Skip to main content
Molecular and Cellular Biology logoLink to Molecular and Cellular Biology
. 2013 Jan;33(2):457–472. doi: 10.1128/MCB.05831-11

Novel Checkpoint Pathway Organization Promotes Genome Stability in Stationary-Phase Yeast Cells

Bonnie Alver 1, Maire K Kelly 1, David T Kirkpatrick 1,
PMCID: PMC3554122  PMID: 23149941

Abstract

Most DNA alterations occur during DNA replication in the S phase of the cell cycle. However, the majority of eukaryotic cells exist in a nondividing, quiescent state. Little is known about the factors involved in preventing DNA instability within this stationary-phase cell population. Previously, we utilized a unique assay system to identify mutations that increased minisatellite alterations specifically in quiescent cells in Saccharomyces cerevisiae. Here we conducted a modified version of synthetic genetic array analysis to determine if checkpoint signaling components play a role in stabilizing minisatellites in stationary-phase yeast cells. Our results revealed that a subset of checkpoint components, specifically MRC1, CSM3, TOF1, DDC1, RAD17, MEC3, TEL1, MEC1, and RAD53, prevent stationary-phase minisatellite alterations within the quiescent cell subpopulation of stationary-phase cells. Pathway analysis revealed at least three pathways, with MRC1, CSM3, and TOF1 acting in a pathway independent of MEC1 and RAD53. Overall, our data indicate that some well-characterized checkpoint components maintain minisatellite stability in stationary-phase cells but are regulated differently in those cells than in actively growing cells. For the MRC1-dependent pathway, the checkpoint itself may not be the important element; rather, it may be loss of the checkpoint proteins' other functions that contributes to DNA instability.

INTRODUCTION

Most eukaryotic cells spend the majority of their life span in a quiescent or nondividing state. It is thought that mutations arising within quiescent cells can allow them to escape quiescence, reentering the cell cycle and initiating tumorigenesis (13). Bypass of cellular growth controls results in unregulated cell divisions and the accumulation of genomic instability, two of the major hallmarks of cancer. At present, little is known about the initial mutagenic events that occur within quiescent cells that cause them to become cancerous. This is due to a lack of assay systems to assess genomic stability within this specific cell population. We previously developed an assay to monitor DNA stability in stationary-phase yeast cells. Since stationary-phase yeast cells are cells that have entered a cellular state called G0, which is equivalent to the mammalian quiescent state (4, 5), our assay allows us to analyze events in this critical population (68).

Checkpoints act as guardians of genomic stability, preventing the accumulation and replication of damaged DNA. In the yeast Saccharomyces cerevisiae, several checkpoints arrest the cell cycle when DNA damage, replication, or mitotic errors occur (Fig. 1). During S phase, the replication checkpoint is activated when replication forks stall (9, 10). This allows DNA repair to occur and prevents the formation of single-stranded DNA (ssDNA), which can be used as a template for chromosomal rearrangements. The protein kinase Mec1p is recruited to RPA-coated ssDNA at stalled replication forks, where it phosphorylates signal transducers, such as Mrc1p or Rad9p (1113). Phosphorylation of Mrc1p or Rad9p results in the recruitment of Rad53p to the replication fork and activation of the replication checkpoint (1416).

Fig 1.

Fig 1

Summary of checkpoint factors. (a) In Saccharomyces cerevisiae, several checkpoints regulate cell cycle progression to ensure that DNA damage or errors made during replication or mitosis can be effectively repaired. These checkpoints include the replication checkpoint, intra-S-phase checkpoint, DNA damage checkpoints, and mitotic checkpoint. Each utilizes several pathways to signal and activate cell cycle arrest. (b) In stationary-phase G0 cells, only a subset of the checkpoint proteins have roles in maintaining DNA stability. Genes overlaid with an X are not active in G0 in the indicated pathway. Genes shown in bold exhibit the strongest phenotype. Question marks designate speculative interactions or pathways. The pathway denoted in gray dotted lines represents a Rad9p-dependent backup pathway that is activated when Mrc1p function is compromised.

Intra-S-phase and DNA damage checkpoints utilize similar signal transduction pathways to block cell cycle progression (Fig. 1) (10, 17). The DNA damage signal is propagated by the kinases Mec1p and Tel1p, a protein functionally redundant with Mec1p (1820). Mec1p and Rad24p (a component of the RFC-like complex which loads the PCNA-like clamp composed of Ddc1p, Rad17p, and Mec3p onto DNA [21, 22]) are independently recruited to the site of DNA damage (23, 24). This localization results in the activation of Mec1p and leads to the activation of Rad53p through the phosphorylation of Rad9p. Alternatively, Mec1p can also phosphorylate the kinase Chk1p to relay the signal and prevent cell cycle progression (25).

During mitosis, the spindle assembly checkpoint prevents the onset of anaphase until all chromosomes are properly attached to the mitotic spindle (26). In brief, Mps1p, Mad1p, Mad2p, Mad3p, Bub1p, and Bub3p localize to unattached kinetochores (27, 28). This binding prevents the activation of the anaphase-promoting complex (APC) through inhibition of its substrate Cdc20p (29). The inhibition of Cdc20p prevents the degradation of APC substrates, thereby delaying anaphase progression until all sister chromatids are properly aligned. These cell cycle surveillance mechanisms ensure the proper replication of DNA and segregation of chromosomes.

In yeast, stationary-phase cells recapitulate the phenotypes of quiescent cells found in other eukaryotic systems (4, 5). Recent studies in S. cerevisiae have shown that the checkpoint kinase Rad53p is phosphorylated in DNA repair mutants that are in stationary phase (30). Furthermore, the authors found a dramatic increase in the amount of spontaneous mutability within these cells. Due to the discovery of Rad53p activation in stationary-phase cells, we wanted to determine if other well-characterized checkpoint components play a role in maintaining genomic stability once cells have exited the cell cycle.

To allow us to study genomic rearrangement events in stationary-phase cells, we developed a novel color segregation assay that assesses the genomic stability of repetitive DNA tracts in stationary-phase yeast cells (6, 7). For this assay, we inserted a short minisatellite into the ADE2 gene (the ade2-min3 allele) of S. cerevisiae (Fig. 2a). Insertion of the minisatellite tract in the ADE2 gene pushes the gene out of frame, resulting in a red colony color and making the cells auxotrophic for adenine. Alterations occurring within the minisatellite are monitored by examining strains bearing the ade2-min3 allele for the presence of a color segregation phenotype. If the minisatellite tract loses one repeat or gains two repeats, the ADE2 gene is pushed back into frame, resulting in colonies that are now white in color and Ade+.

Fig 2.

Fig 2

Colony morphology of strains bearing the ade2-min3 allele. Each strain was streaked onto solid YPD medium, incubated at 30°C for 2 days, and then left at RT for 6 days. (a) The ade2-min3 allele consists of three tandem 20-bp repeats plus one additional base inserted into the ADE2 gene at the XbaI site, producing a 5-bp overhang (ACTAG) at the site of insertion and throwing the ADE2 gene out of frame. The deletion of one repeat unit or the addition of two repeat units restores the ADE2 open reading frame (6, 7). (b) Strains bearing the ade2-min3 allele display a variety of blebbing phenotypes. The mec1-21 and rad53-1 strains display both blebbing and sectoring phenotypes.

Previously, we performed a UV mutagenesis screen to find mutants that destabilized the minisatellite tract within the ade2-min3 allele (7). From this screen, we identified several mutations within the zinc homeostasis genes ZRT1 and ZAP1 that resulted in a novel color segregation phenotype called blebbing. Blebs are white Ade+ microcolonies that form on the surface of the red Ade colony. Further characterization of the blebbing phenotype revealed that it resulted from the loss or gain of minisatellite repeats that occurred once cells entered stationary phase. Restoration of ADE2 function allowed the cell to escape the adenine nutrient limitation that had caused the cells to enter stationary phase and begin to grow again, forming the white microcolonies on the red colony. We subsequently demonstrated that the DNA alterations were occurring specifically within quiescent cells and not within a subpopulation of slowly growing G0 cells. We also demonstrated that the alterations were occurring independently of the ADE2 assay system, were not affected by genomic location, and were dependent upon an active recombination system (6, 7). Thus, our prior work establishes an assay system in which genomic instability can be readily studied within stationary-phase cells.

In this study, we used a modified version of synthetic genetic array (SGA) analysis (31, 32) to determine if well-characterized checkpoints play an active role in stabilizing minisatellites during stationary phase. In brief, we mated a query strain containing the ade2-min3 allele to mutant strains bearing either a complete deletion of a nonessential gene or a temperature-sensitive (ts) allele of an essential gene. We examined the resulting double mutants for the presence of a blebbing phenotype and then verified this phenotype in a separate strain background. Our results reveal that a specific subset of checkpoint components (namely, MRC1, CSM3, TOF1, DDC1, RAD17, MEC3, TEL1, MEC1, and RAD53) prevents minisatellite alterations in quiescent yeast cells in stationary phase.

Interestingly, CHK1, RAD9, and BUB3, despite their major roles in several cell cycle checkpoints, do not stabilize minisatellites in stationary-phase cells, implying that checkpoints in stationary-phase cells function in novel pathways and are regulated differently. This is supported by our pathway analysis in which we find that the key checkpoint components MEC1, RAD53, and the MRC1/CSM3/TOF1 complex function in independent genetic pathways during stationary phase, implying that the latter complex is not part of the Mec1p and Rad53p phosphorylation cascade. We also find that a RAD9-dependent pathway is active in stationary-phase cells and prevents minisatellite instability when Mrc1p function is compromised. Our work provides evidence that checkpoint proteins play an active role in maintaining genomic stability in stationary-phase cells and that these proteins interact differently in stationary-phase and actively growing cells.

MATERIALS AND METHODS

Media and yeast strains.

Liquid and solid media used in this study were prepared as described previously (33). Solid yeast extract-peptone-dextrose (YPD) medium containing Geneticin (G418) was made by adding 200 mg/liter G418 sulfate (Cellgro) to YPD. Medium used for the SGA analysis was prepared as described elsewhere (31, 32). Presporulation solid medium consisted of 2% agar, 5% dextrose, 1% Difco yeast extract, and 3% Difco nutrient broth. Yeast mating, sporulation, and tetrad dissection were performed as stated previously (34).

All Saccharomyces cerevisiae strains used in this study are listed in Table 1. Each strain was derived from DTK264 (MATa his7-2 leu2::HisG trp1-289 ura3-52 ade2-min3) or DTK271 (MATα his7-2 leu2::HisG trp1-289 ura3-52 ade2-min3) (7). All strains with gene disruptions were constructed by isolating corresponding genomic DNA from the nonessential yeast deletion strain haploid set. In brief, PCR products containing the KANMX4 gene (G418 resistance) were generated from the genomic DNA using 5′ and 3′ flanking primers listed in Table 2. Parental strains were transformed with the KANMX PCR product and grown for 4 h at 30°C in liquid YPD. Transformants were selected on YPD plus G418 solid medium. All isolates were verified by PCR.

Table 1.

Yeast strains used in this study

Strain Relevant genotype Construction details or reference
pDC369 URA3MX Gift from D. Clarke; originally from M. Tyers; pURAMX
DCY1793 rad53-1 Raveendranathan et al. (35)
DCY2556 his3-1 ura3-0 can1::MFA1pr-spHIS5 MATa Gift from D. Clarke; originally from M. Tyers (2446-14-2)
DCY2557 his3-1 ura3-0 can1:: MFA1pr-spHIS5 MATα Gift from D. Clarke; originally from M. Tyers (3172-50-4)
DKY2563 mec1-21 Gift from D. Koepp; originally from S. Elledge (Y663)
Y2298 mrc1AQ Osborn and Elledge (15)
Y2544 mrc1-C14 Naylor et al. (13)
YKH25 pkc1-4 Huang and Symington (36)
DTK264 ade2-min3 MATa Kelly et al. (7)
DTK271 ade2-min3 MATα Kelly et al. (7)
DTK284 ade2-min3 Kelly et al. (7)
DTK878 ade2-min3 zrt1Δ::KANMX Kelly et al. (7)
DTK893 ade2-min3-URA3MX his3-1 ura3-0 can1::MFA1pr-spHIS5 MATa DCY2556 with ade2-min3 - URA3MX-linked cassette
DTK904 ade2-min3 zrt1Δ::LEU2 DTK284 with zrt1Δ::LEU2a
DTK1008 ade2-min3 chk1Δ::KANMX DTK271 with chk1Δ::KANMXa
DTK1012 ade2-min3 zrt1Δ::LEU2 rad27Δ::KANMX DTK904 with rad27Δ::KANMXa
DTK1088 ade2-min3 end3Δ::KANMX DTK271 with end3Δ::KANMXa
DTK1093 ade2-min3 rad9Δ::KANMX DTK271 with rad9Δ::KANMXa
DTK1170 ade2-min3 rad53-1 DTK271 × DCY1793, isolated spore
DTK1171 ade2-min3 rad53-1 zrt1Δ::KANMX DTK878 × DCY1793, isolated spore
DTK1175 ade2-min3-URA3MX his3-1 ura3-0 can1::MFA1pr-spHIS5 DCY2557 × DTK893
DTK1189 5a ade2-min3-URA3MX his3-1 ura3-0 can1:: MFA1pr-spHIS5 MATa MATa DTK1175
DTK1189 2b ade2-min3-URA3MX his3-1 ura3-0 can1::MFA1pr-spHIS5 MATα MATα DTK1175
DTK1199 ade2-min3 rad27Δ::KANMX DTK271 × DTK1012, isolated spore
DTK1217 ade2-min3 rad53-1 rad27Δ::KANMX DTK1170 × DTK1199, isolated spore
DTK1219 ade2-min3 rad53-1 end3Δ::KANMX DTK1088 × DTK1170, isolated spore
DTK1270 ade2-min3 rad53-1 por1Δ::KANMX DTK1170 with por1Δ::KANMXa
DTK1272 ade2-min3 rad53-1 etr1Δ::KANMX DTK1170 with etr1Δ::KANMXa
DTK1279 ade2-min3 pkc1-4 DTK271 × YKH27, isolated spore
DTK1295 ade2-min3 rad53-1 pkc1-4 DTK1170 × DTK1279, isolated spore
DTK1360 ade2-min3 etr1Δ::KANMX DTK271 with etr1Δ::KANMXa
DTK1361 ade2-min3 por1Δ::KANMX DTK271 with por1Δ::KANMXa
DTK1392 ade2-min3 mrc1Δ::KANMX DTK271 with mrc1Δ::KANMXa
DTK1521 ade2-min3 csm3Δ::KANMX DTK264 with csm3Δ::KANMXa
DTK1526 ade2-min3 ddc1Δ::KANMX DTK271 with ddc1Δ::KANMXa
DTK1527 ade2-min3 rad17Δ::KANMX DTK271 with rad17Δ::KANMXa
DTK1528 ade2-min3 tof1Δ::KANMX DTK271 with tof1Δ::KANMXa
DTK1529 ade2-min3 csm3Δ::KANMX DTK271 with csm3Δ::KANMXa
DTK1530 ade2-min3 mec3Δ::KANMX DTK271 with mec3Δ::KANMXa
DTK1532 ade2-min3 tof1Δ::KANMX DTK264 with tof1Δ::KANMXa
DTK1539 ade2-min3 mrc1Δ::KANMX DTK264 with mrc1Δ::KANMXa
DTK1549 ade2-min3 mrc1Δ::KANMX tof1Δ::KANMX DTK1392 × DTK1532, isolated spore
DTK1551 ade2-min3 mrc1Δ::KANMX csm3Δ::KANMX DTK1392 × DTK1521, isolated spore
DTK1554 ade2-min3 tof1Δ::KANMX csm3Δ::KANMX DTK1528 × DTK1521, isolated spore
DTK1556 ade2-min3 mrc1Δ::KANMX zrt1Δ::KANMX DTK1539 × DTK878, isolated spore
DTK1558 ade2-min3 mrc1Δ::KANMX rad53-1 DTK1392 × DTK1170, isolated spore
DTK1559 ade2-min3 mrc1Δ::KANMX rad27Δ::KANMX DTK1392 × DTK1199, isolated spore
DTK1587 ade2-min3 mrc1Δ::KANMX etr1Δ::KANMX DTK1539 × DTK1360, isolated spore
DTK1588 ade2-min3 mrc1Δ::KANMX por1Δ::KANMX DTK1539 × DTK1361, isolated spore
DTK1603 ade2-min3 mrc1Δ::KANMX pkc1-4 DTK1392 × DTK1279, isolated spore
DTK1630 ade2-min3 mrc1AQ DTK271 × Y2298, isolated spore
DTK1683 ade2-min3 mrc1-C14 DTK271 × Y2544, isolated spore
DTK1691 ade2-min3 bub3Δ::KANMX DTK271 with bub3Δ::KANMXa
DTK1693 ade2-min3 tof1Δ::KANMX por1Δ::KANMX DTK1532 × DTK1361, isolated spore
DTK1694 ade2-min3 tof1Δ::KANMX etr1Δ::KANMX DTK1532 × DTK1360, isolated spore
DTK1695 ade2-min3 csm3Δ::KANMX etr1Δ::KANMX DTK1521 × DTK1360, isolated spore
DTK1697 ade2-min3 rad17Δ::KANMX DTK264 with rad17Δ::KANMXa
DTK1700 ade2-min3 csm3Δ::KANMX por1Δ::KANMX DTK1521 × DTK1361, isolated spore
DTK1740 ade2-min3 mrc1AQ rad9Δ::KANMX DTK1630 with rad9Δ::KANMXa
DTK1762 ade2-min3 rad17Δ::KANMX zrt1Δ::KANMX DTK1697 × DTK878, isolated spore
DTK1763 ade2-min3 tel1Δ::KANMX DTK271 with tel1Δ::KANMXa
DTK1765 ade2-min3 rad17Δ::KANMX rad53-1 DTK1697 × DTK1170, isolated spore
DTK1766 ade2-min3 mrc1AQ-C14 DTK1630 with mrc1-C14::KANMXa
DTK1767 ade2-min3 rad17Δ::KANMX end3Δ::KANMX DTK1697 × DTK1088, isolated spore
DTK1769 ade2-min3 rad17Δ::KANMX rad27Δ::KANMX DTK1697 × DTK1199, isolated spore
DTK1776 ade2-min3 mec1-21 DTK271 × DKY2563, isolated spore
DTK1777 ade2-min3 rad17Δ::KANMX pkc1-4 DTK1697 × DTK1279, isolated spore
DTK1806 ade2-min3 mrc1Δ::KANMX end3Δ::KANMX DTK1539 × DTK1088, isolated spore
DTK1825 ade2-min3 mrc1AQ por1Δ::KANMX DTK1630 with por1Δ::KANMXa
DTK1826 ade2-min3 mrc1AQ etr1Δ::KANMX DTK1630 with etr1Δ::KANMXa
DTK1827 ade2-min3 mec1-21 por1Δ::KANMX DTK1776 with por1Δ::KANMXa
DTK1832 ade2-min3 mec1-21 zrt1Δ::LEU2 DTK1776 with zrt1Δ::LEU2a
DTK1833 ade2-min3 mec1-21 rad17Δ::KANMX DTK1776 with rad17Δ::KANMXa
DTK1836 ade2-min3 mrc1-C14 etr1Δ::KANMX DTK1683 with etr1Δ::KANMXa
DTK1838 ade2-min3 mec1-21 mrc1Δ::KANMX DTK1776 with mrc1Δ::KANMXa
DTK1839 ade2-min3 mec1-21 rad27Δ::KANMX DTK1776 with rad27Δ::KANMXa
DTK1840 ade2-min3 mec1-21 etr1Δ::KANMX DTK1776 with etr1Δ::KANMXa
DTK1841 ade2-min3 mrc1-C14 por1Δ::KANMX DTK1683 with por1Δ::KANMXa
DTK1855 ade2-min3 mec1-21 rad53-1 DTK1776 × DTK1170, isolated spore
DTK1871 ade2-min3 mec1-21 pkc1-4 DTK1776 × DTK1603, isolated spore
DTK1873 ade2-min3 mrc1AQ-C14 por1Δ::URA3 DTK1766 with por1::URA3a
DTK1882 ade2-min3 mrc1AQ-C14 etr1Δ::URA3 DTK1766 with etr1::URA3a
DTK1883 ade2-min3 mec1-21 end3Δ::KANMX DTK1776 with end3Δ::KANMXa
DTK1979 ade2-min3 rfa1-t11 DTK271 with rfa1-t11
DTK1980 ade2-min3 rfa1-t11 mrc1Δ::KANMXa DTK1979 with mrc1Δ::KANMXa
DTK1981 ade2-min3 rfa1-t11 zrt1Δ::KANMXa DTK1979 with zrt1Δ:: KANMXa
a

The strain was made using a PCR-generated construct.

Table 2.

PCR primers used in this study

Primer Reference no. Sequence
Ade2 F + Tag 14193006 TCCAGTTTAAACGAGCTCGAATTCGAAGCCGAGAATTTTGTAACACC
Ade2 F 14193008 GGGTTAGCTATTTCGCCCAATG
Ade2 R 14193007 TCGCCTTAAGTTGAACGGAGTC
Bub3 F 56372139 CTTTCGGTGACAACCAAGCCTCAT
Bub3 R 56372140 TGGGAGCAGACTTTTGGGCTTA
Chk1 F 23094597 GAGGCCTGCCGAAGTTAATA
Chk1 R 23094598 CGATGACACACTAGAAATCGAC
Csm3 F 46100595 CGCCACGGCTAACTCCAAACATAA
Csm3 R 46100596 CGAGGGAAGCTTGGCTGTTTTCT
Ddc1 F 49746409 CTTCGAGACCAAAGCACTGA
Ddc1 R 49746410 AGTCCATGTCGCAATAAGC
End3 F 28278222 GAGTTAGTGGGTATTGGAAAGGC
End3 R 28278223 CCACACCGTTACTGGATAGA
Etr1 F 37616573 TGTACCCAGGGGTGGTTTCCAT
Etr1 R 37616572 TTGAAGGGTCGACGTCCCCTTTTA
Mec3 F 49746407 TAACTTCTGTGCAGGGGTAGTCGT
Mec3 R 49746408 TGCAACATACCGTTCGTAAGGCT
Mrc1 F 46100597 ACACCAACTCTACTGGCTCTCA
Mrc1 R 46100598 TGCCTCCTTTACCTAACCTACTC
Mrc1/KanMX/C14 F 78415868 AGAAAAAGGAGATTAGAAATTGGCGATGATGCAAAGCTTGTTAAAAACCCACGTACGCTGCAGGTCGAC
Mrc1/KanMX/C14 R 78415869 AAGACAGCTTCTGGAGTTCAATCAACTTCTTCGGAAAAGATAAAAAACCAATCGATGAATTCGAGCTCG
Por1 F 37616575 CCAATCAAACACCGCCATTTCG
Por1 R 37616574 TTCTCACTGCCAAGCAACCA
Rad9 F 28611970 ACGATGAGCAATGTGAAGTGAGCA
Rad9 R 28611971 CGTGTGGGAGGATGTTCTTAGACT
Rad17 F 49746405 AAGGTGCATCTCAGGCTACTGAAG
Rad17 R 49746406 TAGGTGAATGGGCTGGTTTGGGTA
Rad27 F 23094593 GCGTAACATCGCGCAAATGAAG
Rad27 R 23094594 TCCACGTTCAAGTTCCCAGAAA
Tef/Ura3 F 14193004 GGGTTAGCTATTTCGCCCAATGTGTCCATCTGACATTACTATTTTGCATTTTAATTTAATAGATCTGTTTAGCTTGCCTCGT
Tef/Ura3 R 14193005 GGTGTTACAAAATTCTCGGCTTCGAATTCGAGCTCGTTTAAACTGGA
Tel1 F 78479079 TATGAGCGTGATAGGAGGGTCT
Tel1 R 78479080 GGTAGCTTCACTATCAGCGATTGT
Tof1 F 46100599 TGGGTAGTGCCCTGTATGAATTGC
Tof1 R 46100600 GACGATAGGCGACAAAACCCAAGA
Zrt1 F 12966370 TACGCACGGCATTAGCTC
Zrt1 R 12966371 ACTCGTAGATGGCACGGTC

DTK1279, a strain bearing the pkc1-4 allele, was constructed by mating DTK271 with YKH25 (a gift from Lorraine Symington, Columbia University) (36). Spores were isolated by red color and lack of growth at 37°C. The resulting haploid was backcrossed twice to DTK271 to produce DTK1279.

The strain DTK1776, bearing a point mutation in MEC1, was constructed by mating DTK271 with the mec1-21 strain DKY256 (a gift from Deanna Koepp, University of Minnesota); this strain was originally from Y663 (37). The resulting diploid was sporulated and dissected, and a spore bearing the ade2-min3 allele, as well as the mec1-21 mutation, was isolated by colony color and sensitivity to 100 mM hydroxyurea (HU). This isolate was backcrossed twice to DTK271 to generate DTK1776. DTK1170, bearing a point mutation in RAD53, was constructed in a similar manner. The ade2-min3 strain DTK271 was mated with the rad53-1 strain DCY1793 (35). An ade2-min3 rad53-1 isolate was identified by colony color and sensitivity to HU. This spore isolate was backcrossed twice to the parental DTK271 strain as above to generate DTK1170, an ade2-min3 rad53-1 isolate.

DTK1630, bearing the ade2-min3 allele and a checkpoint-defective allele of MRC1 (mrc1AQ), was constructed by mating DTK271 with Y2298 (15). Spores were isolated by colony color and growth on medium lacking histidine. Progeny were backcrossed two times to DTK271. The strain DTK1683, bearing ade2-min3 and a replication-defective allele of MRC1 (mrc1-C14), was constructed by mating DTK271 with Y2544 (Y2298 and Y2544 are gifts from Steve Elledge, Harvard Medical School) (13). Spores were isolated by resistance to G418 and colony color. Progeny were backcrossed twice to DTK271. DTK1766, a strain bearing the C14 C-terminal truncation of Mrc1p combined with the AQ mutations, was constructed by transforming a KANMX PCR product into DTK1630. The KANMX PCR product, bearing MRC1 flanking sequence to delete residues 844 to 1096, was generated using pFAKANMX6 as the template and the primers 78415868 and 78415869. Transformants were selected by resistance to G418 and sequenced.

The strain DTK1979, bearing the rfa1-t11 allele, was constructed using the “pop-in/pop-out” method described elsewhere (38). Here, the rfa1-t11 open reading frame was excised from pKU1-t11 (a gift from Richard Kolodner, University of California San Diego) with SalI and HindIII (39). The resulting fragment was gel purified. The purified rfa1-t11 fragment was cloned into the multiple cloning site of pRS306, resulting in the plasmid pBMA105. Insertion of the rfa1-t11 open reading frame was confirmed by sequencing. pBMA105 was then linearized with MfeI. The digested plasmid was gel purified and transformed into DTK271. Transformants bearing an integrated rfa1-t11 allele were selected on synthetic dextrose without uracil (SD-Ura) solid medium. Ura+ transformants were patched onto YPD medium, grown at 30°C, and then replica plated to 5-fluoroorotic acid (5-FOA) medium. Single papillae were patched onto YPD, incubated at 30°C overnight, and then replica plated to SD-Ura solid medium. DTK1979 was isolated as a red Ura transformant bearing the rfa1-t11 allele, as verified by sequencing and sensitivity to 0.02% methyl methanesulfonate (MMS).

The following haploid strains were generated by mating, sporulation, and tetrad dissection: DTK1171 (DTK878 × DCY1793), DTK1199 (DTK271 × DTK 1012), DTK1217 (DTK1170 × DTK1199), DTK1219 (DTK1088 × DTK1170), DTK1295 (DTK1170 × DTK1279), DTK1549 (DTK1392 × DTK1532), DTK1551 (DTK1392 × DTK1521), DTK1554 (DTK1528 × DTK1521), DTK1556 (DTK1539 × DTK878), DTK1558 (DTK1392 × DTK1170), DTK1559 (DTK1392 × DTK1199), DTK1587 (DTK1539 × DTK1360), DTK1588 (DTK1539 × DTK1361), DTK1603 (DTK1392 × DTK1279), DTK1693 (DTK1532 × DTK1361), DTK1694 (DTK1532 × DTK1360), DTK1695 (DTK1521 × DTK1360), DTK1700 (DTK1521 × DTK1361), DTK1762 (DTK1697 × DTK878), DTK1765 (DTK1697 × DTK1170), DTK1767 (DTK1697 × DTK1088), DTK1769 (DTK1697 × DTK1199), DTK1777 (DTK1697 × DTK1279), DTK1806 (DTK1539 × DTK1088), DTK1855 (DTK1776 × DTK1170), and DTK1871 (DTK1776 × DTK1603). For each strain, a spore containing the ade2-min3 allele as well as the marked gene deletion was isolated by color phenotype and growth on selective medium. Strains containing the mec1-21 or rad53-1 allele were also isolated by sensitivity to HU. Strains bearing the pkc1-4 allele were selected based on lack of growth at 37°C. Strains were verified by PCR. DTK1855 was verified by sequencing.

For SGA analysis, we constructed DTK893 (MATa his3-1 ura3-0 can1::MFA1pr-spHIS5 ade2-min3-URA3MX). A two-step PCR process was used to generate an ade2-min3 URA3MX-linked cassette. In brief, a URA3MX PCR product, flanked by a 5′ TEF promoter site and a 3′ TEF terminator site, was obtained from pDC369 (generous gift from Duncan Clarke, University of Minnesota), using the primers 14193004 and 14193005. An ade2-min3 PCR product was isolated from DTK271 genomic DNA using the primers 14193006 and 14193007. The URA3MX and ade2-min3 PCR products were combined using the primers 14193007 and 14193008. The complete ade2-min3 URA3MX-linked cassette was transformed into DCY2556, and Ura+ cells were selected on solid synthetic medium lacking uracil, yielding DTK893. DTK893 was crossed to DCY2557 (DCY2556 and DCY2557 are gifts from Duncan Clarke, University of Minnesota) to generate the diploid DTK1175. DTK1175 was sporulated and dissected, and red Ura+ spores were selected on synthetic medium lacking uracil. Isolates of DTK1175 were chosen as the query strains for the various SGA analyses: DTK1189 5a is a MATa derivate, and DTK1189 2b is a MATα derivate.

Synthetic genetic array analysis. (i) Nonessential SGA.

We conducted a modified version of synthetic genetic array analysis (31, 32). For this screen, we inoculated liquid YPD medium with a single colony of the DTK1189 5a query strain. After incubation at 30°C overnight with agitation, the culture was plated on solid YPD medium. Once these plates were dry, strains from the MATα nonessential yeast deletion strain haploid set (a gift from Robin Wright, University of Minnesota) (Invitrogen) was manually pinned onto the query strain in a 96-well format and incubated at 30°C overnight. Zygotes were pinned to SD-Ura plus G418 solid medium and incubated at 30°C overnight. To enhance the level of sporulation, we pinned the diploids to presporulation solid medium and incubated the diploids at 30°C overnight. Strains were sporulated at room temperature (RT) for 6 days. MATa progeny were selected on SD-His/Arg/Ura plus canavanine (Can) (US Biological) solid medium and incubated at 30°C overnight. This step was repeated. Double mutants containing the ade2-min3 allele were isolated by pinning the strains to SD-His/Arg/Ura plus Can plus G418 solid medium. This selection step was repeated. After selection, the haploids were left at RT on YPD for 5 days to assay for the blebbing phenotype. Each strain was pinned in duplicate. The screen was repeated three independent times. A MATα zrt1Δ haploid mutant, which has a strong degree of blebbing, was used as a positive control for our screen (7). All mutants producing a strong degree of blebbing (+++ or ++++ on a scale of + to ++++) were backcrossed three times to DTK271 to confirm the blebbing phenotype.

(ii) Essential SGA.

For this screen, we followed a protocol similar to the nonessential SGA protocol described above. The query strain used for the essential SGA was DTK1189 2b. Strains to be examined that were part of a MATa essential temperature-sensitive (ts) strain set containing 455 ts genes (a gift from Charles Boone, University of Toronto) were manually pinned onto the query strain in a 96-well format and incubated at RT for 2 days. Zygotes were pinned to SD-Ura plus G418 solid medium and incubated at RT overnight. Diploids were pinned to presporulation solid medium and incubated at RT overnight. Strains were then sporulated at RT for 6 days. MATa progeny were selected on SD-His/Arg/Ura plus Can solid medium and incubated at RT for 2 days. This step was repeated. Double mutants containing the ade2-min3 allele as well as a temperature-sensitive allele were isolated by pinning the strains to SD-His/Arg/Ura plus Can plus G418 solid medium and incubating at RT for 2 days. This selection step was repeated. After selection, the haploids were pinned to 5 separate YPD solid medium plates. Each plate was left at 26°C, 30°C, 32°C, 34°C, or 37°C for 5 days. Each strain was pinned in duplicate, and the screen was repeated three independent times. Blebbing for each plate was scored as stated above. We define a hit as follows: (i) a strain that produced a steadily increasing level of blebbing, reaching +++ or ++++ only when the critical temperature of the ts allele was reached for all 3 screens or (ii) a strain that produced a level of blebbing of +++ to ++++ only when the critical temperature of the ts allele was reached for all 3 screens. A MATa zrt1Δ haploid mutant was used as a positive control for this screen.

Blebbing quantification assay.

Strains were streaked on solid YPD medium and incubated at 30°C for 48 h to allow colonies to form. Five milliliters of liquid YPD medium was inoculated with single red colonies of each strain and incubated at 30°C for 4 h with agitation. Appropriate dilutions of each culture were plated on solid YPD medium and incubated at 30°C for 2 days. We then left the plates at RT for 6 days and counted the number of blebs on the surface of each colony. Blebs were counted on at least 100 colonies for each strain; we repeated this procedure for 3 independent experiments. Only colonies ranging from 1.26 to 1.32 mm in diameter were included. The average number of blebs per colony and the 95% confidence interval of the mean were calculated for each strain. Strains bearing the pkc1-4 mutation were grown at 35°C for 6 days, and then the number of blebs was counted.

RESULTS

Components of several checkpoint pathways mediate minisatellite stability during stationary phase.

We used the ade2-min3 reporter (6, 7) to determine the effect on minisatellite stability of mutations in checkpoint genes (Fig. 2a). The ade2-min3 construct consists of three 20-bp minisatellite repeat units plus a 5-bp linker inserted into the beginning of the ADE2 coding sequence, disrupting the reading frame and resulting in a red colony color. If one repeat unit is lost (or two repeats gained), the correct reading frame is restored and a white colony color results. All alterations observed involved increases or decreases of complete 20-bp repeat units.

We previously described the ade2-min3 reporter assay and its ability to distinguish between minisatellite alterations occurring during log-phase growth and those occurring during stationary phase (68). Minisatellite alterations occurring during growth of the colony result in a white sector integrated into the red colony, while minisatellite alterations that occur specifically during stationary phase result in a novel colony morphology called “blebbing,” in which white Ade+ microcolonies form on the surface of the red Ade colony.

Approximately 100 genes have been annotated in the Saccharomyces Genome Database (www.yeastgenome.org) as having checkpoint-related functions (Table 3). To determine which of the checkpoint-related genes are important for maintaining minisatellite stability, we used a modified version of the synthetic genetic array (SGA) protocol (31, 32) to screen those genes in the yeast nonessential deletion haploid set and the essential temperature-sensitive haploid set (40). We mated a query strain containing the ade2-min3 allele to deletion set strains containing the KANMX4 allele in place of the wild-type (WT) open reading frame or to the essential strain set bearing temperature-sensitive alleles of genes. Isolated double mutant strains containing the ade2-min3 allele as well as the deletion or temperature-sensitive mutation were analyzed for a color segregation phenotype.

Table 3.

Blebbing phenotypes of checkpoint-annotated genesa

Gene ORF Blebbing score
AME1 YBR211C +
AMN1 YBR158W +
BFA1 YJR053W +
BIR1 YJR089W NAb
BMH1 YER177W ++
BMH2 YDR099W +
BRE1 YDL074C +
BUB1 YGR188C +
BUB2 YMR055C +
BUB3 YOR026W +++
CCR4 YAL021C +
CDC25 YLR310C +
CDC55 YGL190C NA
CEP3 YMR168C +++
CHK1 YBR274W +
CSM3 YMR048W +++
CTF18 YMR078C +
DCR2 YLR361C +
DDC1 YPL194W ++
DDI1 YER143W ++
DMA1 YHR115C +
DMA2 YNL116W ++
DOT1 YDR440W +
DPB11 YJL090C ++
DUN1 YDL101C ++
ELM1 YKL048C +
EOS1 YNL080C ++
ESC2 YDR363W ++
FIN1 YDR130C +
FPR3 YML074C +
GAC1 YOR178C +
GCN2 YDR283C +
GID8 YMR135C +
GIN4 YDR507C +
GLC7 YER133W +
HHT1 YBR010W ++
HHT2 YNL031C ++
HOP1 YIL072W ++
HSL1 YKL101W +
HUG1 YML058W-A NA
IBD2 YNL164C NA
IES4 YOR189W ++
IPL1 YPL209C +++
KCC4 YCL024W ++
KEM1 YGL173C +
KIN4 YOR233W ++
LCD1 YDR499W NA
LTE1 YAL024C +
MAD1 YGL086W ++
MAD2 YJL030W ++
MAD3 YJL013C ++
MEC1 YBR136W NA
MEC3 YLR288C ++
MEK1 YOR351C ++
MPS1 YDL028C ++
MRC1 YCL061C +++
NBL1 YHR199C NA
NUF2 YOL069W +
NUP53 YMR153W +
PCH2 YBR186W ++
PIN4 YBL051C +
PPH21 YDL134C +
PPH22 YDL188C ++
PTC2 YER089C +
PTC3 YBL056W +
RAD17 YOR368W ++
RAD24 YER173W ++
RAD53 YPL153C NA
RAD6 YGL058W +
RAD9 YDR217C +
RCK1 YGL158W +
RCK2 YLR248W +
RED1 YLR263W ++
RFC4 YJR068W +++
RFX1 YLR176C +
RNR1 YER070W No growth
RNR2 YJL026W NA
RNR3 YIL066C ++
RNR4 YGR180C ++
RTS1 YOR014W +
SDA1 YGR245C ++
SGO1 YOR073W +
SGS1 YMR190C +
SLI15 YBR156C +
SPC105 YGL093W +
SPC24 YMR117C +
SPC25 YER018C +
SPC72 YAL047C +
SUM1 YDR310C +
SWE1 YJL187C +
TEL1 YBL088C ++
TID3 YIL144W +
TOF1 YNL273W +++
TOP2 YNL088W NA
TSA1 YML028W +
ULP2 YIL031W NA
XRS2 YDR369C +
ZDS1 YMR273C +
ZDS2 YML109W +
a

Essential genes are in bold typeface. Blebbing scores ranged from + (little/none) to ++++ (highest level).

b

NA, these genes were not included in our nonessential deletion haploid set or our essential temperature-sensitive haploid set.

Our screening of the checkpoint genes identified those that are required for stationary-phase minisatellite stability (Table 3). Loss of the replication checkpoint gene MRC1, CSM3, or TOF1 gave a pronounced blebbing phenotype similar to that of our positive zrt1Δ control (7), indicating a role for these genes in maintaining minisatellite stability during stationary phase. Similarly, strains bearing temperature-sensitive alleles of the spindle checkpoint gene IPL1 (41, 42), the kinetochore gene CEP3 (43, 44), or the S-phase checkpoint gene RFC4 (45) produced a strong blebbing phenotype at their corresponding critical temperatures (Table 3). Additionally, strains containing deletions of ddc1, rad17, mec3, or TEL1 (components of the S-phase and DNA damage checkpoints) exhibited a blebbing phenotype but at a lower level than that for zrt1Δ.

To verify the results of our SGA analysis, we deleted several candidate nonessential genes with well-known cell cycle checkpoint roles (Fig. 1) in our standard strain background, which has been well-characterized in our previous work (68). We examined deletions of genes that exhibited stationary-phase minisatellite instability (MRC1, CSM3, TOF1, DDC1, RAD17, BUB3, MEC3, and TEL1) and genes that did not (RAD9 and CHK1).

We quantified the blebbing frequency of each of these strains (Fig. 2b and 3) as previously described, but with one modification: blebs were counted after colonies were incubated for 6 days at room temperature instead of 4 days (6, 7). This modification was made to accommodate the small size of the checkpoint strain blebs. Time course analysis monitoring the abundance of white cells in cultures of the parental strain, the mrc1Δ strain, or the zrt1Δ strain revealed that white cells accumulated at a later time point in stationary phase for the mrc1Δ strain than for the wild-type and zrt1Δ strains (data not shown). Our analysis suggests that minisatellite alterations in checkpoint mutants occur at a later time in stationary phase than for other strains.

Fig 3.

Fig 3

Several checkpoint components stabilize minisatellites during stationary phase. YPD cultures inoculated with a single red colony from each strain were grown for 4 h at 30°C. Each culture was diluted, plated on solid YPD medium, and then incubated at 30°C for 2 days. Strains were then left at RT for 6 days. Blebs were counted on 100 colonies, and the average number of blebs per colony ± the 95% confidence interval (CI) was calculated. This was repeated three times independently. The black horizontal line indicates the average number of blebs per colony of the WT strain.

Deletion of MRC1, CSM3, or TOF1 led to a strong blebbing phenotype (Fig. 2b). The mrc1Δ strain displayed an average of 23.9 blebs per colony (Fig. 3). This value is significantly higher than that of its parent, which had an average of 4.7 blebs/colony. The 95% confidence intervals were calculated for each strain; lack of overlap between the 95% confidence intervals indicated that the difference between the blebs quantified for each strain was statistically significant. Similarly, the csm3Δ strain and the tof1Δ strain displayed high levels of blebbing (26.2 and 24.4 blebs/colony, respectively). From these data, we conclude that components of the replication checkpoint play an important role in stabilizing minisatellites during stationary phase.

Loss of the DNA damage checkpoint gene DDC1, RAD17, MEC3, or TEL1 led to an average level of blebbing of 10.5, 12.5, 11.5, and 8.0 blebs/colony, respectively (Fig. 2b and 3). These values were significantly higher than that of the parental strain (4.7 blebs/colony). These results suggest that components of the S-phase and DNA damage checkpoints are also involved in minisatellite stability during stationary phase.

Of the mutants surveyed, the rad9Δ, chk1Δ, and bub3Δ strains did not exhibit a level of blebbing significantly greater than that of the parental strain, indicating no effect on minisatellite stability (Fig. 2b and 3). The deletion mutant strains had 3.2, 5.8, and 1.5 blebs/colony, respectively, compared to the 4.7 blebs/colony seen with the parental strain, indicating that RAD9, CHK1, and BUB3 do not influence the stability of minisatellites in stationary-phase cells.

For most of the genes examined in the two strain backgrounds (the lab strain and the SGA strain), deletion of each of the checkpoint genes in our strain background produced results similar to those obtained from the SGA analysis. For example, deletion of MRC1, CSM3, and TOF1 in both strain backgrounds produced strong blebbing phenotypes compared to results for other checkpoint mutants analyzed, in both the SGA analysis and blebbing quantification analysis (Table 3 and Fig. 3). Similarly, deletion of RAD9 and CHK1 did not produce significant levels of blebbing in either the SGA or blebbing quantification analysis. Interestingly, deletion of BUB3 produced a high level of blebbing in the SGA analysis, but blebbing was not significant in the lab strain background. This could be due to the presence of an enhancer or suppressor mutation that could affect a strain's blebbing phenotype.

To determine if the essential central checkpoint genes MEC1 and RAD53 were also involved in maintaining minisatellite stability, we constructed strains bearing a hypomorphic allele of MEC1 (mec1-21) or RAD53 (rad53-1) (35, 37). We then calculated the blebbing frequency for each strain. The mec1-21 strain had 14.2 blebs/colony, significantly greater than that of the WT strain. Similarly, the rad53-1 mutant had an average of 17.8 blebs/colony, significantly higher than the parental frequency of 4.7 blebs/colony (Fig. 3), demonstrating that loss of MEC1 or RAD53 results in a significant increase in minisatellite alterations during stationary phase. We were unable to accurately assess the average number of blebs per colony of a mec1-21 tel1Δ strain; in our strain background, this double mutant exhibited a severe defect in colony formation.

We observed a sectoring phenotype in both mec1-21 and rad53-1 strains (Fig. 2b), likely resulting from minisatellite alterations that occur during colony formation. This result is consistent with the previously described roles of Mec1p and Rad53p in regulating genome stability during cell cycle growth (46) and indicates that minisatellite alterations in the mec1-21 and rad53-1 strains occur in actively dividing cells as well as in cells that have entered stationary phase. No other blebbing strains produced a sectoring phenotype.

Minisatellite alterations occur during stationary phase in strains bearing mutations of checkpoint genes.

Previous work by the Werner-Washburne group demonstrated that yeast stationary-phase cultures consist of both true quiescent cells and nonquiescent cells that are still undergoing slow division (47, 48). Characterization of these subpopulations of stationary-phase cultures showed that each is differentially regulated by a specific set of genes (48). This genetic differentiation of stationary-phase cells allows us to distinguish which cell population gives rise to the blebbing phenotype. Loss of ETR1, which encodes a 2-enoyl thioester reductase, drastically reduces the ability of the quiescent cell population to reenter the cell cycle (48, 49). Similarly, loss of POR1, a gene that encodes mitochondrial porin, reduces the ability of nonquiescent cells to reenter the cell cycle (48, 50). If a cell cannot reenter the cell cycle, it cannot generate a blebbing colony.

To determine if minisatellite alterations in the checkpoint mutants occur in the quiescent or nonquiescent population of stationary-phase cells, we deleted ETR1 or POR1 in mrc1Δ, csm3Δ, tof1Δ, mec1-21, or rad53-1 strains and quantified the blebbing frequency of the resulting double mutants (Fig. 4). The mrc1Δ etr1Δ, csm3Δ etr1Δ, or tof1Δ etr1Δ mutant had 0.05, 0.01, or 0.01 bleb/colony, respectively. This is a significant decrease in blebbing from that of each of the single mutants. Similarly, deletion of ETR1 in a mec1-21 or rad53-1 background reduced the level of blebbing to 1.6 and 0.01 blebs/colony, respectively. In comparison, deletion of POR1 in a mrc1Δ, csm3Δ, or tof1Δ strain background did not result in a complete loss of blebbing. The mrc1Δ por1Δ, csm3Δ por1Δ, or tof1Δ por1Δ double mutant had a level of blebbing of 17.7, 18.1, or 13.9 blebs/colony, respectively. These results indicate that minisatellite alterations in a mrc1Δ, csm3Δ, or tof1Δ strain occur predominantly within the quiescent population rather than the nonquiescent population of stationary-phase cells. However, deletion of POR1 in a mec1-21 or rad53-1 background resulted in a decrease in blebbing from 14.2 blebs/colony (mec1-21) to 6.7 blebs/colony and from 17.8 blebs/colony (rad53-1) to 3.7 blebs/colony, respectively. We conclude that minisatellite alterations in a mec1-21 and rad53-1 background occur within both quiescent and nonquiescent cells populations, in keeping with phenotypes in actively growing cells.

Fig 4.

Fig 4

Minisatellite alterations occur in quiescent cells in checkpoint mutants. Loss of ETR1 will eliminate blebbing in quiescent G0 cells, while loss of POR1 affects nonquiescent G0 cells. The blebbing frequency was quantified as described in Materials and Methods and in the legend to Fig. 3.

Independent pathways regulate minisatellite stability during stationary phase.

To investigate how many independent pathways for stationary-phase minisatellite maintenance are represented by our blebbing mutants, we examined the blebbing phenotype of double mutant strains. The mrc1Δ csm3Δ, mrc1Δ tof1Δ and csm3Δ tof1Δ deletion strains produced equivalent blebbing frequencies (data not shown). We interpret this to mean that all three gene products function within the same pathway; therefore, for the remainder of the pathway analysis, we used only the mrc1Δ strain to construct double mutants.

We previously demonstrated that deletion of the high-affinity zinc transporter gene ZRT1 results in a dramatic increase in the amount of blebbing in an ade2-min3 strain (6, 7). To determine if MRC1, RAD17, MEC1, and RAD53 function within a ZRT1-dependent pathway, we constructed mrc1Δ zrt1Δ, rad17Δ zrt1Δ, mec1-21 zrt1Δ, and rad53-1 zrt1Δ double mutants. The mrc1Δ zrt1Δ mutant had an average of 31.1 blebs/colony, higher than the average number of blebs/colony for each single mutant (for mrc1Δ, 23.9, and for zrt1Δ, 24.5 blebs/colony) (Fig. 5a). However, blebs were difficult to quantify after 6 days at room temperature with this particular strain due to an enhanced blebbing phenotype of the double mutant. We therefore quantified the average number of blebs for each of these strains at an earlier time point. After 3 days at room temperature, the mrc1Δ zrt1Δ mutant produced an average of 28.5 blebs/colony, a value significantly greater than that for either of the single mutants (for mrc1Δ, 8.0, for zrt1Δ, 15.9 blebs/colony). This additive effect and the enhanced blebbing phenotype of the double mutant indicate that Mrc1p regulates minisatellite stability in a pathway that is at least partially independent of Zrt1p.

Fig 5.

Fig 5

Independent pathways regulate minisatellite stability during stationary phase. The blebbing frequency was scored as described in Materials and Methods and as shown in Fig. 3. Strains bearing the pkc1-4 mutation were grown at 35°C for 6 days before the number of blebs was counted. (a) ZRT1-dependent pathway analysis. (b) Placement of MRC1, MEC1, RAD53, and RAD17 in pathways. (c) The photos depict the blebbing phenotype of single mutants and double mutant strains. (d) RAD27 pathway analysis. (e) PKC1 pathway analysis. (f) END3 pathway analysis. The black horizontal line indicates the average number of blebs per colony of the zrt1Δ (a), rad27Δ (d), pkc1-4 (e), or end3Δ (f) strain.

To determine if the enhanced blebbing phenotype of the mrc1Δ zrt1Δ double mutant was due to an increase in the number of minisatellite alteration events or an increase in the growth rate of the white cells comprising the blebs, we performed a time course analysis of white cells isolated from blebs of the wild-type parent or the mrc1Δ, zrt1Δ, or mrc1Δ zrt1Δ mutant (data not shown). We found that blebs from the mrc1Δ zrt1Δ double mutant did not grow at a significantly higher rate than those from the wild-type strain or either single mutant. This result, as well as the results of the blebbing quantification experiment, suggests that the enhanced blebbing phenotype found in the double mutant is due to an increase in the number of minisatellite alteration events at an earlier time rather than an increase in the growth rate of the cells forming the blebs.

The rad17Δ zrt1Δ double mutant produced an average of 16.0 blebs/colony, a value not significantly greater than that for the rad17Δ (12.5 blebs/colony) or zrt1Δ (24.5 blebs/colony) single mutant, placing RAD17 in a ZRT1-dependent pathway. The mec1-21 zrt1Δ strain had an average of 24.3 blebs/colony, while the rad53-1 zrt1Δ mutant averaged 23.5 blebs/colony. Both values were not significantly greater than those for the corresponding single mutants and, unlike the MRC1 result, place MEC1 and RAD53 in the same pathway as ZRT1 (Fig. 5a). Our results suggest that Mrc1p functions in a pathway separate from Rad53p and Mec1p during stationary phase. This is in contrast to their S-phase checkpoint roles, in which each gene product functions within the same checkpoint signaling pathway (Fig. 1) (14, 15).

To examine this relationship further, we constructed mrc1Δ mec1-21, mrc1Δ rad53-1, and mec1-21 rad53-1 double mutants (Fig. 5b and c). Analysis of the mrc1Δ mec1-21 mutant revealed that while the level of blebbing of the double mutant (29.1 blebs/colony) was not significantly additive compared to that for the mrc1Δ (23.9 blebs/colony) or mec1-21 (14.2 blebs/colony) strain, the blebbing phenotype of the mrc1Δ mec1-21 mutant itself was drastically different from that of the parental strains. Double mutant colonies had a range of bleb sizes, unlike all other strains in which the bleb size on the colony is homogeneous. This difference suggests that MRC1 and MEC1 do indeed comprise different pathways and that the minisatellite alterations in the double mutant occur at a variety of time points during stationary phase.

In keeping with this trend, the mrc1Δ rad53-1 mutant (38.3 blebs/colony) produced a significantly additive level of blebbing compared to that for either single mutant, demonstrating that Mrc1p and Rad53p are functioning in separate pathways during stationary phase (Fig. 5b and c). Interestingly, while the mec1-21 rad53-1 mutant (21.9 blebs/colony) did not have a level of blebbing that was significantly additive compared to that of either single mutant, at 14.2 (mec1-21) or 17.8 (rad53-1) blebs per colony, the resulting blebbing phenotype of the double mutant was drastically different. Like the mrc1Δ zrt1Δ and mrc1Δ mec1-21 strains, the double mutant produced blebs that were significantly larger than those produced by the parental strains, suggesting that the minisatellite alterations in a mec1-21 rad53-1 strain occur at an earlier time point than those in the mec1-21 or rad53-1 strain. Together, our data suggest that MEC1 and RAD53 comprise different pathways in stationary-phase cells. This is in sharp contrast to their roles in actively dividing cells, in which Mec1p and Rad53p function together in well-characterized checkpoint signaling pathways (46).

The division of MEC1 and RAD53 into different pathways is further supported by the analysis of RAD17 double mutants (Fig. 5b). The mec1-21 rad17Δ mutant had 34.1 blebs/colony, a value significantly greater than that of either single mutant, at 14.2 (mec1-21) or 12.5 (rad17Δ) blebs/colony. In contrast, the rad53-1 rad17Δ strain (7.0 blebs/colony) produced a level of blebbing significantly lower than that of either single mutant, at 17.8 (rad53-1) and 12.5 (rad17Δ) blebs/colony, which supports our previous data that MEC1 and RAD53 fall into separate pathways during stationary phase. The combination of the mrc1Δ and rad17Δ mutations was synthetically lethal in our strain background; therefore, we are unable to assess the pathway relationship of MRC1 and RAD17.

Our lab found that RAD27, PKC1, and END3 represent several other distinct pathways that mediate minisatellite instability in stationary-phase cells (8). RAD27 encodes a nuclease involved in processing Okazaki fragments (51). PKC1 codes for an essential serene/threonine protein kinase C homolog, while END3 encodes a protein involved in endocytosis and actin organization (52, 53). The mrc1Δ rad27Δ strain and the mec1-21 rad27Δ strain produced averages of 59.5 and 46.9 blebs/colony, respectively, values significantly higher than those of the mrc1Δ (23.9 blebs/colony), rad27Δ (38.8 blebs/colony), and mec1-21 (14.2 blebs/colony) single mutants (Fig. 5d). The rad53-1 rad27Δ double mutant averaged 27.3 blebs/colony, which was not significantly additive compared to findings for the parental single mutants. In contrast, the rad17Δ rad27Δ strain had an average of 30.9 blebs/colony, a value that falls between those of the single mutants, at 12.5 (rad17Δ) and 38.8 (rad27Δ) blebs/colony. From these data, we conclude that Rad17p and Rad53p but not Mrc1p or Mec1p function in a Rad27p-dependent pathway.

Double mutants with PKC1 (mrc1Δ pkc1-4, 25.7 blebs/colony; rad17Δ pkc1-4, 15.1 blebs/colony) produced levels of blebbing that were not significantly elevated over those of the mrc1Δ (23.9 blebs/colony), rad17Δ (12.5 blebs/colony), and pkc1-4 (14.8 blebs/colony) single mutants (Fig. 5e). Similarly, the mec1-21 pkc1-4 (13.1 blebs/colony) and rad53-1 pkc1-4 (14.6 blebs/colony) strains had levels of blebbing that did not significantly differ from those of the parental strains (mec1-21, 14.2 blebs/colony; rad53-1, 17.8 blebs/colony). Mrc1p, Rad17p, Mec1p, and Rad53p all appear to function within a Pkc1p-dependent pathway. Also, the blebbing frequencies in the end3Δ (8.0 blebs/colony) double mutants with mrc1Δ end3Δ (15.9 blebs/colony), rad17Δ end3Δ (7.7 blebs/colony), mec1-21 end3Δ (12.0 blebs/colony), and rad53-1 end3Δ (9.8 blebs/colony) genotypes were not enhanced in comparison to those of the corresponding single mutants (Fig. 5f).

Together, our data suggest that checkpoint proteins participate in at least three independent pathways to maintain the stability of minisatellites during stationary phase. One pathway involves Rad53p, Zrt1p, Rad17p, and Rad27p, while a second has Mrc1p, Csm3p, and Tof1p. Both pathways contain Pkc1p and End3p. The final pathway utilizes Mec1p, Zrt1p, Pkc1p, and End3p but does not contain Rad17p or Rad27p.

Characterization of the role of Mrc1p in maintaining minisatellite stability in stationary-phase cells.

In actively dividing cells, Mrc1p has been shown to promote Mec1p- and Rad53p-dependent checkpoint signaling and maintain proper replicative function (11, 1315). The Elledge group has developed MRC1 mutants that allow one to study the effects of the checkpoint or replicative functions of Mrc1p separately. These include the mrc1AQ mutant, a strain bearing mutations at the Mec1p phosphorylation sites, and the mrc1-C14 strain, a C-terminal truncation mutant that displays a prolonged S phase (13, 15).

To determine if the minisatellite alterations in the mrc1Δ strain are due to loss of the checkpoint function of Mrc1p or the replicative function of Mrc1p, we quantified the average number of blebs/colony in strains bearing the ade2-min3 allele and the mrc1AQ or mrc1-C14 separation-of-function alleles (Fig. 6a). The mrc1AQ phosphorylation site mutant produced 7.1 blebs/colony, a value that, while still significantly greater than that of the wild-type strain (4.7 blebs/colony), is not a drastic increase such as that seen in the mrc1Δ deletion mutant (23.9 blebs/colony). The mrc1-C14 terminal truncation mutant averaged 18.5 blebs/colony, a value significantly greater than that of the wild-type strain. From these data we conclude that the minisatellite stability in stationary-phase cells is mediated predominately by the replicative function of Mrc1p, rather than the checkpoint signaling function of Mrc1p that utilizes Mec1p and Rad53p. This finding complements our pathway analysis data that showed that MRC1, MEC1 and RAD53 lie in distinct genetic pathways in stationary-phase cells (Fig. 5b and c).

Fig 6.

Fig 6

Characterization of the role of Mrc1p in stationary-phase cells. Bleb quantification experiments were performed for each strain as described in Materials and Methods and the legend to Fig. 3. (a) Analysis of Mrc1p separation-of-function mutant strains bearing ade2-min3. (b) Stationary-phase specificity of Mrc1p separation-of-function mutants.

Surprisingly, a strain bearing both the AQ and C14 mutations did not exhibit a level of blebbing equivalent to that of the mrc1Δ strain (17.7 versus 23.9 blebs/colony, respectively) (Fig. 6a). This result could be due to the continued presence of the bulk of the Mrc1p protein or to a possible backup checkpoint pathway, either or both of which could contribute to continued minisatellite stability in the absence of the well-characterized functions of Mrc1p.

Mrc1p and Rad9p were previously shown to represent functionally redundant checkpoint pathways (11). Further analysis from the Elledge lab suggests that Rad9p may act as a backup pathway in actively dividing cells when Mrc1p function is compromised (11, 15). To address the question of whether or not Rad9p acts as a backup checkpoint pathway in stationary phase, we compared the level of blebbing of an mrc1AQ rad9Δ double mutant to those of the parental single mutants (Fig. 6a). The combined mutations produced a synergistic blebbing effect (13.9 blebs/colony) compared to results for the mrc1AQ (7.1 blebs/colony) and rad9Δ (3.2 blebs/colony) single mutants. Thus, when the checkpoint signaling function of Mrc1p is absent, a Rad9p-dependent checkpoint signaling pathway prevents further minisatellite instability. The mrc1Δ rad9Δ and mrc1-C14 rad9Δ mutation combinations exhibit synthetic lethality in our background, in agreement with prior observations that Rad9p is required for cell viability in mrc1Δ mutants that accrue DNA damage due to replication stress (11, 15).

Our quiescent and nonquiescent population analysis of the mrc1Δ strain revealed that the majority of stationary-phase minisatellite alterations were specific to quiescent cells. However, we also found that ∼25% of alterations appeared to occur in nonquiescent cells (Fig. 4). To determine if the different functions of Mrc1p accounted for these results, we deleted POR1 and ETR1 in the mrc1AQ, mrc1-C14, and mrc1AQ-C14 mutant backgrounds (Fig. 6b). Deletion of POR1 in both the mrc1AQ and mrc1-C14 backgrounds did not result in a decrease in blebbing (8.2 and 17.1 blebs/colony, respectively). However, a significant decrease in blebbing was observed in the mrc1AQ-C14 por1Δ strain (14.0 blebs/colony). In comparison, deletion of ETR1 in each of the mutant backgrounds resulted in a dramatic decrease in the level of blebbing compared to that for each of the single mutants (for mrc1AQ etr1Δ, 0.4 bleb/colony; for mrc1-C14 etr1Δ, 0.4 bleb/colony; for mrc1AQ-C14 etr1Δ, 0.6 bleb/colony). We conclude that minisatellite alterations associated with the loss of the well-characterized checkpoint signaling and replication functions of Mrc1p occur primarily within the quiescent population of stationary-phase cells.

Dissecting the mechanism of minisatellite alterations in stationary-phase yeast cells.

To investigate the mechanism giving rise to minisatellite alterations and the blebbing phenotype in our yeast strains, we quantified the average number of blebs per colony in strains bearing the ade2-min3 minisatellite tract and rfa1-t11, a mutant allele of the RFA1 subunit of replication protein A (RPA) (39). RPA is an ssDNA binding protein that is highly conserved in eukaryotes, where it functions to promote effective DNA replication, recombination, and repair (reviewed in reference 54). Yeast strains carrying the rfa1-t11 mutation are defective in recombination during DNA repair and during meiosis but have no measurable defects in DNA replication (39, 55, 56). Thus, examination of the rfa1-t11 allele allows us to separate the effects of repair-associated recombination and DNA replication on minisatellite stability in stationary-phase cells.

A strain bearing the rfa1-t11 and ade2-min3 alleles produced a level of blebbing (5.2 blebs/colony) that was not significantly different from that of the wild-type strain (4.7 blebs/colony). Thus, the rfa1-t11 mutation by itself does not appear to affect minisatellite stability. We next investigated the level of blebbing in strains bearing rfa1-t11 and deletion of either MRC1 or ZRT1. The mrc1Δ rfa1-t11 strain produced a level of blebbing of 10.2 blebs/colony, a value approximately 50% of that produced by the mrc1Δ mutant alone (23.9 blebs/colony). A similar result occurred in the zrt1Δ rfa1-t11 mutant, which had an average of 11.3 blebs/colony, compared to 24.5 blebs/colony produced by the zrt1Δ mutant. This reduction is equivalent to that seen previously with various recombination gene deletion combinations, such as rad50Δ zrt1Δ (6, 7). We conclude that while rfa1-t11 does not have an effect on the low level of spontaneous minisatellite instability displayed in the wild-type strain, minisatellite alterations occurring within mrc1Δ or zrt1Δ mutant strains are at least partially dependent upon the recombination function associated with RFA1.

DISCUSSION

In this study, we used a modified version of the SGA analysis (31, 32) to screen for checkpoint components that play an active role in stabilizing minisatellites in stationary-phase yeast cells. We find that a specific subset of checkpoint genes, including MRC1, CSM3, TOF1, DDC1, RAD17, MEC3, TEL1, MEC1, and RAD53, act to prevent minisatellite alterations in stationary-phase cells. We show that minisatellite alterations within these checkpoint mutant strains occur predominantly in the quiescent cell population of stationary-phase colonies. Finally, we demonstrate that MRC1, MEC1, and RAD53 function in separate pathways in stationary-phase cells, a significant difference from the checkpoint pathways characterized in actively dividing cells. Our data suggest that novel checkpoint pathways are in place in stationary-phase cells to prevent genomic instability and that components of these pathways are interacting differently in stationary-phase cells than in actively dividing cells.

The role of checkpoint proteins in actively growing cells is to sense a cellular state and transmit a signal under the appropriate conditions. While quiescent G0 cells are not actively going through a cell cycle, the stationary-phase checkpoint proteins identified in our work likely are still sensing a cellular state and transmitting a signal when problematic conditions are present (possibly ssDNA, as discussed below). This signal may activate DNA repair activities, for example. In addition, it is possible that the checkpoint proteins in stationary-phase cells are establishing a block to progression, as they would in actively growing cells, to prevent the cell from exiting G0 before the problem has been resolved.

Our SGA screen of nonessential checkpoint genes for genes whose deletion destabilized a minisatellite tract inserted into ADE2 revealed that specific components of checkpoint signaling pathways are active in stationary-phase cells. We identified several that are known to function together in well-characterized signaling pathways in actively growing cells. These include MRC1, CSM3, and TOF1, whose gene products form a complex that associates with the replication fork and mediates replication checkpoint signaling (11, 15, 57, 58). Also included are the kinase encoded by TEL1 (18, 19) and PCNA-like clamp complex proteins encoded by DDC1, RAD17, and MEC3, which mediate DNA damage checkpoint signaling (21, 23) and are considered to be upstream of Rad9p and Chk1p (Fig. 1). However, CHK1 and RAD9, which are central components of the intra-S and DNA damage checkpoint pathways (Fig. 1), were not identified as hits in our screen. This surprising result was confirmed by analysis in a separate strain background. DDC1, RAD17, MEC3, and TEL1, while not strong hits from our SGA screen, were verified to have a significantly elevated level of blebbing when also deleted in this background. Thus, while we have demonstrated that some checkpoint proteins mediate DNA stability in stationary-phase cells, our data argue that specific checkpoint pathways, or the interactions between those checkpoint components, are significantly different in stationary-phase cells from those actively growing cells.

A subsequent analysis of essential checkpoint gene mutants reinforced this finding. In actively growing cells, the essential Mec1 protein is upstream of the essential Rad53 protein in the replication checkpoint pathway and in the intra-S and DNA damage pathways (Fig. 1) (9, 46). However, our results suggest that MEC1 and RAD53 do not fall within the same genetic pathway (or at least provide unique contributions to minisatellite stability), implying that Mec1p is not actively signaling a Rad53p checkpoint pathway in stationary-phase cells with respect to minisatellite stability (Fig. 5b and c). This observation is unlike the previously characterized roles of Mec1p in dividing cells and even in oxidative repair-deficient stationary-phase cells, in which Mec1p is required to activate Rad53p by phosphorylation (Fig. 1) (30, 46). Some studies have shown that Rad53p does have a Mec1p-independent role in maintaining genomic stability, in which Rad53p monitors histone levels in order to prevent delays in DNA repair synthesis (59, 60). Our work suggests that Rad53p maintains minisatellite stability in stationary-phase cells independently of Mec1p. Therefore, Rad53p could be part of an otherwise unidentified checkpoint signaling pathway in stationary-phase cells or it could be monitoring histone levels, either of which then influences minisatellite instability.

Pathway analysis of strains bearing mutations in MRC1, CSM3, or TOF1 provides evidence that all three genes act within the same genetic pathway. This result was not unexpected, since the protein products of each gene form a heterotrimeric complex that travels with replication forks (57, 58). Based upon the results from our screen and pathway analysis data, we predict that Mrc1p, Csm3p, and Tof1p form a complex that associates with replication sites in stationary-phase cells. While bulk DNA synthesis does not occur in stationary-phase cells, recent work has demonstrated that discrete areas of DNA replication do occur within the genome of stationary-phase yeast cells (61), presumably at regions of localized DNA repair. Therefore, the Mrc1p/Csm3p/Tof1p complex may associate with replication sites at areas of DNA repair and prevent genomic instability through mediating checkpoint signaling in stationary-phase cells.

To address whether or not minisatellites are stabilized by the Mrc1p checkpoint or replication function during stationary phase, we assessed the level of blebbing in strains bearing either the mrc1AQ allele or the mrc1-C14 allele (Fig. 6a) (13, 15). Our data show that the level of blebbing in a strain bearing the Mrc1p checkpoint loss-of-function allele mrc1AQ is not drastically greater than that of the WT strain. This indicates that even in the absence of proper checkpoint signaling, the minisatellite is still predominantly stable. In contrast, the level of blebbing in a strain bearing the Mrc1p loss-of-replicative-function allele, mrc1-C14, is significantly greater than that in the WT strain. Together, we find that Mrc1p stabilizes minisatellites in stationary-phase cells largely through its replicative function rather than through mediating checkpoint signaling.

In support of this hypothesis, our pathway analysis of MRC1, MEC1, and RAD53 shows that MRC1 does not fall within the same genetic pathway as MEC1 or RAD53 in stationary-phase cells (Fig. 5b and c). Similarly, our data demonstrating that MEC1 and RAD53 do not lie in the same pathway support the possibility that the characterized replication checkpoint, in which Mec1p is recruited to the replication fork and activates Rad53p via Mrc1p (Fig. 1) (11, 1315), is not participating in stabilizing minisatellites in stationary-phase cells. Therefore, we suggest Mrc1p prevents minisatellite rearrangements in stationary-phase cells by maintaining correct replicative function rather than by promoting checkpoint signaling via a Rad53p signaling pathway (Fig. 6a); we cannot rule out the possibility that Mrc1p is mediating checkpoint signaling through an as yet unidentified pathway, however.

Interestingly, a strain bearing both the mrc1AQ and mrc1-C14 deletions did not result in a level of blebbing equivalent to that of the mrc1Δ deletion strain (Fig. 6a). This could be due to one of the following possibilities: (i) the bulk of the Mrc1 protein is still intact and stabilizes the minisatellite through being present physically; (ii) a secondary backup pathway is activated when Mrc1p function is aberrant, thereby preventing the minisatellite from undergoing further alterations; or (iii) residual checkpoint or replication function remains in either the mrc1AQ or mrc1-C14 mutant. The second possibility could account for the suppression of minisatellite instability displayed by our strain bearing the mrc1AQ allele.

It was previously demonstrated that Mrc1p and the DNA damage checkpoint protein Rad9p are functionally redundant, suggesting that the Rad9p pathway is activated in strains bearing mutant Mrc1p (11, 15). To determine if a Rad9p pathway is initiated in stationary-phase cells bearing checkpoint-defective Mrc1p, we assessed the level of blebbing produced by the mrc1AQ rad9Δ mutant strain. Despite the finding that RAD9 deletion by itself does not appear to affect minisatellite stability, deletion of RAD9 in an mrc1AQ background results in a synergistic increase in the level of blebbing, demonstrating that a secondary Rad9p-dependent signaling pathway is activated in stationary-phase cells to prevent minisatellite instability when Mrc1p checkpoint signaling is compromised.

To determine how many independent pathways regulate minisatellite instability in stationary-phase cells, we constructed strains bearing mutations in MRC1, MEC1, RAD53, or RAD17 and several genes we previously identified as stabilizing the ade2-min3 construct (68). Our results reveal that there are three distinct pathways that stabilize minisatellites in yeast cells in stationary phase (Fig. 1b). The first two of these pathways are the MRC1/CSM3/TOF1 pathway and the RAD53/ZRT1/RAD17/RAD27 pathway. Interestingly, PKC1 and END3 appear to act in both pathways. The final pathway consists of MEC1, ZRT1, PKC1, and END3 but does not contain RAD17 or RAD27. These data provide further evidence that MRC1, MEC1, and RAD53 act in separate pathways in stationary-phase cells and suggest that Mec1p is not activated through the presence of an intact clamp as in the established checkpoint pathway. Thus, like Rad53p, Mec1p may not be functioning in a checkpoint-dependent signaling pathway or may be participating in an as yet unidentified pathway in stationary-phase yeast cells.

A common element of all of the mutants with a strong blebbing phenotype is an involvement in ssDNA metabolism; accumulation of ssDNA could act as a template for minisatellite instability in stationary-phase cells. MRC1, CSM3, and TOF1 promote genomic stability by preventing aberrant replication and mediating checkpoint signaling in the presence of ssDNA (1315, 57). RAD27, ZRT1, END3, RAD53, and PKC1 are also important in preventing the accumulation of ssDNA. Deletion of RAD27 results in unprocessed Okazaki fragments and an increase in ssDNA (62, 63). Strains bearing a deletion of END3 have been shown to produce an increase in reactive oxygen species (ROS) (64). Similarly, mutations in RAD53 or PKC1 result in cells that are susceptible to oxidative stress that can then accumulate ROS (6567). Previous studies have shown that an increase in ROS in yeast cells results in the accumulation of ssDNA and repetitive DNA instability (64, 68). Our lab recently demonstrated that increased ade2-min3 blebbing in an END3 mutant is correlated with an increase in ROS, and a suppressor mutation that reduces the level of blebbing also reduces the level of ROS in the cells (8). Two models are possible from our results—either the MRC1/CSM3/TOF1, MEC1/ZRT1, and the RAD53/ZRT1/RAD27/RAD17 pathways are independent but acted upon by PKC1 and END3 (as shown in Fig. 1b) or they are branches of a uniform pathway containing PKC1 and END3. In either case, our data are consistent with the idea that the primary lesion leading to minisatellite instability in stationary-phase cells is ssDNA formation and that G0 cells possess multiple methods for dealing with ssDNA.

To address whether or not an accumulation of ssDNA could be an intermediate of minisatellite instability in stationary-phase cells, we quantified the level of blebbing in strains bearing a recombination-defective allele of the ssDNA-binding RPA complex subunit RFA1 (rfa-t11) (39). We found that the rfa1-t11 mutation by itself does not appear to affect minisatellite instability. However, strains bearing the rfa1-t11 allele along with deletions in either MRC1 or ZRT1 displayed a 50% reduction in the level of minisatellite alterations compared to findings for either single mutant. Thus, loss of the recombination-associated function of RFA1 results in a partial suppression of the minisatellite alterations in mrc1Δ or zrt1Δ mutant strains. Based upon our results, we suggest that Rfa1p-initiated recombination mediates a portion of the minisatellite alterations exhibited in strains bearing a deletion of MRC1 or ZRT1. The rfa1-t11 results support our proposal that stationary-phase minisatellite alteration events could result from a failure to repair accumulated ssDNA nicks or gaps.

A few other checkpoint genes exhibited a moderate phenotype in our screens but have not been analyzed further yet, including IPL1, CEP3, and RFC4. IPL1 encodes the central component of the aurora kinase complex that is involved in the spindle checkpoint, along with SLI15, BIR1, and NBL1 (reviewed in reference 69). While the essential genes BIR1 and NBL1 were not present in our set, the SLI15 deletion did not exhibit a blebbing phenotype (Table 3). The role that IPL1 is playing in stationary-phase cells is not apparent, although CEP3 (an essential kinetochore component [43, 44]) may be functioning in a manner similar to that of IPL1. Intriguingly, MEC1 has been implicated in activation of the spindle checkpoint, and this may occur in a RAD53-independent manner (e.g., see references 70 and 71); double mutant analysis with MEC1 and the spindle checkpoint components we have identified may provide insight into this aspect of stationary-phase minisatellite stability. Since RFC4 encodes a component of replication factor C (45), it may be involved in a replication step of DNA repair events or it may interact with the MRC1/CSM3/TOF1 pathway. Given the outcome of our analysis of BUB3, it is possible that any or all of these are false positives.

Finally, we were interested in the state of the stationary-phase cells that were undergoing minisatellite alterations. Stationary-phase cultures of yeast cells consist of a nondividing quiescent cell population and a slow-dividing nonquiescent population of cells (47, 48). To determine if minisatellite alterations occurred within the true quiescent cell population of stationary-phase cells, we constructed double mutants bearing a deletion of ETR1 or POR1 in a checkpoint mutant background, since deletion of ETR1 reduces the reproductive capacity of quiescent cells while deletion of POR1 has the same effect in nonquiescent cells (48). We found that loss of ETR1 in all checkpoint strain backgrounds eliminated blebbing in each of these strains, indicating that the majority of the stationary-phase alterations are occurring in the quiescent cell population. In comparison, deletion of POR1 in the majority of strain backgrounds resulted in only a partial decrease in blebbing. The small effect of POR1 deletion on blebbing in the checkpoint mutants may be explained by the role that checkpoint proteins play in dividing cells, even slowly dividing nonquiescent cells that are ostensibly in G0. Intriguingly, the effect of POR1 deletion was stronger in the mec1-21 and rad53-1 checkpoint mutants, in which the level of blebbing was similar to that of the wild-type strain. This result suggests that minisatellite alterations occurring within a mec1-21 or rad53-1 strain arise in both nondividing quiescent cells and dividing cells, consistent with the color segregation phenotype of each strain in which blebbing and sectoring are present together (Fig. 2b).

In conclusion, our work demonstrates that several checkpoint signaling components may be active during stationary phase and function to prevent the instability of minisatellites. However, the pathways and interactions found in stationary-phase cells differ significantly from those found in actively dividing cells. We suggest that the stationary-phase checkpoint pathways act to prevent the accumulation of ssDNA that leads to genomic instability in stationary-phase cells.

ACKNOWLEDGMENTS

We thank P. Jauert for technical assistance. We also thank D. Clarke, S. Elledge, D. Koepp, R. Kolodner, and L. Symington for yeast strains or plasmids. We are grateful to C. Boone and R. Wright for yeast haploid sets.

This work was funded by a grant from the National Institutes of Health (5RO1-GM072598) to David T. Kirkpatrick.

Footnotes

Published ahead of print 12 November 2012

REFERENCES

  • 1. Jin K, Ewton DZ, Park S, Hu J, Friedman E. 2009. Mirk regulates the exit of colon cancer cells from quiescence. J. Biol. Chem. 284:22916–22925 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Kim CF, Jackson EL, Woolfenden AE, Lawrence S, Babar I, Vogel S, Crowley D, Bronson RT, Jacks T. 2005. Identification of bronchioalveolar stem cells in normal lung and lung cancer. Cell 121:823–835 [DOI] [PubMed] [Google Scholar]
  • 3. Suda T, Arai F, Hirao A. 2005. Hematopoietic stem cells and their niche. Trends Immunol. 26:426–433 [DOI] [PubMed] [Google Scholar]
  • 4. Gray JV, Petsko GA, Johnston GC, Ringe D, Singer RA, Werner-Washburne M. 2004. “Sleeping beauty”: quiescence in Saccharomyces cerevisiae. Microbiol. Mol. Biol. Rev. 68:187–206 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Werner-Washburne M, Braun E, Johnston GC, Singer RA. 1993. Stationary phase in the yeast Saccharomyces cerevisiae. Microbiol. Rev. 57:383–401 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Kelly MK, Alver B, Kirkpatrick DT. 2011. Minisatellite alterations in ZRT1 mutants occur via RAD52-dependent and RAD52-independent mechanisms in quiescent stationary phase yeast cells. DNA Repair 10:556–566 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Kelly MK, Jauert PA, Jensen LE, Chan CL, Truong CS, Kirkpatrick DT. 2007. Zinc regulates the stability of repetitive minisatellite DNA tracts during stationary phase. Genetics 177:2469–2479 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Kelly MK, Brosnan L, Jauert PA, Dunham MJ, Kirkpatrick DT. 2012. Multiple pathways regulate minisatellite stability during stationary phase in yeast. G3 2:1185–1195 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Branzei D, Foiani M. 2009. The checkpoint response to replication stress. DNA Repair 8:1038–1046 [DOI] [PubMed] [Google Scholar]
  • 10. Putnam CD, Jaehnig EJ, Kolodner RD. 2009. Perspectives on the DNA damage and replication checkpoint responses in Saccharomyces cerevisiae. DNA Repair 8:974–982 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Alcasabas AA, Osborn AJ, Bachant J, Hu F, Werler PJ, Bousset K, Furuya K, Diffley JF, Carr AM, Elledge SJ. 2001. Mrc1 transduces signals of DNA replication stress to activate Rad53. Nat. Cell Biol. 3:958–965 [DOI] [PubMed] [Google Scholar]
  • 12. Emili A. 1998. MEC1-dependent phosphorylation of Rad9p in response to DNA damage. Mol. Cell 2:183–189 [DOI] [PubMed] [Google Scholar]
  • 13. Naylor ML, Li JM, Osborn AJ, Elledge SJ. 2009. Mrc1 phosphorylation in response to DNA replication stress is required for Mec1 accumulation at the stalled fork. Proc. Natl. Acad. Sci. U. S. A. 106:12765–12770 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Chen SH, Zhou H. 2009. Reconstitution of Rad53 activation by Mec1 through adaptor protein Mrc1. J. Biol. Chem. 284:18593–18604 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Osborn AJ, Elledge SJ. 2003. Mrc1 is a replication fork component whose phosphorylation in response to DNA replication stress activates Rad53. Genes Dev. 17:1755–1767 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Vialard JE, Gilbert CS, Green CM, Lowndes NF. 1998. The budding yeast Rad9 checkpoint protein is subjected to Mec1/Tel1-dependent hyperphosphorylation and interacts with Rad53 after DNA damage. EMBO J. 17:5679–5688 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Longhese MP, Clerici M, Lucchini G. 2003. The S-phase checkpoint and its regulation in Saccharomyces cerevisiae. Mutat. Res. 532:41–58 [DOI] [PubMed] [Google Scholar]
  • 18. Greenwell PW, Kronmal SL, Porter SE, Gassenhuber J, Obermaier B, Petes TD. 1995. TEL1, a gene involved in controlling telomere length in S. cerevisiae, is homologous to the human ataxia telangiectasia gene. Cell 82:823–829 [DOI] [PubMed] [Google Scholar]
  • 19. Morrow DM, Tagle DA, Shiloh Y, Collins FS, Hieter P. 1995. TEL1, an S. cerevisiae homolog of the human gene mutated in ataxia telangiectasia, is functionally related to the yeast checkpoint gene MEC1. Cell 82:831–840 [DOI] [PubMed] [Google Scholar]
  • 20. Weinert TA, Kiser GL, Hartwell LH. 1994. Mitotic checkpoint genes in budding yeast and the dependence of mitosis on DNA replication and repair. Genes Dev. 8:652–665 [DOI] [PubMed] [Google Scholar]
  • 21. Kondo T, Matsumoto K, Sugimoto K. 1999. Role of a complex containing Rad17, Mec3, and Ddc1 in the yeast DNA damage checkpoint pathway. Mol. Cell. Biol. 19:1136–1143 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Paciotti V, Lucchini G, Plevani P, Longhese MP. 1998. Mec1p is essential for phosphorylation of the yeast DNA damage checkpoint protein Ddc1p, which physically interacts with Mec3p. EMBO J. 17:4199–4209 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Majka J, Burgers PM. 2003. Yeast Rad17/Mec3/Ddc1: a sliding clamp for the DNA damage checkpoint. Proc. Natl. Acad. Sci. U. S. A. 100:2249–2254 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Navadgi-Patil VM, Burgers PM. 2009. A tale of two tails: activation of DNA damage checkpoint kinase Mec1/ATR by the 9-1-1 clamp and by Dpb11/TopBP1. DNA Repair 8:996–1003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Sanchez Y, Bachant J, Wang H, Hu F, Liu D, Tetzlaff M, Elledge SJ. 1999. Control of the DNA damage checkpoint by chk1 and rad53 protein kinases through distinct mechanisms. Science 286:1166–1171 [DOI] [PubMed] [Google Scholar]
  • 26. Lew DJ, Burke DJ. 2003. The spindle assembly and spindle position checkpoints. Annu. Rev. Genet. 37:251–282 [DOI] [PubMed] [Google Scholar]
  • 27. Hoyt MA, Totis L, Roberts BT. 1991. S. cerevisiae genes required for cell cycle arrest in response to loss of microtubule function. Cell 66:507–517 [DOI] [PubMed] [Google Scholar]
  • 28. Li R, Murray AW. 1991. Feedback control of mitosis in budding yeast. Cell 66:519–531 [DOI] [PubMed] [Google Scholar]
  • 29. Hwang LH, Lau LF, Smith DL, Mistrot CA, Hardwick KG, Hwang ES, Amon A, Murray AW. 1998. Budding yeast Cdc20: a target of the spindle checkpoint. Science 279:1041–1044 [DOI] [PubMed] [Google Scholar]
  • 30. Pawar V, Jingjing L, Patel N, Kaur N, Doetsch PW, Shadel GS, Zhang H, Siede W. 2009. Checkpoint kinase phosphorylation in response to endogenous oxidative DNA damage in repair-deficient stationary-phase Saccharomyces cerevisiae. Mech. Ageing Dev. 130:501–508 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Tong AH, Boone C. 2006. Synthetic genetic array analysis in Saccharomyces cerevisiae. Methods Mol. Biol. 313:171–192 [DOI] [PubMed] [Google Scholar]
  • 32. Tong AH, Evangelista M, Parsons AB, Xu H, Bader GD, Page N, Robinson M, Raghibizadeh S, Hogue CW, Bussey H, Andrews B, Tyers M, Boone C. 2001. Systematic genetic analysis with ordered arrays of yeast deletion mutants. Science 294:2364–2368 [DOI] [PubMed] [Google Scholar]
  • 33. Guthrie C, Fink G. 1991. Guide to yeast genetics and molecular biology, vol 194. Academic Press, San Diego, CA [Google Scholar]
  • 34. Jauert PA, Edmiston SN, Conway K, Kirkpatrick DT. 2002. RAD1 controls the meiotic expansion of the human HRAS1 minisatellite in Saccharomyces cerevisiae. Mol. Cell. Biol. 22:953–964 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Raveendranathan M, Chattopadhyay S, Bolon YT, Haworth J, Clarke DJ, Bielinsky AK. 2006. Genome-wide replication profiles of S-phase checkpoint mutants reveal fragile sites in yeast. EMBO J. 25:3627–3639 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Huang KN, Symington LS. 1995. Suppressors of a Saccharomyces cerevisiae pkc1 mutation identify alleles of the phosphatase gene PTC1 and of a novel gene encoding a putative basic leucine zipper protein. Genetics 141:1275–1285 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Sanchez Y, Desany BA, Jones WJ, Liu Q, Wang B, Elledge SJ. 1996. Regulation of RAD53 by the ATM-like kinases MEC1 and TEL1 in yeast cell cycle checkpoint pathways. Science 271:357–360 [DOI] [PubMed] [Google Scholar]
  • 38. Boeke JD, LaCroute F, Fink GR. 1984. A positive selection for mutants lacking orotidine-5′-phosphate decarboxylase activity in yeast: 5-fluoro-orotic acid resistance. Mol. Gen. Genet. 197:345–346 [DOI] [PubMed] [Google Scholar]
  • 39. Umezu K, Sugawara N, Chen C, Haber JE, Kolodner RD. 1998. Genetic analysis of yeast RPA1 reveals its multiple functions in DNA metabolism. Genetics 148:989–1005 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Li Z, Vizeacoumar FJ, Bahr S, Li J, Warringer J, Vizeacoumar FS, Min R, Vandersluis B, Bellay J, Devit M, Fleming JA, Stephens A, Haase J, Lin ZY, Baryshnikova A, Lu H, Yan Z, Jin K, Barker S, Datti A, Giaever G, Nislow C, Bulawa C, Myers CL, Costanzo M, Gingras AC, Zhang Z, Blomberg A, Bloom K, Andrews B, Boone C. 2011. Systematic exploration of essential yeast gene function with temperature-sensitive mutants. Nat. Biotechnol. 29:361–367 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Biggins S, Murray AW. 2001. The budding yeast protein kinase Ipl1/Aurora allows the absence of tension to activate the spindle checkpoint. Genes Dev. 15:3118–3129 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Pinsky BA, Kung C, Shokat KM, Biggins S. 2006. The Ipl1-Aurora protein kinase activates the spindle checkpoint by creating unattached kinetochores. Nat. Cell Biol. 8:78–83 [DOI] [PubMed] [Google Scholar]
  • 43. Lechner J, Carbon J. 1991. A 240 kd multisubunit protein complex, CBF3, is a major component of the budding yeast centromere. Cell 64:717–725 [DOI] [PubMed] [Google Scholar]
  • 44. Strunnikov AV, Kingsbury J, Koshland D. 1995. CEP3 encodes a centromere protein of Saccharomyces cerevisiae. J. Cell Biol. 128:749–760 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Cullmann G, Fien K, Kobayashi R, Stillman B. 1995. Characterization of the five replication factor C genes of Saccharomyces cerevisiae. Mol. Cell. Biol. 15:4661–4671 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Branzei D, Foiani M. 2006. The Rad53 signal transduction pathway: replication fork stabilization, DNA repair, and adaptation. Exp. Cell Res. 312:2654–2659 [DOI] [PubMed] [Google Scholar]
  • 47. Allen C, Buttner S, Aragon AD, Thomas JA, Meirelles O, Jaetao JE, Benn D, Ruby SW, Veenhuis M, Madeo F, Werner-Washburne M. 2006. Isolation of quiescent and nonquiescent cells from yeast stationary-phase cultures. J. Cell Biol. 174:89–100 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Aragon AD, Rodriguez AL, Meirelles O, Roy S, Davidson GS, Tapia PH, Allen C, Joe R, Benn D, Werner-Washburne M. 2008. Characterization of differentiated quiescent and nonquiescent cells in yeast stationary-phase cultures. Mol. Biol. Cell 19:1271–1280 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Torkko JM, Koivuranta KT, Miinalainen IJ, Yagi AI, Schmitz W, Kastaniotis AJ, Airenne TT, Gurvitz A, Hiltunen KJ. 2001. Candida tropicalis Etr1p and Saccharomyces cerevisiae Ybr026p (Mrf1′p), 2-enoyl thioester reductases essential for mitochondrial respiratory competence. Mol. Cell. Biol. 21:6243–6253 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Sanchez NS, Pearce DA, Cardillo TS, Uribe S, Sherman F. 2001. Requirements of Cyc2p and the porin, Por1p, for ionic stability and mitochondrial integrity in Saccharomyces cerevisiae. Arch. Biochem. Biophys. 392:326–332 [DOI] [PubMed] [Google Scholar]
  • 51. Liu Y, Kao HI, Bambara RA. 2004. Flap endonuclease 1: a central component of DNA metabolism. Annu. Rev. Biochem. 73:589–615 [DOI] [PubMed] [Google Scholar]
  • 52. Benedetti H, Raths S, Crausaz F, Riezman H. 1994. The END3 gene encodes a protein that is required for the internalization step of endocytosis and for actin cytoskeleton organization in yeast. Mol. Biol. Cell 5:1023–1037 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Levin DE, Fields FO, Kunisawa R, Bishop JM, Thorner J. 1990. A candidate protein kinase C gene, PKC1, is required for the S. cerevisiae cell cycle. Cell 62:213–224 [DOI] [PubMed] [Google Scholar]
  • 54. Fanning E, Klimovich V, Nager AR. 2006. A dynamic model for replication protein A (RPA) function in DNA processing pathways. Nucleic Acids Res. 34:4126–4137 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Kantake N, Sugiyama T, Kolodner RD, Kowalczykowski SC. 2003. The recombination-deficient mutant RPA (rfa1-t11) is displaced slowly from single-stranded DNA by Rad51 protein. J. Biol. Chem. 278:23410–23417 [DOI] [PubMed] [Google Scholar]
  • 56. Soustelle C, Vedel M, Kolodner R, Nicolas A. 2002. Replication protein A is required for meiotic recombination in Saccharomyces cerevisiae. Genetics 161:535–547 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Bando M, Katou Y, Komata M, Tanaka H, Itoh T, Sutani T, Shirahige K. 2009. Csm3, Tof1, and Mrc1 form a heterotrimeric mediator complex that associates with DNA replication forks. J. Biol. Chem. 284:34355–34365 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Katou Y, Kanoh Y, Bando M, Noguchi H, Tanaka H, Ashikari T, Sugimoto K, Shirahige K. 2003. S-phase checkpoint proteins Tof1 and Mrc1 form a stable replication-pausing complex. Nature 424:1078–1083 [DOI] [PubMed] [Google Scholar]
  • 59. Dohrmann PR, Sclafani RA. 2006. Novel role for checkpoint Rad53 protein kinase in the initiation of chromosomal DNA replication in Saccharomyces cerevisiae. Genetics 174:87–99 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. Gunjan A, Verreault A. 2003. A Rad53 kinase-dependent surveillance mechanism that regulates histone protein levels in S. cerevisiae. Cell 115:537–549 [DOI] [PubMed] [Google Scholar]
  • 61. de Morgan A, Brodsky L, Ronin Y, Nevo E, Korol A, Kashi Y. 2010. Genome-wide analysis of DNA turnover and gene expression in stationary-phase Saccharomyces cerevisiae. Microbiology 156:1758–1771 [DOI] [PubMed] [Google Scholar]
  • 62. Kokoska RJ, Stefanovic L, Tran HT, Resnick MA, Gordenin DA, Petes TD. 1998. Destabilization of yeast micro- and minisatellite DNA sequences by mutations affecting a nuclease involved in Okazaki fragment processing (rad27) and DNA polymerase delta (pol3-t). Mol. Cell. Biol. 18:2779–2788 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Lopes J, Ribeyre C, Nicolas A. 2006. Complex minisatellite rearrangements generated in the total or partial absence of Rad27/hFEN1 activity occur in a single generation and are Rad51 and Rad52 dependent. Mol. Cell. Biol. 26:6675–6689 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64. Gourlay CW, Ayscough KR. 2006. Actin-induced hyperactivation of the Ras signaling pathway leads to apoptosis in Saccharomyces cerevisiae. Mol. Cell. Biol. 26:6487–6501 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. Haghnazari E, Heyer WD. 2004. The Hog1 MAP kinase pathway and the Mec1 DNA damage checkpoint pathway independently control the cellular responses to hydrogen peroxide. DNA Repair 3:769–776 [DOI] [PubMed] [Google Scholar]
  • 66. Leroy C, Mann C, Marsolier MC. 2001. Silent repair accounts for cell cycle specificity in the signaling of oxidative DNA lesions. EMBO J. 20:2896–2906 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67. Pujol N, Bonet C, Vilella F, Petkova MI, Mozo-Villarias A, de la Torre-Ruiz MA. 2009. Two proteins from Saccharomyces cerevisiae: Pfy1 and Pkc1, play a dual role in activating actin polymerization and in increasing cell viability in the adaptive response to oxidative stress. FEMS Yeast Res. 9:1196–1207 [DOI] [PubMed] [Google Scholar]
  • 68. Jackson AL, Chen R, Loeb LA. 1998. Induction of microsatellite instability by oxidative DNA damage. Proc. Natl. Acad. Sci. U. S. A. 95:12468–12473 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 69. Ruchaud S, Carmena M, Earnshaw WC. 2007. Chromosomal passengers: conducting cell division. Nat. Rev. 8:798–812 [DOI] [PubMed] [Google Scholar]
  • 70. McCulley JL, Petes TD. 2010. Chromosome rearrangements and aneuploidy in yeast strains lacking both Tel1p and Mec1p reflect deficiencies in two different mechanisms. Proc. Natl. Acad. Sci. U. S. A. 107:11465–11470 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71. McSherry TD, Kitazono AA, Javaheri A, Kron SJ, Mueller PR. 2007. Non-catalytic function for ATR in the checkpoint response. Cell Cycle 6:2019–2030 [DOI] [PubMed] [Google Scholar]

Articles from Molecular and Cellular Biology are provided here courtesy of Taylor & Francis

RESOURCES