome divided into three RNAs, designated RNAs 1, 2, and 3 (2, 4). RNA 1 encodes the 1a protein, which has methyltransferase and helicase domains and which is involved in virus replication (5, 6). RNA 2 encodes the 2a protein, which has a GDD box characteristic of RNA-dependent RNA polymerases and which is also involved in virus replication (5, 7), and the 2b protein, which is involved in virus movement, symptom expression, and suppression of RNA silencing (8, 9). RNA 3 encodes the 3a movement protein and the coat protein, which are required for virus movement and dissemination (10, 11).

Interviral recombinants have arisen from serial passages of a mixture of different strains of CMV in some host plants (12). Several such recombinants described in the literature involved the 3′ nontranslated region (3′ NTR) of RNA 3 of CMV (13–17). In this work, we describe recombinants in the progenies of a virus obtained by reassortment between CMV strains Fny-CMV (subgroup IA) and LS-CMV (subgroup II) and we studied their fixation process in viral populations developed in competition experiments in five host plants.

Plants and viruses are described by our accompanying article (18). Ten 3-week-old Nicotiana benthamiana plants were inoculated with reassortant/recombinant viruses containing recombinant RNA 3 and RNAs 1 and 2 from either Fny- or LS-CMV and, as a competitor, an equal concentration (100 μg/ml) of RNA 3 from either Fny- or LS-CMV. Control plants were inoculated with the buffer only (50 mM Na₂HPO₄, pH 9).

Total RNA extraction and high-fidelity (HiFi) reverse transcription-PCR (RT-PCR) were as described in our accompanying article (18), except that for the competition experiments, total RNA was isolated from systemically infected leaves at 7, 15, and 21 days postinoculation (dpi). The thermal cycling reactions were carried out as previously described (19) and were optimized to eliminate any recombination artifacts in vitro. Cloning and sequence and clone analyses were also as described in our accompanying article (18) except for the competition experiments; 10 white colonies (instead of 24) were selected from each plate and resuspended in 30 μl of water. Five microliters of the suspension was then used in thermal cycling reactions as previously described (19). PCR products were digested with restriction enzymes BglI and DdeI separately. Competitor RNAs 3 were distinguished by restriction fragment length polymorphism (RFLP).

Strains of Fny- and LS-CMV and the cDNA clones derived from these viruses that are capable of producing infectious RNA transcripts were previously described (20, 21). To obtain infectious clones of the interviral recombinants, total RNAs from plants where they occurred (Table 1) were selected and used for HiFi RT-PCR. After cloning and sequence analysis, the 3′ end recombined fragments of various interviral recombinants were subcloned into XhoI and EcoNI restriction sites of plasmid pFny 309 (22). An EcoNI site was engineered in the 3′ end of the recombined fragment by using primer TGGTCTCCTTTTGGAGGACC in the final thermal cycling reactions in lieu of primer 1. The RNA 2 mutant clones used here were as described elsewhere (18).

Table 1.

Incidence of the recombinants observed in L₁L₂F₃ progenies in five hosts

Host	Plant	No. of recombinants
Host	Plant	Parental F₃	Rec-1	Rec-2	Rec-3	Rec-4	Rec-5
N. benthamiana	1	4	6	0	0	0	0
	2	0	13	0	0	0	0
	3	0	21	0	0	0	0
Pepper	1	0	21	0	0	0	0
	2	0	22	0	0	0	0
	3	0	4	0	0	0	16
Tomato	1	0	23	0	0	1	0
	2	0	19	0	0	0	0
	3	0	6	0	0	17	0
Squash	1	12	5	0	0	1	0
	2	4	18	0	0	0	0
	3	0	23	0	0	0	0
Tobacco	1	0	6	17	1	0	0
Total		20	187	17	1	19	16

Open in a new tab

We were not surprised to see interviral recombinants in the populations of reassortant viruses, as these have been described previously (12–16, 23). However, recombinants appeared only in the progeny of one of the six reassortants, irrespective of the hosts tested. No recombinant was detected in the progenies of wild types (wt) F₁F₂F₃ and L₁L₂L₃ or in the progenies of reassortants F₁L₂L₃, F₁F₂L₃, F₁L₂F₃, L₁F₂F₃, and L₁F₂L₃, while several recombinants were identified in the progeny of L₁L₂F₃ in all hosts. For each recombinant, part of the 3′ NTR of L₂ was inserted in F₃.

Based on the sizes of the inserted fragments and depending on the insertion sites, we could distinguish several different recombinants (Fig. 1), designated Rec-1 to Rec-5. Also, we noticed that in all five hosts, the interviral recombinants always outcompeted the parental F₃, which was lost from the population with time (Table 1). For example, of the 10 clones sequenced from N. benthamiana plant 1, four were parental F₃ and six were Rec-1 but the 21 clones sequenced from N. benthamiana plant 3 were all Rec-1, with no parental F₃ (Table 1). This indicates that the interviral recombinants have a selective advantage over the parental F₃. To further study the mechanisms underlying the fixation of the 3′ NTR recombinants in the viral population, we recloned the recombinant-containing progeny populations to obtain full-length infectious clones using cDNA from the viral RNAs as templates. In the cloning process we discovered some additional recombinants. Their nucleotide sequences were compared to those of the original recombinants, Rec-1 to Rec-5. They fall into four groups depending on their reporter sizes (a reflection of the insert size and position). The first group includes clones a, b, c, and d, of 1,111 nucleotides (nt), which were found to be identical to Rec-1. The second group includes clones h and i, of 1,141 nt, which were identical to Rec-2. Group 3 includes clones e and f, of 1,118 nt, identical to Rec-4. The last group contains clones g, j and k, of various sizes, which were not isolated previously. This suggests that there is a richer pool of interviral recombinants in L₁L₂F₃ progenies. No recombinants identical to Rec-3 or Rec-5 were found in this experiment. Two important characteristics of the infectious clones are the sizes and the nucleotide sequences of the inserts corresponding to the 3′ termini. Except for Rec-5 and clone j, the size of the insert is 309 nt, with the sequence corresponding to the 3′ terminus identical to that of an important motif called Box 1 (17). Recombinants j and Rec-5 do not contain the Box 1 motif.

The clones a, e, g, h, and j were tested for their infectivity (Table 2). In vitro transcripts of RNAs 1 and 2 of Fny-CMV or LS-CMV were mixed with transcripts of the various recombinant RNAs 3 and inoculated into N. benthamiana plants. All the clones tested were infectious except clone j, which is the only one lacking Box 1, suggesting that Box 1 may be indispensable for establishing an infection. The infectivity tests also showed that replacement of LS-CMV RNA 3 by any of the infectious recombinant RNAs increased the virulence of LS-CMV (Table 2): the symptoms appeared earlier and more plants were infected. This was not the case for Fny-CMV, which already displays greater virulence than LS-CMV. The selective advantage of the interviral recombinant RNAs 3 over the parental F₃ in L₁L₂F₃ progenies could be due to a better affinity of the replicase L₁L₂ for the recombined 3′ NTR, which seems to fit even better than the parental L₃ 3′ NTR.

Table 2.

Infectivity assays in Nicotiana benthamiana

Inoculum	Box 1 in RNA-3^a	Infectivity^b	Initiation of symptoms (dpi^c)
F₁F₂F₃ (parental)	−	4/4^b	3
F₁F₂ + a	+	4/4	3
F₁F₂ + e	+	2/4	3
F₁F₂ + g	+	3/4	3
F₁F₂ + h	+	4/4	3
F₁F₂ + j	−	0/4	Not infectious
L₁L₂L₃ (parental)	+	1/4	8
L₁L₂ + a	+	3/4	4
L₁L₂ + e	+	2/4	4
L₁L₂ + g	+	2/4	4
L₁L₂ + h	+	3/4	4
L₁L₂ + j	−	0/4	Not infectious

Open in a new tab

−, absent; +, present.

Number of plants infected/number inoculated.

dpi, days postinoculation.

Interviral recombinants were detected only in the progenies of one reassortant, L₁L₂F₃. It is possible that 15 days was not enough time to generate recombinants, as previous studies have shown that this can be a slow process (12, 24), but the rapid generation of recombinants in L₁L₂F₃ suggests that other factors are more important. In addition, the high reproducibility of this asymmetrical recombination event, coupled with the rapid fixation of the recombinants in the viral population, indicates a strong selective advantage of the recombinants in the context of the L₁L₂ replicase. Thompson et al. (17) showed that the uncapped and noncoding subgenomic RNA 5 that is produced in subgroup II strains of CMV (like LS-CMV), but not in subgroup I strains (like Fny-CMV), has its initiation nucleotide located in a 21-nucleotide conserved sequence named Box 1, which is absent in CMV subgroup I. Interestingly, the recombination event described here took place just one nucleotide upstream of this Box 1 and led to the acquisition of most of the LS-RNA 2 3′ NTR, including the Box 1 motif. Infectivity assays performed for several interviral recombinants (Table 2) also revealed that the recombinants have a slight advantage over the parental LS-CMV RNA 3 and indicate that the acquired Box 1 is required for their infectivity, as clone j, which lacks Box 1, is not infectious. Transcomplementation may explain the survival of the Box 1-negative clones j and Rec-5 in the viral progenies (Table 1).

The 3′ NTRs of CMV and related viruses have been studied extensively (10, 25–27), although the function(s) of RNA 5 is not known. Members of the Bromovirus and Cucumovirus genera have a tRNA-like structure at the 3′ end of their genomic RNAs that interacts with the replicase and is required for minus-strand synthesis (28, 29). Sivakumaran et al. (27) showed that the 3′ NTR of Fny-CMV contains a stem-loop structure similar to that of Brome mosaic virus, which is necessary for the binding of CMV replicase. Therefore, the 3′ NTR of CMV clearly contains the promoter for minus-strand synthesis of the viral RNA during replication, and its primary function involves interaction with the replicase. In addition, phylogenetic analyses have shown that RNA-specific functions (translation, encapsidation) may also be encoded in this region (26). Our data indicate that the 3′ NTR of Fny-CMV RNA 3 was exchanged for that of LS-CMV RNA 2 by recombination, resulting in increased fitness of the newly formed molecule (presumably because it better accommodates the replicase). Others have shown that cucumoviral recombinants outcompete the parental viruses (30). It was suggested that viruses of subgroup II of CMV (like LS-CMV) have obtained their 3′ NTRs from the related Cucumovirus Tomato aspermy virus (TAV), by means of recombination (23). It seems clear that the location of the recombination event that generated the interviral recombinants described here, one nucleotide upstream of Box 1, is of biological significance. De Wispelaere and Rao (31) showed that the first nucleotide of RNA 5 of Q-CMV RNAs 1, 2, and 3 is located two nucleotides upstream of Box 1. We are confident that RNA 2 and not RNA 1 is the donor of the 3′ NTR in the recombination event described here, for the following reasons: (i) the sequence of the 309 nt exchanged is 100% identical to the corresponding fragment in RNA 2 and only 97.7% identical to the corresponding fragment in RNA 1; (ii) the sequence of LS-RNA 1 does not contain the 21-nt conserved motif (Box 1). However, according to de Wispelaere and Rao (31), RNA 5 and not RNA 2 per se is the preferred template for this type of recombination. There is evidence that RNA 5 is recognized by CMV replicase (24, 32). Hence, our system is offering new tools to further study the mechanisms involved in this type of recombination. The lack of RNA 5 in subgroup I strains may explain the lack of recombinants in reassortants with Fny RNA 2, but it cannot explain why strains such as F₁L₂F₃ did not generate recombinants or the differential selection of recombinants in infections with mixtures of RNA 3.

To uncover the mechanisms underlying the fixation phenomenon described here, we conducted experiments involving competition between the interviral recombinant RNA 3 (h) and the parental RNA 3 (L₃ or F₃) in planta, with various reassortments of RNAs 1 and 2 of Fny- and LS-CMV (Table 3; Fig. 2). Because of its size, clone h is easily distinguishable from the parental F₃ or L₃.

Table 3.

Competition experiment in Nicotiana benthamiana with various reassortants of Fny- and LS-CMV and with viruses containing deleted or exchanged 2b

Inoculum	Plant	No. of clones of indicated reassortant/no. of clones identified^a at:
		7 dpi		15 dpi		21 dpi
		F₃ or L₃	h	F₃ or L₃	h	F₃ or L₃	h
L₁L₂L₃ + h	1	NI^b	NI	NI	NI	NI	NI
L₁L₂L₃ + h	2	−^c	−	6/9	3/9	10/10	0/10
L₁F₂L₃ + h	1	0/10	10/10	0/10	10/10	0/10	10/10
L₁F₂L₃ + h	2	0/10	10/10	0/10	10/10	0/10	10/10
F₁F₂L₃ + h	1	0/9	9/9	0/9	9/9	0/10	10/10
F₁F₂L₃ + h	2	0/10	10/10	0/8	8/8	0/9	9/9
F₁F₂F₃ + h	1	10/10	0/10	10/10	0/10	10/10	0/10
F₁F₂F₃ + h	2	10/10	0/10	10/10	0/10	10/10	0/10
F₁L₂F₃ + h	1	8/8	0/8	10/10	0/10	2/9	7/9
F₁L₂F₃ + h	2	NI	NI	NI	NI	NI	NI
F₁L₂L₃ + h	1	NI	NI	NI	NI	NI	NI
F₁L₂L₃ + h	2	9/10	1/10	0/8	8/8	2/6	4/6
L₁F₂F₃ + h	1	0/10	10/10	0/10	10/10	0/10	10/10
L₁F₂F₃ + h	2	0/10	10/10	0/10	10/10	0/10	10/10
L₁F₂F₃L₃ + h	1	0/10	10/10	0/10	10/10	0/10	10/10
L₁F₂F₃L₃ + h	2	0/10	10/10	0/10	10/10	0/10	10/10
F₁F₂L₃F₃ + h	1	0/10	10/10	0/10	10/10	0/10	10/10
F₁F₂L₃F₃ + h	2	10/10^d	0/10	10/10^d	0/10	10/10^d	0/10
L₁F_2aL_2bL₃ + h	1	0/10	10/10	0/10	10/10	0/10	10/10
L₁F_2aL_2bL₃ + h	2	0/10	10/10	0/10	10/10	0/10	10/10
L₁F_2aF_Δ2bL₃ + h	1	0/10	10/10	0/10	10/10	0/10	10/10
L₁F_2aF_Δ2bL₃ + h	2	0/10	10/10	0/10	10/10	0/10	10/10
L₁L_2aL_Δ2bL₃ + h	1	0/10	10/10	0/10	10/10	0/10	10/10
L₁L_2aL_Δ2bL₃ + h	2	0/10	10/10	0/10	10/10	0/10	10/10
F₁F_2aL_2bL₃ + h	1	0/10	10/10	0/10	10/10	0/10	10/10
F₁F_2aL_2bL₃ + h	2	10/10	0/10	10/10	0/10	10/10	0/10
F₁F_2aF_Δ2bL₃ + h	1	0/10	10/10	0/10	10/10	0/10	10/10
F₁F_2aF_Δ2bL₃ + h	2	0/10	10/10	0/10	10/10	0/10	10/10
F₁F_2aL_2bF₃ + h	1	10/10	0/10	10/10	0/10	10/10	0/10
F₁F_2aL_2bF₃ + h	2	10/10	0/10	10/10	0/10	10/10	0/10
F₁F_2aF_Δ2bF₃ + h	1	10/10	0/10	10/10	0/10	10/10	0/10
F₁F_2aF_Δ2bF₃ + h	2	0/10	10/10	0/10	10/10	0/10	10/10

Open in a new tab

The “winner” is highlighted in grey.

NI, not infected.

−, the RT-PCR is negative.

The RNA 3 identified is F₃.

Fig 2 — Schematic representation of the competition experiments. The winner among the competitor RNAs 3 is indicated.

Comparison of L₁F₂L₃ plus h and F₁F₂L₃ plus h, where the recombinant “won” in both cases, indicates that the nature of RNA 1 alone does not affect the selection process and Fny RNA 2 may have better affinity with the interviral recombinant than with L₃. However, comparison of L₁F₂F₃ plus h, where the recombinant “wins,” and F₁F₂F₃ plus h, where the wt F₃ “wins,” indicates that the source of RNA 1 does control the fixation of the recombinant. Comparison of L₁F₂F₃ plus h and L₁F₂L₃ plus h, where the recombinant “wins” in both cases, indicates that the nature of the competing RNA 3 may not matter in the presence of heterologous RNAs 1 and 2 (L₁ and F₂). However, F₁F₂L₃ plus h and F₁F₂F₃ plus h indicate the contrary, i.e., that the nature of the competing RNA 3 may influence the selection of the recombinant. In the presence of homologous RNAs 1 and 2 from Fny, F₃ is selected over the recombinant RNA 3 while the recombinant is selected over L₃. F₁F₂L₃F₃ plus h (Table 3) confirms this, as F₃ is selected from among the three choices. In general, these sets of competition experiments indicate that the selection/fixation process is controlled by the interactions between the proteins encoded by RNAs 1 and 2 (i.e., the 1a, 2a, and 2b proteins) or between the RNAs 3 themselves.

On the other hand, comparison of L₁L₂L₃ plus h and L₁F₂L₃ plus h indicates that Fny RNA 2 may promote the selection of the interviral recombinant. Also, comparison of F₁F₂F₃ plus h and F₁L₂F₃ plus h corroborates the role of RNA 2 in the selection process: when Fny RNA 2 is replaced by that of LS-CMV, the parental F₃ is gradually replaced by the recombinant over time. This is further confirmed by F₁L₂F₃ plus h and F₁L₂L₃ plus h and by F₁L₂L₃ plus h and F₁F₂L₃ plus h: the replacement of F₂ by L₂ leads to the gradual fixation of the recombinant, irrespective of the wt source of RNA 3. This indicates that the selection process is mainly controlled by the interaction between the replicase complex and the replicating RNA 3. In the presence of the homologous RNAs 1 and 2, L₁L₂ or F₁F₂, the cognate RNA 3, L₃, or F₃ is selected over the recombinant, although with L₁L₂ the recombinant and L₃ seem to be in a tie until late in infection (Table 3). In the presence of the heterologous RNAs 1 and 2, L₁F₂, or F₁L₂, the recombinant outcompetes the parental RNA 3. Consequently, we investigated the putative role of the 2b gene in the fixation process described here with various reassortant viruses in which the 2b genes were deleted or exchanged between Fny- and LS-CMV. Comparison of L₁F_2aL_2bL₃ plus h, L₁F_2aF_2bL₃ plus h, and L₁F_2aF_Δ2bL₃ plus h, where the recombinant wins in all cases (Table 3 and Fig. 2) indicates that, in the presence of the heterologous RNAs 1 and 2 (L₁F₂), the source or even the presence of 2b is not critical for the fixation of the interviral recombinant. However, this is not the case in the presence of homologous RNAs 1 and 2 of L₁L₂ (L₁L_2aL_Δ2bL₃ plus h and L₁L_2aL_2bL₃ plus h), where the recombinant won in the presence of L_2b and the wt L₃ won in the absence of L_2b, or F₁F₂ (F₁F_2aL_2bL₃ plus h and F₁F_2aF_2bL₃ plus h; F₁F_2aF_Δ2bF₃ plus h and F₁F_2aF_2bF₃ plus h; F₁F_2aL_2bF₃ plus h and F₁F_2aF_Δ2bF₃ plus h), where the source or the absence of 2b only partially influences the fixation process. Comparison of F₁F_2aF_2bL₃ plus h and F₁F_2aF_Δ2bL₃ plus h, where the recombinant wins in both cases, shows that the absence of Fny 2b does not affect the fixation process in the context of RNAs 1 and 2 from Fny-CMV and RNA 3 of LS-CMV. These findings are different from those published by Shi et al. (32). These authors used a similar system in which an interviral recombinant emerged from a reassortant virus with RNAs 1 and 2 from Q-CMV and RNA 3 from TAV, with the 2b gene of TAV (or WAII-CMV) replacing that of Q-CMV. They indicated that the 2b gene controlled the generation and the selection of the interviral recombinants. It is possible that two different mechanisms control the fixation process in these two systems because in our case, a cognate 2b gene (L₁L_2aL_2bF₃) is sufficient to generate the recombinants and the fixation is a fairly rapid process, whereas this was not the case in the system described by Shi et al. (32). Indeed, our data clearly show an effect of the 2b gene in the fixation process, but only in the context of homologous RNAs 1 and 2, which was the only context tested by Shi et al. (32). Their findings could have been different had they tested the role of the 2b in a different context with Q₁T₂ or T₁Q₂, but these combinations are not viable. The role of 2b in the fixation process described here (in the context of a homologous interaction of RNAs 1 and 2) may be explained by the 2b protein preferentially binding to the cognate parental RNA 3 for cell-to-cell movement.

The results presented here provide insight into the viral factors controlling the fixation of interstrain recombinants in viral populations in planta. We have shown that the increase in relative fitness of the interviral recombinants is associated with a better adaptation to the replicase complex. This could be a mechanism used by interviral recombinants to evolve into new species in viruses with segmented genomes, a process that is probably a major driving force in deep evolution of RNA viruses (33).

ACKNOWLEDGMENTS

This work was supported by the Samuel Roberts Noble Foundation and by the Pennsylvania State University College of Agricultural Sciences.

We thank Luis Márquez and Xiaodong Bao for careful reading of the manuscript.

Footnotes

Published ahead of print 31 October 2012

REFERENCES

1. Roossinck MJ. 2001. Cucumber mosaic virus, a model for RNA virus evolution. Mol. Plant Pathol. 2:59–63 [DOI] [PubMed] [Google Scholar]
2. Palukaitis P, García-Arenal F. 2003. Cucumoviruses. Adv. Virus Res. 62:241–323 [DOI] [PubMed] [Google Scholar]
3. Roossinck MJ, Zhang L, Hellwald K-H. 1999. Rearrangements in the 5′ nontranslated region and phylogenetic analyses of cucumber mosaic virus RNA 3 indicate radial evolution of three subgroups. J. Virol. 73:6752–6758 [DOI] [PMC free article] [PubMed] [Google Scholar]
4. Palukaitis P, Roossinck MJ, Dietzgen RG, Francki RIB. 1992. Cucumber mosaic virus. Adv. Virus Res. 41:281–348 [DOI] [PubMed] [Google Scholar]
5. Hayes RJ, Buck KW. 1990. Complete replication of a eukaryotic virus RNA in vitro by a purified RNA-dependent RNA polymerase. Cell 63:363–368 [DOI] [PubMed] [Google Scholar]
6. Nitta N, Takanami Y, Kuwata S, Kubo S. 1988. Inoculation with RNAs 1 and 2 of cucumber mosaic virus induces viral RNA replicase activity in tobacco mesophyll protoplasts. J. Gen. Virol. 69:2695–2700 [Google Scholar]
7. Nitta N, Masuta C, Kuwata S, Takanami Y. 1988. Comparative studies on the nucleotide sequence of cucumber mosaic virus RNA3 between Y strain and Q. strain. Ann. Phytopathol. Soc. Jpn. 54:516–522 [Google Scholar]
8. Brigneti G, Voinnet O, Li W-X, Ji L-H, Ding S-W, Baulcombe DC. 1998. Viral pathogenicity determinants are suppressors of transgene silencing in Nicotiana benthamiana. EMBO J. 17:6739–6746 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
9. Shi B-J, Miller J, Symons RH, Palukaitis P. 2003. The 2b protein of cucumoviruses has a role in promoting the cell-to-cell movement of pseudorecombinant viruses. Mol. Plant Microbe Inteact. 16:261–267 [DOI] [PubMed] [Google Scholar]
10. Boccard F, Baulcombe D. 1993. Mutational analysis of cis-acting sequences and gene function in RNA3 of cucumber mosaic virus. Virology 193:563–578 [DOI] [PubMed] [Google Scholar]
11. Suzuki M, Kuwata S, Kataoka J, Masuta C, Nitta N, Takanami Y. 1991. Functional analysis of deletion mutants of cucumber mosaic virus RNA3 using an in vitro transcription system. Virology 183:106–113 [DOI] [PubMed] [Google Scholar]
12. Masuta C, Ueda S, Suzuki M, Uyeda I. 1998. Evolution of a quadripartite hybrid virus by interspecific exchange and recombination between replicase components of two related tripartite RNA viruses. Proc. Natl. Acad. Sci. U. S. A. 95:10487–10492 [DOI] [PMC free article] [PubMed] [Google Scholar]
13. Bonnet J, Fraile A, Sacristán S, Malpica JM, GarcíA-Arenal F. 2005. Role of recombination in the evolution of natural populations of Cucumber mosaic virus, a tripartite RNA plant virus. Virology 332:359–368 [DOI] [PubMed] [Google Scholar]
14. Canto T, Choi SK, Palukaitis P. 2001. A subpopulation of RNA 1 of Cucumber mosaic virus contains 3′ termini originating from RNAs 2 or 3. J. Gen. Virol. 82:941–945 [DOI] [PubMed] [Google Scholar]
15. Chen Y-K, Goldbach R, Prins M. 2002. Inter- and intramolecular recombinations in the Cucumber mosaic virus genome related to adaptation to alstroemeria. J. Virol. 76:4119–4124 [DOI] [PMC free article] [PubMed] [Google Scholar]
16. Morroni M, Thompson JR, Tepfer M. 2009. Analysis of recombination between viral RNAs and transgene mRNA under conditions of high selection pressure favour recombinants. J. Gen. Virol. 90:2798–2807 [DOI] [PubMed] [Google Scholar]
17. Thompson JR, Buratti E, Wispelaere M, Tepfer M. 2008. Structural and functional characterization of the 5′ region of subgenomic RNA5 of cucumber mosaic virus. J. Gen. Virol. 89:1729–1738 [DOI] [PubMed] [Google Scholar]
18. Pita JS, Roossinck MJ. 2013. Mapping viral functional domains for genetic diversity in plants. J. Virol. 87:790–797 [DOI] [PMC free article] [PubMed] [Google Scholar]
19. Pita JS, deMiranda JR, Schneider WL, Roossinck MJ. 2007. Environment determines fidelity for an RNA virus replicase. J. Virol. 81:9072–9077 [DOI] [PMC free article] [PubMed] [Google Scholar]
20. Rizzo TM, Palukaitis P. 1990. Construction of full-length cDNA clones of cucumber mosaic virus RNAs 1,2 and 3: generation of infectious RNA transcripts. Mol. Gen. Genet. 222:249–256 [DOI] [PubMed] [Google Scholar]
21. Zhang L, Hanada K, Palukaitis P. 1994. Mapping local and systemic symptom determinants of cucumber mosaic cucumovirus in tobacco. J. Gen. Virol. 75:3185–3191 [DOI] [PubMed] [Google Scholar]
22. Roossinck MJ, Kaplan I, Palukaitis P. 1997. Support of a cucumber mosaic virus satellite RNA maps to a single amino acid proximal to the helicase domain of the helper virus. J. Virol. 71:608–612 [DOI] [PMC free article] [PubMed] [Google Scholar]
23. Thompson JR, Tepfer M. 2009. The 3′ untranslated region of cucumber mosaic virus (CMV) subgroup II RNA3 arose by interspecific recombination between CMV and tomato aspermy virus. J. Gen. Virol. 90:2293–2298 [DOI] [PubMed] [Google Scholar]
24. Suzuki M, Hiba T, Masuta C. 2003. RNA recombination between cucumoviruses: possible role of predicted stem-loop strutures and an internal subgenomic promoter-like motif. Virology 306:77–86 [DOI] [PubMed] [Google Scholar]
25. Rao ALN, Grantham GL. 1994. Amplification in vivo of brome mosaic virus RNAs bearing 3′ noncoding region from cucumber mosaic virus. Virology 204:478–481 [DOI] [PubMed] [Google Scholar]
26. Roossinck MJ. 2002. Evolutionary history of Cucumber mosaic virus deduced by phylogenetic analyses. J. Virol. 76:3382–3387 [DOI] [PMC free article] [PubMed] [Google Scholar]
27. Sivakumaran K, Bao Y, Roossinck MJ, Kao CC. 2000. Recognition of the core RNA promoter for minus-strand RNA synthesis by the replicase of Brome mosaic virus and Cucumber mosaic virus. J. Virol. 74:10323–10331 [DOI] [PMC free article] [PubMed] [Google Scholar]
28. Ahlquist P, Dasgupta R, Kaesberg P. 1981. Near identity of the 3′ RNA secondary structure in bromoviruses and cucumber mosaic virus. Cell 23:183–189 [DOI] [PubMed] [Google Scholar]
29. Chapman MR, Kao CC. 1999. A minimal RNA promoter for minus-strand RNA synthesis by the brome mosaic virus polymerase. J. Mol. Biol. 286:709–720 [DOI] [PubMed] [Google Scholar]
30. Fernández-Cuartero B, Burgyán J, Aranda MA, Salánki K, Moriones E, García-Arenal F. 1994. Increase in the relative fitness of a plant virus RNA associated with its recombinant nature. Virology 203:373–377 [DOI] [PubMed] [Google Scholar]
31. de Wispelaere M, Rao ALN. 2009. Production of cucumber mosaic virus RNA5 and its role in recombination. Virology 384:179–191 [DOI] [PubMed] [Google Scholar]
32. Shi B-J, Symons RH, Palukaitis P. 2008. The cucumovirus 2b gene drives selection of inter-viral recombinants affecting the crossover site, the acceptor RNA and the rate of selection. Nuc Acids Res. 36:1057–1071 [DOI] [PMC free article] [PubMed] [Google Scholar]
33. Roossinck MJ. 2005. Symbiosis versus competition in the evolution of plant RNA viruses. Nat. Rev. Microbiol. 3:917–924 [DOI] [PubMed] [Google Scholar]

[B1] 1. Roossinck MJ. 2001. Cucumber mosaic virus, a model for RNA virus evolution. Mol. Plant Pathol. 2:59–63 [DOI] [PubMed] [Google Scholar]

[B2] 2. Palukaitis P, García-Arenal F. 2003. Cucumoviruses. Adv. Virus Res. 62:241–323 [DOI] [PubMed] [Google Scholar]

[B3] 3. Roossinck MJ, Zhang L, Hellwald K-H. 1999. Rearrangements in the 5′ nontranslated region and phylogenetic analyses of cucumber mosaic virus RNA 3 indicate radial evolution of three subgroups. J. Virol. 73:6752–6758 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B4] 4. Palukaitis P, Roossinck MJ, Dietzgen RG, Francki RIB. 1992. Cucumber mosaic virus. Adv. Virus Res. 41:281–348 [DOI] [PubMed] [Google Scholar]

[B5] 5. Hayes RJ, Buck KW. 1990. Complete replication of a eukaryotic virus RNA in vitro by a purified RNA-dependent RNA polymerase. Cell 63:363–368 [DOI] [PubMed] [Google Scholar]

[B6] 6. Nitta N, Takanami Y, Kuwata S, Kubo S. 1988. Inoculation with RNAs 1 and 2 of cucumber mosaic virus induces viral RNA replicase activity in tobacco mesophyll protoplasts. J. Gen. Virol. 69:2695–2700 [Google Scholar]

[B7] 7. Nitta N, Masuta C, Kuwata S, Takanami Y. 1988. Comparative studies on the nucleotide sequence of cucumber mosaic virus RNA3 between Y strain and Q. strain. Ann. Phytopathol. Soc. Jpn. 54:516–522 [Google Scholar]

[B8] 8. Brigneti G, Voinnet O, Li W-X, Ji L-H, Ding S-W, Baulcombe DC. 1998. Viral pathogenicity determinants are suppressors of transgene silencing in Nicotiana benthamiana. EMBO J. 17:6739–6746 [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]

[B9] 9. Shi B-J, Miller J, Symons RH, Palukaitis P. 2003. The 2b protein of cucumoviruses has a role in promoting the cell-to-cell movement of pseudorecombinant viruses. Mol. Plant Microbe Inteact. 16:261–267 [DOI] [PubMed] [Google Scholar]

[B10] 10. Boccard F, Baulcombe D. 1993. Mutational analysis of cis-acting sequences and gene function in RNA3 of cucumber mosaic virus. Virology 193:563–578 [DOI] [PubMed] [Google Scholar]

[B11] 11. Suzuki M, Kuwata S, Kataoka J, Masuta C, Nitta N, Takanami Y. 1991. Functional analysis of deletion mutants of cucumber mosaic virus RNA3 using an in vitro transcription system. Virology 183:106–113 [DOI] [PubMed] [Google Scholar]

[B12] 12. Masuta C, Ueda S, Suzuki M, Uyeda I. 1998. Evolution of a quadripartite hybrid virus by interspecific exchange and recombination between replicase components of two related tripartite RNA viruses. Proc. Natl. Acad. Sci. U. S. A. 95:10487–10492 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B13] 13. Bonnet J, Fraile A, Sacristán S, Malpica JM, GarcíA-Arenal F. 2005. Role of recombination in the evolution of natural populations of Cucumber mosaic virus, a tripartite RNA plant virus. Virology 332:359–368 [DOI] [PubMed] [Google Scholar]

[B14] 14. Canto T, Choi SK, Palukaitis P. 2001. A subpopulation of RNA 1 of Cucumber mosaic virus contains 3′ termini originating from RNAs 2 or 3. J. Gen. Virol. 82:941–945 [DOI] [PubMed] [Google Scholar]

[B15] 15. Chen Y-K, Goldbach R, Prins M. 2002. Inter- and intramolecular recombinations in the Cucumber mosaic virus genome related to adaptation to alstroemeria. J. Virol. 76:4119–4124 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B16] 16. Morroni M, Thompson JR, Tepfer M. 2009. Analysis of recombination between viral RNAs and transgene mRNA under conditions of high selection pressure favour recombinants. J. Gen. Virol. 90:2798–2807 [DOI] [PubMed] [Google Scholar]

[B17] 17. Thompson JR, Buratti E, Wispelaere M, Tepfer M. 2008. Structural and functional characterization of the 5′ region of subgenomic RNA5 of cucumber mosaic virus. J. Gen. Virol. 89:1729–1738 [DOI] [PubMed] [Google Scholar]

[B18] 18. Pita JS, Roossinck MJ. 2013. Mapping viral functional domains for genetic diversity in plants. J. Virol. 87:790–797 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B19] 19. Pita JS, deMiranda JR, Schneider WL, Roossinck MJ. 2007. Environment determines fidelity for an RNA virus replicase. J. Virol. 81:9072–9077 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B20] 20. Rizzo TM, Palukaitis P. 1990. Construction of full-length cDNA clones of cucumber mosaic virus RNAs 1,2 and 3: generation of infectious RNA transcripts. Mol. Gen. Genet. 222:249–256 [DOI] [PubMed] [Google Scholar]

[B21] 21. Zhang L, Hanada K, Palukaitis P. 1994. Mapping local and systemic symptom determinants of cucumber mosaic cucumovirus in tobacco. J. Gen. Virol. 75:3185–3191 [DOI] [PubMed] [Google Scholar]

[B22] 22. Roossinck MJ, Kaplan I, Palukaitis P. 1997. Support of a cucumber mosaic virus satellite RNA maps to a single amino acid proximal to the helicase domain of the helper virus. J. Virol. 71:608–612 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B23] 23. Thompson JR, Tepfer M. 2009. The 3′ untranslated region of cucumber mosaic virus (CMV) subgroup II RNA3 arose by interspecific recombination between CMV and tomato aspermy virus. J. Gen. Virol. 90:2293–2298 [DOI] [PubMed] [Google Scholar]

[B24] 24. Suzuki M, Hiba T, Masuta C. 2003. RNA recombination between cucumoviruses: possible role of predicted stem-loop strutures and an internal subgenomic promoter-like motif. Virology 306:77–86 [DOI] [PubMed] [Google Scholar]

[B25] 25. Rao ALN, Grantham GL. 1994. Amplification in vivo of brome mosaic virus RNAs bearing 3′ noncoding region from cucumber mosaic virus. Virology 204:478–481 [DOI] [PubMed] [Google Scholar]

[B26] 26. Roossinck MJ. 2002. Evolutionary history of Cucumber mosaic virus deduced by phylogenetic analyses. J. Virol. 76:3382–3387 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B27] 27. Sivakumaran K, Bao Y, Roossinck MJ, Kao CC. 2000. Recognition of the core RNA promoter for minus-strand RNA synthesis by the replicase of Brome mosaic virus and Cucumber mosaic virus. J. Virol. 74:10323–10331 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B28] 28. Ahlquist P, Dasgupta R, Kaesberg P. 1981. Near identity of the 3′ RNA secondary structure in bromoviruses and cucumber mosaic virus. Cell 23:183–189 [DOI] [PubMed] [Google Scholar]

[B29] 29. Chapman MR, Kao CC. 1999. A minimal RNA promoter for minus-strand RNA synthesis by the brome mosaic virus polymerase. J. Mol. Biol. 286:709–720 [DOI] [PubMed] [Google Scholar]

[B30] 30. Fernández-Cuartero B, Burgyán J, Aranda MA, Salánki K, Moriones E, García-Arenal F. 1994. Increase in the relative fitness of a plant virus RNA associated with its recombinant nature. Virology 203:373–377 [DOI] [PubMed] [Google Scholar]

[B31] 31. de Wispelaere M, Rao ALN. 2009. Production of cucumber mosaic virus RNA5 and its role in recombination. Virology 384:179–191 [DOI] [PubMed] [Google Scholar]

[B32] 32. Shi B-J, Symons RH, Palukaitis P. 2008. The cucumovirus 2b gene drives selection of inter-viral recombinants affecting the crossover site, the acceptor RNA and the rate of selection. Nuc Acids Res. 36:1057–1071 [DOI] [PMC free article] [PubMed] [Google Scholar]

[B33] 33. Roossinck MJ. 2005. Symbiosis versus competition in the evolution of plant RNA viruses. Nat. Rev. Microbiol. 3:917–924 [DOI] [PubMed] [Google Scholar]

PERMALINK

Fixation of Emerging Interviral Recombinants in Cucumber Mosaic Virus Populations

Justin S Pita

Marilyn J Roossinck

Abstract

TEXT

Table 1.

Fig 1.

Table 2.

Table 3.

Fig 2.

ACKNOWLEDGMENTS

Footnotes

REFERENCES

ACTIONS

PERMALINK

RESOURCES

Cite

Add to Collections

PERMALINK

Fixation of Emerging Interviral Recombinants in Cucumber Mosaic Virus Populations

Justin S Pita

Marilyn J Roossinck

Abstract

TEXT

Table 1.

Fig 1.

Table 2.

Table 3.

Fig 2.

ACKNOWLEDGMENTS

Footnotes

REFERENCES

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases