Skip to main content
Journal of Virology logoLink to Journal of Virology
. 2013 Feb;87(3):1465–1476. doi: 10.1128/JVI.02122-12

Significant Reductions in Gag-Protease-Mediated HIV-1 Replication Capacity during the Course of the Epidemic in Japan

Shigeru Nomura a, Noriaki Hosoya b, Zabrina L Brumme c,d, Mark A Brockman c,d, Tadashi Kikuchi a, Michiko Koga a, Hitomi Nakamura a, Tomohiko Koibuchi e, Takeshi Fujii e, Jonathan M Carlson f, David Heckerman f, Ai Kawana-Tachikawa a, Aikichi Iwamoto a, Toshiyuki Miura a,*,✉
PMCID: PMC3554148  PMID: 23152532

Abstract

Human immunodeficiency virus type 1 (HIV-1) evolves rapidly in response to host immune selection pressures. As a result, the functional properties of HIV-1 isolates from earlier in the epidemic may differ from those of isolates from later stages. However, few studies have investigated alterations in viral replication capacity (RC) over the epidemic. In the present study, we compare Gag-Protease-associated RC between early and late isolates in Japan (1994 to 2009). HIV-1 subtype B sequences from 156 antiretroviral-naïve Japanese with chronic asymptomatic infection were used to construct a chimeric NL4-3 strain encoding plasma-derived gag-protease. Viral replication capacity was examined by infecting a long terminal repeat-driven green fluorescent protein-reporter T cell line. We observed a reduction in the RC of chimeric NL4-3 over the epidemic, which remained significant after adjusting for the CD4+ T cell count and plasma virus load. The same outcome was seen when limiting the analysis to a single large cluster of related sequences, indicating that our results are not due to shifts in the molecular epidemiology of the epidemic in Japan. Moreover, the change in RC was independent of genetic distance between patient-derived sequences and wild-type NL4-3, thus ruling out potential temporal bias due to genetic similarity between patient and historic viral backbone sequences. Collectively, these data indicate that Gag-Protease-associated HIV-1 replication capacity has decreased over the epidemic in Japan. Larger studies from multiple geographical regions will be required to confirm this phenomenon.

INTRODUCTION

It has been almost 30 years since the discovery of human immunodeficiency virus type 1 (HIV-1) (1), a pathogen that first infected human populations approximately 100 years ago (2, 3). Over the course of the pandemic, substantial and various selection pressures have been exerted on HIV-1 by its human host, possibly resulting in alterations in viral replication capacity (RC), virulence, and/or other properties (4). However, few studies to date have examined population-level alterations in HIV-1 replication capacity over the epidemic's course (5, 6), and none have investigated the potential role of immune escape mutations selected by cellular immune responses in modulating this phenomenon.

Cytotoxic T lymphocytes (CTLs) play a major role in controlling viremia and disease progression in HIV-1 infection (7–11). However, the selection of escape mutations within or near CTL epitopes facilitates viral immune evasion (12–16) and represents a major challenge for HIV vaccine design. Since CTL responses are restricted by human leukocyte antigen (HLA) class I alleles, CTL escape mutations emerge in an HLA-specific manner. Many CTL escape mutations have been identified experimentally (15, 17–20); moreover, statistical analyses of large population-level data sets have yielded HLA-associated mutation maps of HIV-1 protein sequences, thereby identifying putative CTL escape sites (21–27). Importantly, these escape variants may be transmitted both vertically and horizontally (12, 28, 29). Furthermore, CTL escape variants selected by common HLA class I alleles may have been accumulating at the population level over the course of the epidemic in some regions, most notably, Japan (30, 31). If this is the case, active CTL epitopes restricted by common HLA class I alleles may be lost through mutational escape as the epidemic matures, possibly leading to increased viral virulence through enhanced immune evasion in these populations.

Although CTL escape mutations allow HIV to evade immune detection, they can also reduce viral replication capacity (28, 32–38). Furthermore, while certain virus-attenuating escape mutations revert upon transmission to recipients lacking the relevant HLA class I allele (20, 28, 36), this is not always the case (39, 40). Indeed, a recent study suggested that fixation of viruses carrying such attenuating escape mutations is increasing in an allele frequency-dependent manner in certain populations (30). These observations have led to the hypothesis that the in vitro replication capacity of HIV-1 may have been decreasing over the epidemic's course in certain populations, at the expense of the loss of active CTL epitopes at the population level through mutational escape.

In the present study, we generated chimeric HIV-1 isolates by inserting plasma HIV RNA-derived gag-protease sequences from 156 asymptomatic, chronically infected treatment-naïve Japanese patients dating from 1994 to 2009 into a laboratory strain backbone (HIV-1 NL4-3) and examined their replication capacity using published methods (33, 41–44). We specifically focused on the Gag protein, as it is likely to be the most important target of HLA-restricted CTLs (45) and because numerous fitness-reducing HLA-associated escape mutations have been described therein (28, 32–38). As such, Gag is ideal for investigating the potential effects of immune-mediated HIV attenuation over time. Overall, we have observed a significant reduction in Gag-Protease-mediated HIV-1 replication capacity as the epidemic has matured in Japan.

MATERIALS AND METHODS

Study participants.

A total of 177 antiretroviral-naïve Japanese individuals with asymptomatic chronic HIV-1 infection who visited the Research Hospital of the University of Tokyo from April 1992 through March 2009 were enrolled. Individuals with acute HIV infection, chronically infected individuals with a history of AIDS-defining illnesses, and hemophilia patients were excluded (hemophilia patients were excluded because Japanese hemophiliacs acquired HIV-1 from imported blood products in the mid-1980s [46, 47], a fact which could confound our analyses). The sociodemographic characteristics of the participants are shown in Table 1. Blood collected at the earliest available time point during the asymptomatic chronic phase of infection (median, 173 days after diagnosis; interquartile range [IQR], 56 to 525 days after diagnosis; range, 0 to 4,313 days after diagnosis) was studied. Plasma and peripheral blood mononuclear cells (PBMCs) were separated by standard procedures and stored at −80°C and in liquid nitrogen, respectively, until use. The study was approved by the Institutional Review Board of the Institute of Medical Science, University of Tokyo. Written informed consent was obtained from all participants.

Table 1.

Demographic characteristics of the participantsa

Characteristic Value
Median (range) age (yr) 31 (18–73)
No. (%) of participants by gender
    Male 167 (94)
    Female 10 (5.6)
Median (IQR) CD4+ T cell count (no. of cells μl−1) 339 (269–452)
Median (IQR) pVL (no. of RNA copies/ml) 23,000 (5,700–46,000)
No. (%) of participants by route of transmissionb
    Men who have sex with men 147 (83)
    Heterosexual 25 (14)
    Unknown 5 (2.8)
a

Data are for 177 participants.

b

Hemophilia patients were excluded from this study.

HLA class I typing.

Genomic DNA was extracted from PBMCs using a QIAamp DNA blood minikit (Qiagen Inc., Valencia, CA) following the manufacturer's instructions. High-resolution HLA class I typing was performed using a WAKFlow HLA typing kit (Wakunaga, Hiroshima, Japan) and a Luminex multianalyte profiling system (Luminex Corporation, Austin, TX).

Viral RNA isolation.

Plasma (500 μl) was quickly spun down to remove cell debris. The resulting clarified plasma was then centrifuged at 14,000 rpm (20,000 × g) for 120 min to pellet the virions. After centrifugation, 360 μl of the supernatant was discarded, leaving 140 μl plasma for which viral RNA was extracted using a QIAamp viral RNA minikit (Qiagen Inc., Valencia, CA). Extracted viral RNA was eluted in 80 μl of elution buffer and stored at −80°C until use.

Plasma virus sequencing.

The HIV-1 gag-protease region was amplified from extracted plasma HIV RNA as described previously, with some modifications (48). We included protease since disruption of the autologous combination of Gag and Protease may negatively affect Protease-mediated cleavage of Gag protein products, thus compromising the RC of the recombinant viruses. Briefly, reverse transcriptase PCR (RT-PCR) was performed using a Superscript III one-step RT-PCR system with Platinum Taq DNA polymerase with high fidelity (Invitrogen, Carlsbad, CA). Each 50-μl reaction mixture was composed of 4 μl of viral RNA, 25 μl of 2× reaction mix, 200 nM forward and reverse outer primers, 1 μl of enzyme mix, and water. RT-PCR primer sequences were AAATCTCTAGCAGTGGCGCCCGAACAG (strain HXB2 nucleotide numbering, positions 623 to 649) for the forward primer and TAACCCTGCGGGATGTGGTATTCC (positions 2849 to 2826) for the reverse primer. Thermal cycling conditions for the RT-PCR were 50°C for 30 min and 94°C for 2 min, followed by 35 cycles of 94°C for 15 s, 56°C for 30 s, and 68°C for 2 min. Second-round DNA PCR was performed using TaKaRa Ex Taq DNA polymerase Hot Start enzyme (TaKaRa Bio Inc., Shiga, Japan). Each reaction mixture contained 2 μl of the PCR product from the RT-PCR. PCR primer sequences were GCGGCGACTGGTGAGTACGCC (positions 734 to 754) for the forward primer and TCCTTTAGTTGCCCCCCTATC for the reverse primer (positions 2314 to 2294). Thermal cycling conditions were 94°C for 2 min, followed by 35 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 2 min and, finally, 10 min at 68°C. To examine protease sequences, the gag-protease region was reamplified from existing 1st-round RT-PCR products using forward primer GCTAGAAGGAGAGAGATGGG (positions 775 to 794 on HXB2) and reverse primer CAGTCTCAATAGGACTAATGGG (positions 2550 to 2571) with the same thermal cycler conditions described above. PCR amplifications were confirmed by agarose gel electrophoresis, and successful amplicons were purified using a QIAquick PCR purification kit (Qiagen Inc., Valencia, CA) according to the manufacturer's instructions. Population sequences were obtained by bidirectional reading using an ABI Prism BigDye Terminator (version 3.1) cycle sequencing kit (Applied Biosystems, Foster City, CA) on an Applied Biosystems 3130xl genetic analyzer. Chromatograms were edited using Sequencher software (Gene Codes Corporation, Ann Arbor, MI); nucleotide mixtures were called if the height of the secondary peak exceeded 25% of the dominant peak height. Multiple alignments were constructed using the ClustalW program. Maximum-likelihood phylogenetic trees were drawn from nucleotide alignments using DNAml of the PHYLIP program integrated into the BioEdit software package. HIV-1 subtypes were determined by the REGA HIV subtyping tool (http://hivdb.stanford.edu/). Recombinant viruses were detected using the recombination identification program (RIP; available at http://www.hiv.lanl.gov/content/sequence/RIP/RIP.html) and the jpHMM program (GOBICS; University of Göttingen). Pairwise genetic distances between individual gag sequences and the HIV-1 reference strain NL4-3 were calculated using DNAdist of the PHYLIP program integrated into BioEdit software.

Generation of chimeric viruses.

Chimeric NL4-3 viruses were generated as previously described (33, 49). Briefly, the gag-protease region was reamplified from the 1st-round RT-PCR products using 100-bp-long primers homologous to the NL4-3 reference strain (forward primer, GAC TCG GCT TGC TGA AGC GCG CAC GGC AAG AGG CGA GGG GCG GCG ACT GGT GAG TAC GCC AAA AAT TTT GAC TAG CGG AGG CTA GAA GGA GAG AGA TGG G [positions 695 to 794 on HXB2]; reverse primer, ATG CTT TTA TTT TTT CTT CTG TCA ATG GCC ATT GTT TAA CTT TTG GGC CAT CCA TTC CTG GCT TTA ATT TTA CTG GTA CAG TCT CAA TAG GAC TAA TGG G [positions 2649 to 2550]). Note that the forward primer overlapped the gag-coding sequence by five bases (underlined), and the reverse primer ended one base downstream of the protease gene. The PCR was undertaken in a final volume of 100 μl, consisting of 4 μl of 10 μM forward and reverse primers, 90 μl of Invitrogen Platinum PCR SuperMix high fidelity (Invitrogen, Carlsbad, CA), and 2 μl of the RT-PCR product. Thermal cycling conditions were 95°C for 2 min, followed by 35 cycles of 94°C for 30 s, 65°C for 30 s, and 72°C for 2 min and a 7-min extension of 72°C. PCR products were purified with the QIAquick PCR purification kit (Qiagen Inc., Valencia, CA) and eluted in 50 μl of elution buffer. pNL4-3 with a gag-protease deletion (33) and 5 to 10 μg of purified PCR product were cotransfected into 2.5 × 106 cells of a long terminal repeat (LTR)-driven green fluorescent protein (GFP)-reporter T cell line (GXR cells, CEM origin [50]) in 800 μl of R10+ medium (RPMI medium with 10% fetal calf serum containing penicillin and streptomycin) by electroporation (exponential protocol, 300 V, 500 μF). Cells were incubated for 45 min at room temperature, subsequently transferred to T25 flasks in 10 ml of R10+ medium, and incubated at 37°C with 5% CO2. GFP expression was monitored by flow cytometry (FACSCalibur; BD Biosciences, San Jose, CA) every 1 to 2 days after day 5. Supernatants containing recombinant virus stocks were harvested after GFP expression reached 15% among viable cells, and 1-ml aliquots were stored at −80°C until use. To verify the patient origin of each recombinant virus stock and rule out contamination or sample mix-up, viral RNA was extracted from 30 μl of virus stock using a ChargeSwitch EasyPlex viral kit (Invitrogen, Carlsbad, CA). gag sequences were obtained using the same method used for plasma virus sequencing described earlier, and maximum-likelihood phylogenetic trees incorporating the original bulk and recombinant virus sequences were constructed using DNAml.

Determination of recombinant virus titers and RC assay.

Determination of the titers of recombinant virus stocks and viral RC assays were performed as described previously (32, 35, 48, 50, 51). For determination of viral titer, 400-μl viral stocks were mixed with 1.0 × 106 GXR cells in 100 μl of R10+ medium in a 24-well plate and incubated at 37°C with 5% CO2. After 24 h, 1 ml R10+ medium was added to each culture. After 48 h, the titers of virus stocks were determined by measuring the percentage of GFP-positive (GFP+) cells using flow cytometry. In the subsequent replication capacity assay, virus stocks were used to infect 1.0 × 106 GXR cells at a multiplicity of infection of 0.002 in 500 μl of R10+ medium in a 24-well plate. All assays included a positive (wild-type NL4-3) and a negative (cells-only) control. Assay mixtures were incubated overnight at 37°C with 5% CO2, and 1 ml of R10+ medium was added on the following day (day 1). The percentage of GFP+ cells was then measured by flow cytometry every other day for the following week (days 2 to 8). For each virus, the natural log slope of the percentage of GFP+ cells was calculated during the exponential phase of viral spread (days 2 to 6). This value was divided by the mean rate of spread of the wild-type NL4-3 control to generate a normalized, quantitative measure of RC. An RC value of 1.0 indicates a rate of viral growth that was equal to that of NL4-3, while RC values of <1.0 and >1.0 indicate rates of spread that were lower and higher than the rate for wild-type NL4-3, respectively. All viruses were tested in a single experiment by a single operator; this experiment was performed in triplicate using fresh viral stocks for each one. Final RC values therefore represent the averages of wild-type NL4-3-normalized triplicate measurements.

Statistical analysis.

Statistical comparisons between independent groups were performed using the Mann-Whitney U test. Univariate correlation analysis was performed using Spearman's correlation. Multiple-regression analyses were performed using standard least-squares methods. For these analyses, a P value of <0.05 was considered significant. Analyses were performed in GraphPad Prism (version 5.03) software (GraphPad Software, La Jolla, CA).

Published phylogenetically informed methods were used to identify amino acids in Gag and Protease significantly associated with HLA class I alleles expressed in our data set (52, 53). Associations between viral RC and specific amino acid residues within Gag and Protease observed with a minimum frequency of 3 were identified using the Mann-Whitney U test. In these analyses, multiple comparisons were addressed using q values, the P value analogue of the false discovery rate (FDR) (54). The FDR is the expected proportion of false positives among results deemed significant at a given P-value threshold; for example, at a q value of ≤0.2, we expect 20% of identified associations to be false positives.

Nucleotide sequence accession numbers.

gag and protease sequences have been submitted to GenBank (accession numbers JX264247 to JX264562).

RESULTS

No significant temporal changes in CD4+ T cell count or pVLs by year of HIV-1 diagnosis.

A total of 177 asymptomatic, chronically HIV-1-infected Japanese individuals were enrolled. Since the replicative capacity of viruses within an individual's quasispecies tends to increase over the infection course (55–58) and immune-driven selection in Gag by protective HLA alleles predominantly affects viral RC in acute/early infection (44), individuals with acute infection and those with a history of AIDS-defining illnesses were excluded. Clinical markers of HIV infection (CD4+ T cell count and plasma virus loads [pVLs] at the time of sampling) were comparable among subjects, despite differences in year of HIV diagnosis (Fig. 1). Furthermore, although the timing of blood sampling varied substantially between subjects, no correlation between diagnosis year and the duration from diagnosis to blood sampling was observed (data not shown; R = 0.0084, P = 0.92).

Fig 1.

Fig 1

Correlation between plasma virus load, CD4+ T cell count, and year of HIV-1 diagnosis. No significant correlation between plasma HIV-1 load and the year of diagnosis (A) or the CD4+ T cell count and the year of diagnosis (B) was observed. Plasma virus loads and CD4+ T cell counts are based upon a single time point (date of blood sampling). Each dot represents a single individual (n = 177).

Relationship between viral replication capacity and clinical markers of HIV infection.

Of the 177 enrolled patients, full-length amplification of gag-protease was successful for 168 of these (94.9%). Eight individuals infected with non-clade B viruses (6 infected with CRF01_AE, 1 with CRF02_AG, and 1 with A1) and two individuals with intersubtype clade B gag recombinants were excluded from study. After construction of chimeric viral stocks and confirmation of their patient origin (Fig. 2), a further two samples were excluded due to suspected contamination. Viral RC was thus assessed for the remaining 156 recombinant viruses. Each recombinant virus was used to infect a GFP reporter T cell line, and its in vitro RC was examined over a 7-day period. Since the set-point viral load has been associated with the in vitro replication of chimeric viruses (33, 42, 43, 55–59), we first examined the potential correlation between plasma viral load, CD4+ T cell count, and RC of chimeric NL4-3 strains. A significant positive correlation between RC and plasma virus load was observed (R = 0.21, P = 0.0072; Fig. 3A), consistent with previous reports of the reduced RC of chimeric NL4-3 derived from HIV-1 controllers (33, 41, 42). No significant correlation between CD4+ T cell count and RC was observed (R = −0.042, P = 0.60; Fig. 3B), possibly due to exclusion of individuals with advanced disease from the present study.

Fig 2.

Fig 2

Validation of the origin of the gag-protease region in chimeric NL4-3 viruses. To verify the patient origin of each chimeric virus, a maximum-likelihood phylogenetic tree was constructed using plasma (red) and chimeric (blue) gag sequences. This tree includes 156 validated chimeric viruses that clustered with their original bulk sequences (two viruses were removed due to suspected contamination). The tree is rooted using the HIV-1 subtype A1 reference strain with GenBank accession number AF004885.

Fig 3.

Fig 3

Correlation between replication capacity of chimeric NL4-3 and clinical markers of HIV infection. The correlation of replication capacity of chimeric NL4-3 with pVL (A) and CD4 T cell count (B) at the time of blood sampling (n = 156) is shown. A statistically significant positive correlation between RC and pVL was observed (R = 0.21, P = 0.0072).

Change in Gag-Protease-associated viral replication capacity over the epidemic in Japan.

In order to investigate temporal changes in viral RC over the epidemic in Japan, the correlation between RC and year of HIV diagnosis was analyzed, revealing a significant inverse correlation (R = −0.27, P = 0.0006; Fig. 4A). This observation remained statistically significant in a multivariate linear regression model adjusting for CD4+ T cell count and plasma virus load (P = 0.0008; partial regression coefficients, −0.0064; 95% confidence interval [CI], −0.0101 to −0.0027). Consistent results were obtained when the original analysis was stratified by CD4+ T cell count at blood sampling (for CD4 T cell counts of >200, R = −0.28 and P = 0.0009; for CD4 T cell counts of >300, R = −0.25 and P = 0.013; for CD4 T cell counts of >500, R = −0.39 and P = 0.080; Fig. 4B to D). Taken together, these results support a decline in Gag-Protease-mediated RC in HIV-1 over the course of the Japanese epidemic which is independent of differences in pVLs and CD4 T cell counts in the studied population. Since the duration from HIV diagnosis to blood sampling varied among the subjects, the analysis was repeated and was limited to the subjects whose blood collection had been performed within a year of diagnosis of HIV infection; however, the inverse correlation remained significant (n = 105, R = −0.25, P = 0.0080; data not shown).

Fig 4.

Fig 4

Change in Gag-Protease-associated viral replication capacity over the epidemic in Japan. A statistically significant inverse correlation between year of diagnosis and replication capacity was observed in all subjects regardless of CD4 T cell count (n = 156) (A), only in subjects with a CD4+ T cell count of >200/μl (n = 145) (B), and only in subjects with a CD4+ T cell count of >300/μl (n = 100) (C). A similar tendency was observed when the analysis was limited to subjects with a CD4+ T cell count of >500/μl (n = 23) (D).

A potential confounder in such analyses is the molecular epidemiology of the epidemic itself. Theoretically, if distinct subtype B lineages with differential replication capacities were introduced into Japan at different times during the study period, this could influence our results. In order to exclude this possibility, we constructed a phylogenetic tree featuring global HIV-1 subtype B sequences (retrieved from the HIV sequence database at Los Alamos National Laboratory). Multiple clusters of Japanese clade B sequences were interspersed throughout the tree; however, all clusters contained sequences spanning the entire study period, indicating that there have been no major intraclade shifts within Japan in the past 2 decades (Fig. 5A). To further address this issue, we restricted our analysis to one particularly large cluster containing 55 sequences sampled over the study period (Fig. 5A) and found that the significant inverse correlation between RC and the year of diagnosis remained highly statistically significant in this cluster (R = −0.47, P = 0.0003; Fig. 5B). Taken together, these results support a decline in Gag-Protease-mediated RC in HIV-1 over the course of the Japanese epidemic which is not likely explained by shifts in the molecular epidemiology of HIV-1 over the period studied.

Fig 5.

Fig 5

Temporal change in Gag-Protease-associated viral replication capacity of 55 sequences from a phylogenetic cluster. (A) Maximum-likelihood phylogenetic tree constructed using gag sequences from 156 Japanese individuals obtained in the present study and 263 individuals from other countries (randomly selected from the Los Alamos National Laboratory HIV sequence database). Purple, light blue, and blue branches, Japanese sequences with HIV diagnoses of 1999 or earlier, 2000 to 2004, and 2005 or later, respectively; green branches, sequences from the United States and Canada; yellow branches, sequences from other countries (Argentina, Australia, Brazil, China, Cuba, Cyprus, Denmark, France, Germany, Hong Kong, India, Italy, Jamaica, Myanmar, Netherlands, Russia, South Africa, South Korea, Spain, Taiwan, Thailand, and the United Kingdom). Reference strains (which include two reference sequences for each of the HIV-1 group M subtypes, as well as inferred ancestral sequences of the A, B, and C subtypes [obtained from the Los Alamos National Laboratory database]) are shown in black. NL4-3 is shown as red. The tree is rooted using the HIV-1 subtype A1 reference strain with GenBank accession number AF004885. A large cluster of Japanese sequences (n = 55) is indicated by the large red circle. (B) A significant inverse correlation between the replication capacity of chimeric viruses and year of HIV diagnosis for the viruses within this large Japanese cluster (n = 55).

No correlation between replication capacity of chimeric viruses and their genetic distance from wild-type strain NL4-3.

Chimeric NL4-3 virus carrying gag-protease derived from subtype C isolates (42, 43) displayed reduced RC compared to viruses derived from subtype B, likely due in part to the substantial genetic distance between insert and backbone. It is therefore conceivable that subtype B sequences sampled from the early part of the epidemic may be more similar to the NL4-3 backbone sequence (first characterized in 1986 [60]) than those sampled later and that this may influence RC. To investigate this potential confounder, we calculated the genetic distance between each patient isolate and the wild-type NL4-3 gag sequence, and we examined the correlation between genetic distance and viral RC. No such relationship was observed (R = 0.0015, P = 0.98; Fig. 6). Moreover, RC of chimeric viruses remained inversely correlated with the year of HIV diagnosis in multivariate analyses controlling for genetic distance from NL4-3 (P = 0.0001; partial regression coefficients, −0.0086; 95% CI, −0.0129 to −0.0044). It is therefore reasonable to conclude that the decline in Gag-Protease-associated viral RC observed over the epidemic in Japan is unlikely to be explained by gross genetic incompatibility between NL4-3 and later clinical sequences circulating in the Japanese population.

Fig 6.

Fig 6

Chimeric virus replication capacity is not related to genetic distance between the insert and backbone. Pairwise genetic distances between the gag nucleotide sequence of each insert (clinical isolate sequence) and backbone (wild-type NL4-3) were calculated as described in Materials and Methods. No statistically significant correlation between the genetic distance and replication capacity of chimeric NL4-3 was observed.

Accumulation of PI resistance-associated mutations over time?

Twelve major protease inhibitor (PI) resistance-associated mutations have been reported in the HIV Drug Resistance Database at Stanford University (http://hivdb.stanford.edu/), and some of these reduce viral replication capacity (61–67). To address the temporal accumulation of PI resistance mutations as a potential confounder, HIV-1 protease sequences were examined for 140 subjects for whom chimeric viruses were generated (for the remaining 15 patients, PCR or sequencing was unsuccessful). PI resistance-associated mutations were observed in 6 subjects, none of whom carried more than one PI resistance-associated mutation (4 were M46L and 2 were N88S), and all but 1 were enrolled after 2005. The median RC of chimeric NL4-3 derived from subjects with these PI resistance-associated mutations (n = 6) was higher than that of the others (n = 134) (1.21 versus 1.13; P = 0.013). Moreover, after excluding viruses derived from these 6 subjects from the original analysis, the temporal decline in chimeric virus RC remained significant (R = −0.33, P < 0.0001). Collectively, these data indicate that accumulation of PI resistance-associated variants in the population does not explain the change in viral RC over time in Japan.

Relationship between HLA class I alleles and temporal change in replication capacities of chimeric viruses.

Chimeric NL4-3 virus derived from recent patient sequences displayed reduced in vitro RC compared to earlier isolates. To investigate whether immune selection pressure by specific HLA class I alleles could have contributed to this relative attenuation, the RCs of chimeric viruses were compared with respect to the presence versus absence of particular HLA-A, -B, and -C alleles in their host (note that analyses were limited to HLA alleles expressed in >20 individuals). In a cross-sectional analysis undertaken on the whole cohort regardless of sampling date, no significant associations between HLA class I expression and viral RC were observed (data not shown). However, when recombinant viruses were stratified on the basis of the year of HIV diagnosis (2002 or earlier versus 2003 or later), significantly lower median RC values were observed among A*24-expressing persons in early stages (for A*24-positive [A*24+] versus A*24-negative [A*24−] persons, 1.14 versus 1.21; P = 0.024) but not later stages (for A*24+ versus A*24− persons, 1.12 versus 1.11; P = 0.20) of the epidemic (Fig. 7A), suggesting that the viral RC in A*24− persons in the early stage might have declined to levels comparable to those of A*24+ persons in the late stage. Such a phenomenon was not observed for other HLA class I alleles (the results for A*02, B*40, and C*03 are shown in Fig. 7B to D, respectively). Nearly 70% of Japanese express HLA-A*24, making it the most common class I allele in this population. Our finding raises the intriguing hypothesis that A*24-associated escape mutations, alone or in combination, reduce viral RC to a modest extent and that these A*24-attenuated viruses have increased in prevalence at the population level over the course of the Japanese epidemic via transmission to and persistence in non-A*24-expressing persons.

Fig 7.

Fig 7

Relationship between common HLA alleles and chimeric virus replication capacity during early and late epidemic periods. To examine the potential impact of selection pressures by common HLA alleles in the Japanese population on the change in viral replication capacity, chimeric viruses were grouped according to year of HIV diagnosis (early [2002 or earlier] and late [2003 or later]), and associations between replication capacity and expression of particular HLA class I alleles were examined. Recombinant viruses from HLA-A*24-expressing hosts exhibited reduced RC before 2002 but not thereafter (A). However, such a phenomenon was not observed for other alleles investigated: A*02, B*40, and C*03 (B to D). Horizontal bars indicate the median values.

Due to the relative rarity of this allele in Caucasians and Africans, HLA-A*24-restricted CTL epitopes have not been studied extensively; nevertheless, two optimal A*24 CTL epitopes within Gag and Protease have been reported: KW9 in p17 (Gag positions 28 to 36) (68) and RL11 in p24 (Gag positions 294 to 304) (69). However, we observed no accumulation of particular mutations within either of these known epitopes (data not shown). A published in silico analysis undertaken on >1,500 subtype B-infected individuals from Canada, the United States, and Australia reported a putative escape association between HLA-A*24 and the K30R substitution in p17Gag (21). However, the accumulation of K30R was not observed in the present study (data not shown), and the RCs of chimeric viruses with this substitution were not statistically different from the RCs of those without it. In addition, a phylogenetically corrected analysis of HLA-associated polymorphisms in 156 Japanese viral sequences from the present study identified Gag V362I to be significantly associated with HLA-A*24 (present in 17% of A*24+ patients versus 4.1% of A*24− patients; P < 0.001, q < 0.1). However, as this substitution was observed in only 3 of 74 A*24-negative individuals in the present study, it was not possible to demonstrate its accumulation over the study period.

Accumulation of mutations associated with reduced replication capacity.

Lastly, we conducted an exploratory analysis to identify specific amino acids in Gag and Protease associated with viral RC in our data set. Although no associations were observed at a q value of <0.2, 34 amino acids within Gag and 5 within Protease were identified as being associated with a lower RC at a P value of <0.05 (all q values were <0.4; not shown). We then investigated whether the frequencies of viruses carrying these Gag or Protease mutations increased over the course of the epidemic. Of the 34 polymorphisms identified in Gag, 6 significantly increased over the study period (V46L, L64I, D121G, A224P, T470A, I479L), while of the 5 mutations identified in Protease, 1 (R41K) significantly increased over the study period. However, with the exception of Gag L64I (reported to be associated with A*68) (21), none of these polymorphisms are known to be HLA associated.

DISCUSSION

In the present study, we observed a significant reduction in Gag-Protease-associated HIV-1 replication capacity over the past 15 years of the HIV-1 epidemic in Japan.

Our analyses addressed a number of potential confounders. First, viral RC is known to change over the course of HIV infection (70, 71). Examining the RCs of viruses isolated from acutely infected subjects is therefore ideal; however, the availability of such historic panels of specimens from a particular geographical area is extremely limited. Therefore, to rule out infection stage as a potential confounder, we undertook multivariate analyses adjusting for CD4 count and pVL as surrogate markers of disease stage. Second, to exclude the possibility that the molecular epidemiology of HIV in Japan differed in the early and late phases of the epidemic, we performed a subanalysis limited to a particularly large cluster composed of only Japanese clade B sequences sampled over the study period. Lastly, to address a concern about incompatibility between backbone NL4-3 and gag-protease from recent clinical isolates, we demonstrated that the year of HIV diagnosis correlated with RC independently of the genetic distance between patient-derived sequences and the wild-type NL4-3 sequence. In all cases, our original findings still held after controlling for these potential confounders. Furthermore, temporal trends in RC did not appear to be driven by protease inhibitor resistance mutations (which were infrequent in the studied population). Nevertheless, we cannot rule out the possibility that the introduction of increasingly more potent protease inhibitors over time is driving the selection of novel secondary drug resistance-associated polymorphisms that compromise RC and that such polymorphisms may be increasing in frequency in the general population.

Attempts have been made to study population-level changes in plasma HIV loads, CD4 T cell counts, and rates of disease progression over time as indirect evidence for altered HIV virulence over the epidemic's course. However, the lack of historic data, inherent limitations in conducting observational studies, and changes in the technologies used to measure clinical parameters have made this an extremely difficult issue to address. Despite this, a pattern appears to be emerging. While studies undertaken prior to the mid-1990s yielded conflicting results (72–76), more recent reports support the observation that HIV may be increasing in virulence as the epidemic progresses (77–85).

At first, published reports of increased virulence over time may appear to be inconsistent with our findings of reduced in vitro viral RC over the course of the Japanese epidemic. However, it is important to note that in vitro RC does not necessarily equate with viral virulence, as the former assesses the ability of a recombinant virus to replicate in a controlled in vitro environment devoid of host or other selection pressures, while the latter reflects the far more complex capacity of the virus to cause disease in its host. Indeed, while certain immune escape mutations reduce in vitro viral RC (28, 32–38), we must also consider that mutants with such escape mutations are highly adapted to their in vivo environment within a host expressing the relevant HLA class I allele. Indeed, while RC may be somewhat compromised compared to that of wild type, escape mutant viruses able to fully or partially evade CTL detection in vivo are almost certainly more virulent in the HLA-matched host environment, leading to increased virion production and thereby enhanced pathogenesis. The context dependency of viral fitness is similarly illustrated by antiretroviral resistance mutations such as M184V within reverse transcriptase (86–91): viruses harboring this mutation display relative in vitro replicative defects but are certainly more fit than their wild-type counterparts in the presence of lamivudine both in vivo and in vitro.

It is notable that viremia remained relatively unchanged over the study period. One potential explanation for this observation is the existence of two conflicting processes that offset each other: on the one hand, an increase in virus production (manifested as pVL) as a result of viral adaptation to its host and, on the other, a concomitant decrease in RC as a result of the fitness costs of this adaptation. To investigate this hypothesis, we conducted a multivariate analysis to examine the relationship between pVL and the year of diagnosis when conditioned on RC; however, no apparent trend was observed (data not shown); larger-scale studies will therefore be necessary to further investigate the interplay between these factors.

It was surprising to see such a clear decline in viral RC over the relatively short study period, especially in a country where HIV incidence and prevalence are low (HIV prevalence in Japan is <0.1%; [HIV and AIDS Data Hub for Asia-Pacific, http://www.aidsdatahub.org/]). However, Japan is relatively ethnically homogeneous and its population exhibits a far narrower HLA frequency spectrum than the populations of Western countries (92). This more limited HLA diversity may facilitate the rapid accumulation of CTL escape mutations in circulating HIV-1 sequences (93), most notably, those restricted by common Japanese HLA class I alleles (30, 31).

Intriguingly, lower viral RC was observed in HLA-A*24+ patients than HLA-A*24− patients in earlier but not later periods of the Japanese epidemic. We propose the following interpretation for this observation: regardless of epidemic stage, viruses from HLA-A*24-positive patients carry A*24 escape mutations; therefore, no differences in RC are observed between early and late isolates from A*24-positive individuals. However, if single (or combinations of) A*24 escape mutants, some of which carry modest replicative costs, are transmitted to A*24-negative individuals and if some of these escape mutants persist in A*24-negative individuals, despite these modest replicative costs, it is possible that such mutations will increase in frequency in the general population over the course of the epidemic. If so, it is conceivable that the RC in A*24-negative individuals will concomitantly decline to levels similar to those in A*24-positive individuals over time. Although we did not observe any differences in the prevalence of particular amino acids within known A*24-restricted CTL epitopes in Gag and Protease in early versus later sequences, accumulation of A*24 CTL escape mutations within Nef in circulating viruses in Japan has been reported (31), suggesting that a similar phenomenon could be occurring in Gag. The link between A*24-associated immune pressure and temporal reductions in RC therefore remains speculative; future studies will be required to define CTL escape mutations for HLA alleles frequently observed in Japanese populations and demonstrate the accumulation of such mutations during the HIV epidemic.

Despite the limited statistical power of the present study to detect such associations, we performed an exploratory analysis to identify specific amino acid residues that could explain observed reductions in viral RC. Although we identified a number of putative amino acids that were associated with lower RCs at a P value of <0.05 and whose frequency appeared to increase over the study period, these associations did not remain significant after correction for multiple comparisons, and thus, our results should be interpreted with caution. Larger studies aimed at identifying amino acids associated with temporal alterations in RC are therefore warranted.

Another caveat is that only Gag-Protease-associated viral RC was evaluated in the present study; as such, our results may not be representative of RC of whole virus isolates. The reasons for specifically investigating Gag-Protease-associated RC are 2-fold. First, our primary purpose was to investigate temporal changes in viral RC potentially attributable to HLA-associated immune pressures in Gag, a critical target of CTL responses. Whole-virus assays would have been confounded by the autologous envelope sequence, which is a major determinant of viral fitness (57) but is highly sensitive to infection stage due to shifts in coreceptor usage (94–96). Second, the generation and evaluation of large numbers of viruses require higher-throughput methods. Whole-virus isolates are traditionally replicated in primary CD4+ T cells, but the laborious and costly nature of these assays precludes their application to large sample panels such as that used in the present study.

Despite these limitations, the present study sheds light on the replicative costs of HIV-1 adaptation to its human host. Additional, larger studies spanning greater durations of the HIV epidemic undertaken in different geographic areas and host populations, as well as studies elucidating the clinical implications of alterations in viral RC, are warranted, to determine whether this is a local or global phenomenon.

ACKNOWLEDGMENTS

We thank all of the patients and clinical staff at the Research Hospital of the Institute of Medical Science, University of Tokyo, for their essential contributions to this study.

This work was supported in part by a Grant-in-Aid for Scientific Research (B) from the Japan Society for the Promotion of Science (22390203 to T.M. and 22590412 to A.K.T.); research on HIV/AIDS (to T.M., A.K.T., and T.K.), research on international cooperation in medical science (to A.I.), and research on global health issues (to A.I.) from a Health Labor Science Research Grant from the Ministry of Health Labor and Welfare; contact research funds from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) for the Program of Japan Initiative for the Global Research Network on Infectious Disease (10005010, to A.I.); the Global COE Program (Center of Education and Research for Advanced Genome-Based Medicine for Personalized Medicine and the Control of Worldwide Infectious Diseases) of MEXT (F06, to A.I.); a Canada Research Chair, Tier 2, in Viral Pathogenesis and Immunity (to M.A.B.); and a New Investigator Award from the Canadian Institutes of Health Research and a Scholar Award from the Michael Smith Foundation for Health Research (to Z.L.B.).

Footnotes

Published ahead of print 14 November 2012

REFERENCES

  • 1. Barre-Sinoussi F, Chermann JC, Rey F, Nugeyre MT, Chamaret S, Gruest J, Dauguet C, Axler-Blin C, Vezinet-Brun F, Rouzioux C, Rozenbaum W, Montagnier L. 1983. Isolation of a T-lymphotropic retrovirus from a patient at risk for acquired immune deficiency syndrome (AIDS). Science 220:868–871 [DOI] [PubMed] [Google Scholar]
  • 2. Korber B, Muldoon M, Theiler J, Gao F, Gupta R, Lapedes A, Hahn BH, Wolinsky S, Bhattacharya T. 2000. Timing the ancestor of the HIV-1 pandemic strains. Science 288:1789–1796 [DOI] [PubMed] [Google Scholar]
  • 3. Worobey M, Gemmel M, Teuwen DE, Haselkorn T, Kunstman K, Bunce M, Muyembe JJ, Kabongo JM, Kalengayi RM, Van Marck E, Gilbert MT, Wolinsky SM. 2008. Direct evidence of extensive diversity of HIV-1 in Kinshasa by 1960. Nature 455:661–664 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Bunnik EM, Euler Z, Welkers MR, Boeser-Nunnink BD, Grijsen ML, Prins JM, Schuitemaker H. 2010. Adaptation of HIV-1 envelope gp120 to humoral immunity at a population level. Nat. Med. 16:995–997 [DOI] [PubMed] [Google Scholar]
  • 5. Arien KK, Troyer RM, Gali Y, Colebunders RL, Arts EJ, Vanham G. 2005. Replicative fitness of historical and recent HIV-1 isolates suggests HIV-1 attenuation over time. AIDS 19:1555–1564 [DOI] [PubMed] [Google Scholar]
  • 6. Gali Y, Berkhout B, Vanham G, Bakker M, Back NK, Arien KK. 2007. Survey of the temporal changes in HIV-1 replicative fitness in the Amsterdam cohort. Virology 364:140–146 [DOI] [PubMed] [Google Scholar]
  • 7. Borrow P, Lewicki H, Hahn BH, Shaw GM, Oldstone MB. 1994. Virus-specific CD8+ cytotoxic T-lymphocyte activity associated with control of viremia in primary human immunodeficiency virus type 1 infection. J. Virol. 68:6103–6110 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Koup RA, Safrit JT, Cao Y, Andrews CA, McLeod G, Borkowsky W, Farthing C, Ho DD. 1994. Temporal association of cellular immune responses with the initial control of viremia in primary human immunodeficiency virus type 1 syndrome. J. Virol. 68:4650–4655 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Matano T, Shibata R, Siemon C, Connors M, Lane HC, Martin MA. 1998. Administration of an anti-CD8 monoclonal antibody interferes with the clearance of chimeric simian/human immunodeficiency virus during primary infections of rhesus macaques. J. Virol. 72:164–169 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Schmitz JE, Kuroda MJ, Santra S, Sasseville VG, Simon MA, Lifton MA, Racz P, Tenner-Racz K, Dalesandro M, Scallon BJ, Ghrayeb J, Forman MA, Montefiori DC, Rieber EP, Letvin NL, Reimann KA. 1999. Control of viremia in simian immunodeficiency virus infection by CD8+ lymphocytes. Science 283:857–860 [DOI] [PubMed] [Google Scholar]
  • 11. Goulder PJ, Watkins DI. 2008. Impact of MHC class I diversity on immune control of immunodeficiency virus replication. Nat. Rev. Immunol. 8:619–630 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Allen TM, Altfeld M, Yu XG, O'Sullivan KM, Lichterfeld M, Le Gall S, John M, Mothe BR, Lee PK, Kalife ET, Cohen DE, Freedberg KA, Strick DA, Johnston MN, Sette A, Rosenberg ES, Mallal SA, Goulder PJ, Brander C, Walker BD. 2004. Selection, transmission, and reversion of an antigen-processing cytotoxic T-lymphocyte escape mutation in human immunodeficiency virus type 1 infection. J. Virol. 78:7069–7078 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Draenert R, Le Gall S, Pfafferott KJ, Leslie AJ, Chetty P, Brander C, Holmes EC, Chang SC, Feeney ME, Addo MM, Ruiz L, Ramduth D, Jeena P, Altfeld M, Thomas S, Tang Y, Verrill CL, Dixon C, Prado JG, Kiepiela P, Martinez-Picado J, Walker BD, Goulder PJ. 2004. Immune selection for altered antigen processing leads to cytotoxic T lymphocyte escape in chronic HIV-1 infection. J. Exp. Med. 199:905–915 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Ammaranond P, Zaunders J, Satchell C, van Bockel D, Cooper DA, Kelleher AD. 2005. A new variant cytotoxic T lymphocyte escape mutation in HLA-B27-positive individuals infected with HIV type 1. AIDS Res. Hum. Retroviruses 21:395–397 [DOI] [PubMed] [Google Scholar]
  • 15. Goulder PJ, Watkins DI. 2004. HIV and SIV CTL escape: implications for vaccine design. Nat. Rev. Immunol. 4:630–640 [DOI] [PubMed] [Google Scholar]
  • 16. Price DA, West SM, Betts MR, Ruff LE, Brenchley JM, Ambrozak DR, Edghill-Smith Y, Kuroda MJ, Bogdan D, Kunstman K, Letvin NL, Franchini G, Wolinsky SM, Koup RA, Douek DC. 2004. T cell receptor recognition motifs govern immune escape patterns in acute SIV infection. Immunity 21:793–803 [DOI] [PubMed] [Google Scholar]
  • 17. Phillips RE, Rowland-Jones S, Nixon DF, Gotch FM, Edwards JP, Ogunlesi AO, Elvin JG, Rothbard JA, Bangham CR, Rizza CR, McMichael AJ. 1991. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature 354:453–459 [DOI] [PubMed] [Google Scholar]
  • 18. Borrow P, Lewicki H, Wei X, Horwitz MS, Peffer N, Meyers H, Nelson JA, Gairin JE, Hahn BH, Oldstone MB, Shaw GM. 1997. Antiviral pressure exerted by HIV-1-specific cytotoxic T lymphocytes (CTLs) during primary infection demonstrated by rapid selection of CTL escape virus. Nat. Med. 3:205–211 [DOI] [PubMed] [Google Scholar]
  • 19. Price DA, Goulder PJ, Klenerman P, Sewell AK, Easterbrook PJ, Troop M, Bangham CR, Phillips RE. 1997. Positive selection of HIV-1 cytotoxic T lymphocyte escape variants during primary infection. Proc. Natl. Acad. Sci. U. S. A. 94:1890–1895 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Leslie AJ, Pfafferott KJ, Chetty P, Draenert R, Addo MM, Feeney M, Tang Y, Holmes EC, Allen T, Prado JG, Altfeld M, Brander C, Dixon C, Ramduth D, Jeena P, Thomas SA, St John A, Roach TA, Kupfer B, Luzzi G, Edwards A, Taylor G, Lyall H, Tudor-Williams G, Novelli V, Martinez-Picado J, Kiepiela P, Walker BD, Goulder PJ. 2004. HIV evolution: CTL escape mutation and reversion after transmission. Nat. Med. 10:282–289 [DOI] [PubMed] [Google Scholar]
  • 21. Brumme ZL, John M, Carlson JM, Brumme CJ, Chan D, Brockman MA, Swenson LC, Tao I, Szeto S, Rosato P, Sela J, Kadie CM, Frahm N, Brander C, Haas DW, Riddler SA, Haubrich R, Walker BD, Harrigan PR, Heckerman D, Mallal S. 2009. HLA-associated immune escape pathways in HIV-1 subtype B Gag, Pol and Nef proteins. PLoS One 4:e6687 doi:10.1371/journal.pone.0006687 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Brumme ZL, Tao I, Szeto S, Brumme CJ, Carlson JM, Chan D, Kadie C, Frahm N, Brander C, Walker B, Heckerman D, Harrigan PR. 2008. Human leukocyte antigen-specific polymorphisms in HIV-1 Gag and their association with viral load in chronic untreated infection. AIDS 22:1277–1286 [DOI] [PubMed] [Google Scholar]
  • 23. Moore CB, John M, James IR, Christiansen FT, Witt CS, Mallal SA. 2002. Evidence of HIV-1 adaptation to HLA-restricted immune responses at a population level. Science 296:1439–1443 [DOI] [PubMed] [Google Scholar]
  • 24. Bhattacharya T, Daniels M, Heckerman D, Foley B, Frahm N, Kadie C, Carlson J, Yusim K, McMahon B, Gaschen B, Mallal S, Mullins JI, Nickle DC, Herbeck J, Rousseau C, Learn GH, Miura T, Brander C, Walker B, Korber B. 2007. Founder effects in the assessment of HIV polymorphisms and HLA allele associations. Science 315:1583–1586 [DOI] [PubMed] [Google Scholar]
  • 25. Rousseau CM, Daniels MG, Carlson JM, Kadie C, Crawford H, Prendergast A, Matthews P, Payne R, Rolland M, Raugi DN, Maust BS, Learn GH, Nickle DC, Coovadia H, Ndung'u T, Frahm N, Brander C, Walker BD, Goulder PJ, Bhattacharya T, Heckerman DE, Korber BT, Mullins JI. 2008. HLA class I-driven evolution of human immunodeficiency virus type 1 subtype C proteome: immune escape and viral load. J. Virol. 82:6434–6446 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. John M, Heckerman D, James I, Park LP, Carlson JM, Chopra A, Gaudieri S, Nolan D, Haas DW, Riddler SA, Haubrich R, Mallal S. 2010. Adaptive interactions between HLA and HIV-1: highly divergent selection imposed by HLA class I molecules with common supertype motifs. J. Immunol. 184:4368–4377 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Carlson JM, Brumme CJ, Martin E, Listgarten J, Brockman MA, Le AQ, Chui C, Cotton LA, Knapp DJ, Riddler SA, Haubrich R, Nelson G, Pfeifer N, Deziel CE, Heckerman D, Apps R, Carrington M, Mallal S, Harrigan PR, John M, Brumme ZL. 2012. Correlates of protective cellular immunity revealed by analysis of population-level immune escape pathways in HIV-1. J. Virol. 86:13202–13216 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Crawford H, Lumm W, Leslie A, Schaefer M, Boeras D, Prado JG, Tang J, Farmer P, Ndung'u T, Lakhi S, Gilmour J, Goepfert P, Walker BD, Kaslow R, Mulenga J, Allen S, Goulder PJ, Hunter E. 2009. Evolution of HLA-B*5703 HIV-1 escape mutations in HLA-B*5703-positive individuals and their transmission recipients. J. Exp. Med. 206:909–921 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Goulder PJ, Pasquier C, Holmes EC, Liang B, Tang Y, Izopet J, Saune K, Rosenberg ES, Burchett SK, McIntosh K, Barnardo M, Bunce M, Walker BD, Brander C, Phillips RE. 2001. Mother-to-child transmission of HIV infection and CTL escape through HLA-A2-SLYNTVATL epitope sequence variation. Immunol. Lett. 79:109–116 [DOI] [PubMed] [Google Scholar]
  • 30. Kawashima Y, Pfafferott K, Frater J, Matthews P, Payne R, Addo M, Gatanaga H, Fujiwara M, Hachiya A, Koizumi H, Kuse N, Oka S, Duda A, Prendergast A, Crawford H, Leslie A, Brumme Z, Brumme C, Allen T, Brander C, Kaslow R, Tang J, Hunter E, Allen S, Mulenga J, Branch S, Roach T, John M, Mallal S, Ogwu A, Shapiro R, Prado JG, Fidler S, Weber J, Pybus OG, Klenerman P, Ndung'u T, Phillips R, Heckerman D, Harrigan PR, Walker BD, Takiguchi M, Goulder P. 2009. Adaptation of HIV-1 to human leukocyte antigen class I. Nature 458:641–645 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Furutsuki T, Hosoya N, Kawana-Tachikawa A, Tomizawa M, Odawara T, Goto M, Kitamura Y, Nakamura T, Kelleher AD, Cooper DA, Iwamoto A. 2004. Frequent transmission of cytotoxic-T-lymphocyte escape mutants of human immunodeficiency virus type 1 in the highly HLA-A24-positive Japanese population. J. Virol. 78:8437–8445 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Brockman MA, Schneidewind A, Lahaie M, Schmidt A, Miura T, Desouza I, Ryvkin F, Derdeyn CA, Allen S, Hunter E, Mulenga J, Goepfert PA, Walker BD, Allen TM. 2007. Escape and compensation from early HLA-B57-mediated cytotoxic T-lymphocyte pressure on human immunodeficiency virus type 1 Gag alter capsid interactions with cyclophilin A. J. Virol. 81:12608–12618 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Miura T, Brockman MA, Brumme ZL, Brumme CJ, Pereyra F, Trocha A, Block BL, Schneidewind A, Allen TM, Heckerman D, Walker BD. 2009. HLA-associated alterations in replication capacity of chimeric NL4-3 viruses carrying gag-protease from elite controllers of human immunodeficiency virus type 1. J. Virol. 83:140–149 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Bailey JR, O'Connell K, Yang HC, Han Y, Xu J, Jilek B, Williams TM, Ray SC, Siliciano RF, Blankson JN. 2008. Transmission of human immunodeficiency virus type 1 from a patient who developed AIDS to an elite suppressor. J. Virol. 82:7395–7410 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Schneidewind A, Brockman MA, Yang R, Adam RI, Li B, Le Gall S, Rinaldo CR, Craggs SL, Allgaier RL, Power KA, Kuntzen T, Tung CS, LaBute MX, Mueller SM, Harrer T, McMichael AJ, Goulder PJ, Aiken C, Brander C, Kelleher AD, Allen TM. 2007. Escape from the dominant HLA-B27-restricted cytotoxic T-lymphocyte response in Gag is associated with a dramatic reduction in human immunodeficiency virus type 1 replication. J. Virol. 81:12382–12393 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Martinez-Picado J, Prado JG, Fry EE, Pfafferott K, Leslie A, Chetty S, Thobakgale C, Honeyborne I, Crawford H, Matthews P, Pillay T, Rousseau C, Mullins JI, Brander C, Walker BD, Stuart DI, Kiepiela P, Goulder P. 2006. Fitness cost of escape mutations in p24 Gag in association with control of human immunodeficiency virus type 1. J. Virol. 80:3617–3623 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Crawford H, Prado JG, Leslie A, Hue S, Honeyborne I, Reddy S, van der Stok M, Mncube Z, Brander C, Rousseau C, Mullins JI, Kaslow R, Goepfert P, Allen S, Hunter E, Mulenga J, Kiepiela P, Walker BD, Goulder PJ. 2007. Compensatory mutation partially restores fitness and delays reversion of escape mutation within the immunodominant HLA-B*5703-restricted Gag epitope in chronic human immunodeficiency virus type 1 infection. J. Virol. 81:8346–8351 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Boutwell CL, Rowley CF, Essex M. 2009. Reduced viral replication capacity of human immunodeficiency virus type 1 subtype C caused by cytotoxic-T-lymphocyte escape mutations in HLA-B57 epitopes of capsid protein. J. Virol. 83:2460–2468 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Schneidewind A, Brumme ZL, Brumme CJ, Power KA, Reyor LL, O'Sullivan K, Gladden A, Hempel U, Kuntzen T, Wang YE, Oniangue-Ndza C, Jessen H, Markowitz M, Rosenberg ES, Sekaly RP, Kelleher AD, Walker BD, Allen TM. 2009. Transmission and long-term stability of compensated CD8 escape mutations. J. Virol. 83:3993–3997 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Cornelissen M, Hoogland FM, Back NK, Jurriaans S, Zorgdrager F, Bakker M, Brinkman K, Prins M, van der Kuyl AC. 2009. Multiple transmissions of a stable human leucocyte antigen-B27 cytotoxic T-cell-escape strain of HIV-1 in The Netherlands. AIDS 23:1495–1500 [DOI] [PubMed] [Google Scholar]
  • 41. Miura T, Brumme ZL, Brockman MA, Rosato P, Sela J, Brumme CJ, Pereyra F, Kaufmann DE, Trocha A, Block BL, Daar ES, Connick E, Jessen H, Kelleher AD, Rosenberg E, Markowitz M, Schafer K, Vaida F, Iwamoto A, Little S, Walker BD. 2010. Impaired replication capacity of acute/early viruses in persons who become HIV controllers. J. Virol. 84:7581–7591 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42. Wright JK, Brumme ZL, Carlson JM, Heckerman D, Kadie CM, Brumme CJ, Wang B, Losina E, Miura T, Chonco F, van der Stok M, Mncube Z, Bishop K, Goulder PJ, Walker BD, Brockman MA, Ndung'u T. 2010. Gag-protease-mediated replication capacity in HIV-1 subtype C chronic infection: associations with HLA type and clinical parameters. J. Virol. 84:10820–10831 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Wright JK, Novitsky V, Brockman MA, Brumme ZL, Brumme CJ, Carlson JM, Heckerman D, Wang B, Losina E, Leshwedi M, van der Stok M, Maphumulo L, Mkhwanazi N, Chonco F, Goulder PJ, Essex M, Walker BD, Ndung'u T. 2011. Influence of Gag-protease-mediated replication capacity on disease progression in individuals recently infected with HIV-1 subtype C. J. Virol. 85:3996–4006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44. Brockman MA, Brumme ZL, Brumme CJ, Miura T, Sela J, Rosato PC, Kadie CM, Carlson JM, Markle TJ, Streeck H, Kelleher AD, Markowitz M, Jessen H, Rosenberg E, Altfeld M, Harrigan PR, Heckerman D, Walker BD, Allen TM. 2010. Early selection in Gag by protective HLA alleles contributes to reduced HIV-1 replication capacity that may be largely compensated for in chronic infection. J. Virol. 84:11937–11949 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45. Zuniga R, Lucchetti A, Galvan P, Sanchez S, Sanchez C, Hernandez A, Sanchez H, Frahm N, Linde CH, Hewitt HS, Hildebrand W, Altfeld M, Allen TM, Walker BD, Korber BT, Leitner T, Sanchez J, Brander C. 2006. Relative dominance of Gag p24-specific cytotoxic T lymphocytes is associated with human immunodeficiency virus control. J. Virol. 80:3122–3125 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Cullinane J. 2005. Tainted blood and vengeful spirits: the legacy of Japan's yakugai eizu (AIDS) trial. Cult. Med. Psychiatry 29:5–31 [DOI] [PubMed] [Google Scholar]
  • 47. Haas GJ. 1995. “Yakugai” AIDS and the Yokohama Xth international AIDS conference. Common Factor 1:22. [PubMed] [Google Scholar]
  • 48. Miura T, Brockman MA, Brumme CJ, Brumme ZL, Carlson JM, Pereyra F, Trocha A, Addo MM, Block BL, Rothchild AC, Baker BM, Flynn T, Schneidewind A, Li B, Wang YE, Heckerman D, Allen TM, Walker BD. 2008. Genetic characterization of human immunodeficiency virus type 1 in elite controllers: lack of gross genetic defects or common amino acid changes. J. Virol. 82:8422–8430 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Miura T, Brockman MA, Schneidewind A, Lobritz M, Pereyra F, Rathod A, Block BL, Brumme ZL, Brumme CJ, Baker B, Rothchild AC, Li B, Trocha A, Cutrell E, Frahm N, Brander C, Toth I, Arts EJ, Allen TM, Walker BD. 2009. HLA-B57/B*5801 human immunodeficiency virus type 1 elite controllers select for rare gag variants associated with reduced viral replication capacity and strong cytotoxic T-lymphocyte [corrected] recognition. J. Virol. 83:2743–2755 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 50. Brockman MA, Tanzi GO, Walker BD, Allen TM. 2006. Use of a novel GFP reporter cell line to examine replication capacity of CXCR4- and CCR5-tropic HIV-1 by flow cytometry. J. Virol. Methods 131:134–142 [DOI] [PubMed] [Google Scholar]
  • 51. Schneidewind A, Brockman MA, Sidney J, Wang YE, Chen H, Suscovich TJ, Li B, Adam RI, Allgaier RL, Mothe BR, Kuntzen T, Oniangue-Ndza C, Trocha A, Yu XG, Brander C, Sette A, Walker BD, Allen TM. 2008. Structural and functional constraints limit options for cytotoxic T-lymphocyte escape in the immunodominant HLA-B27-restricted epitope in human immunodeficiency virus type 1 capsid. J. Virol. 82:5594–5605 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Carlson JM, Listgarten J, Pfeifer N, Tan V, Kadie C, Walker BD, Ndung'u T, Shapiro R, Frater J, Brumme ZL, Goulder PJ, Heckerman D. 2012. Widespread impact of HLA restriction on immune control and escape pathways of HIV-1. J. Virol. 86:5230–5243 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Carlson JM, Brumme ZL, Rousseau CM, Brumme CJ, Matthews P, Kadie C, Mullins JI, Walker BD, Harrigan PR, Goulder PJ, Heckerman D. 2008. Phylogenetic dependency networks: inferring patterns of CTL escape and codon covariation in HIV-1 Gag. PLoS Comput. Biol. 4:e1000225 doi:10.1371/journal.pcbi.1000225 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Storey JD, Tibshirani R. 2003. Statistical significance for genomewide studies. Proc. Natl. Acad. Sci. U. S. A. 100:9440–9445 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 55. Blaak H, Brouwer M, Ran LJ, de Wolf F, Schuitemaker H. 1998. In vitro replication kinetics of human immunodeficiency virus type 1 (HIV-1) variants in relation to virus load in long-term survivors of HIV-1 infection. J. Infect. Dis. 177:600–610 [DOI] [PubMed] [Google Scholar]
  • 56. Campbell TB, Schneider K, Wrin T, Petropoulos CJ, Connick E. 2003. Relationship between in vitro human immunodeficiency virus type 1 replication rate and virus load in plasma. J. Virol. 77:12105–12112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 57. Lassen KG, Lobritz MA, Bailey JR, Johnston S, Nguyen S, Lee B, Chou T, Siliciano RF, Markowitz M, Arts EJ. 2009. Elite suppressor-derived HIV-1 envelope glycoproteins exhibit reduced entry efficiency and kinetics. PLoS Pathog. 5:e1000377 doi:10.1371/journal.ppat.1000377 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Troyer RM, Collins KR, Abraha A, Fraundorf E, Moore DM, Krizan RW, Toossi Z, Colebunders RL, Jensen MA, Mullins JI, Vanham G, Arts EJ. 2005. Changes in human immunodeficiency virus type 1 fitness and genetic diversity during disease progression. J. Virol. 79:9006–9018 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 59. Quinones-Mateu ME, Ball SC, Marozsan AJ, Torre VS, Albright JL, Vanham G, van Der Groen G, Colebunders RL, Arts EJ. 2000. A dual infection/competition assay shows a correlation between ex vivo human immunodeficiency virus type 1 fitness and disease progression. J. Virol. 74:9222–9233 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 60. Adachi A, Gendelman HE, Koenig S, Folks T, Willey R, Rabson A, Martin MA. 1986. Production of acquired immunodeficiency syndrome-associated retrovirus in human and nonhuman cells transfected with an infectious molecular clone. J. Virol. 59:284–291 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 61. Amiel C, Charpentier C, Desire N, Bonnard P, Lebrette MG, Weiss L, Pialoux G, Schneider V. 2011. Long-term follow-up of 11 protease inhibitor (PI)-naive and PI-treated HIV-infected patients harbouring virus with insertions in the HIV-1 protease gene. HIV Med. 12:138–144 [DOI] [PubMed] [Google Scholar]
  • 62. Barbour JD, Wrin T, Grant RM, Martin JN, Segal MR, Petropoulos CJ, Deeks SG. 2002. Evolution of phenotypic drug susceptibility and viral replication capacity during long-term virologic failure of protease inhibitor therapy in human immunodeficiency virus-infected adults. J. Virol. 76:11104–11112 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 63. Ho SK, Coman RM, Bunger JC, Rose SL, O'Brien P, Munoz I, Dunn BM, Sleasman JW, Goodenow MM. 2008. Drug-associated changes in amino acid residues in Gag p2, p7(NC), and p6(Gag)/p6(Pol) in human immunodeficiency virus type 1 (HIV-1) display a dominant effect on replicative fitness and drug response. Virology 378:272–281 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 64. Martinez-Picado J, Savara AV, Sutton L, D'Aquila RT. 1999. Replicative fitness of protease inhibitor-resistant mutants of human immunodeficiency virus type 1. J. Virol. 73:3744–3752 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 65. Sune C, Brennan L, Stover DR, Klimkait T. 2004. Effect of polymorphisms on the replicative capacity of protease inhibitor-resistant HIV-1 variants under drug pressure. Clin. Microbiol. Infect. 10:119–126 [DOI] [PubMed] [Google Scholar]
  • 66. van Maarseveen NM, Andersson D, Lepsik M, Fun A, Schipper PJ, de Jong D, Boucher CA, Nijhuis M. 2012. Modulation of HIV-1 Gag NC/p1 cleavage efficiency affects protease inhibitor resistance and viral replicative capacity. Retrovirology 9:29 doi:10.1186/1742-4690-9-29 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 67. Zennou V, Mammano F, Paulous S, Mathez D, Clavel F. 1998. Loss of viral fitness associated with multiple Gag and Gag-Pol processing defects in human immunodeficiency virus type 1 variants selected for resistance to protease inhibitors in vivo. J. Virol. 72:3300–3306 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 68. Ikeda-Moore Y, Tomiyama H, Ibe M, Oka S, Miwa K, Kaneko Y, Takiguchi M. 1998. Identification of a novel HLA-A24-restricted cytotoxic T-lymphocyte epitope derived from HIV-1 Gag protein. AIDS 12:2073–2074 [DOI] [PubMed] [Google Scholar]
  • 69. Dorrell L, Dong T, Ogg GS, Lister S, McAdam S, Rostron T, Conlon C, McMichael AJ, Rowland-Jones SL. 1999. Distinct recognition of non-clade B human immunodeficiency virus type 1 epitopes by cytotoxic T lymphocytes generated from donors infected in Africa. J. Virol. 73:1708–1714 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 70. Arien KK, Vanham G, Arts EJ. 2007. Is HIV-1 evolving to a less virulent form in humans? Nat. Rev. Microbiol. 5:141–151 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 71. Mullins JI, Jensen MA. 2006. Evolutionary dynamics of HIV-1 and the control of AIDS. Curr. Top. Microbiol. Immunol. 299:171–192 [DOI] [PubMed] [Google Scholar]
  • 72. Webber MP, Schoenbaum EE, Gourevitch MN, Buono D, Chang CJ, Klein RS. 1998. Temporal trends in the progression of human immunodeficiency virus disease in a cohort of drug users. Epidemiology 9:613–617 [PubMed] [Google Scholar]
  • 73. O'Brien TR, Hoover DR, Rosenberg PS, Chen B, Detels R, Kingsley LA, Phair J, Saah AJ. 1995. Evaluation of secular trends in CD4+ lymphocyte loss among human immunodeficiency virus type 1 (HIV-1)-infected men with known dates of seroconversion. Am. J. Epidemiol. 142:636–642 [DOI] [PubMed] [Google Scholar]
  • 74. Hessol NA, Koblin BA, van Griensven GJ, Bacchetti P, Liu JY, Stevens CE, Coutinho RA, Buchbinder SP, Katz MH. 1994. Progression of human immunodeficiency virus type 1 (HIV-1) infection among homosexual men in hepatitis B vaccine trial cohorts in Amsterdam, New York City, and San Francisco, 1978-1991. Am. J. Epidemiol. 139:1077–1087 [DOI] [PubMed] [Google Scholar]
  • 75. Taylor JM, Kuo JM, Detels R. 1991. Is the incubation period of AIDS lengthening? J. Acquir. Immune Defic. Syndr. 4:69–75 [PubMed] [Google Scholar]
  • 76. Gail MH, Rosenberg PS, Goedert JJ. 1990. Therapy may explain recent deficits in AIDS incidence. J. Acquir. Immune Defic. Syndr. 3:296–306 [PubMed] [Google Scholar]
  • 77. Herbeck JT, Muller V, Maust BS, Ledergerber B, Torti C, Di Giambenedetto S, Gras L, Gunthard HF, Jacobson LP, Mullins JI, Gottlieb GS. 2012. Is the virulence of HIV changing? A meta-analysis of trends in prognostic markers of HIV disease progression and transmission. AIDS 26:193–205 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 78. Gras L, Jurriaans S, Bakker M, van Sighem A, Bezemer D, Fraser C, Lange J, Prins JM, Berkhout B, de Wolf F. 2009. Viral load levels measured at set-point have risen over the last decade of the HIV epidemic in the Netherlands. PLoS One 4:e7365 doi:10.1371/journal.pone.0007365 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 79. Crum-Cianflone N, Eberly L, Zhang Y, Ganesan A, Weintrob A, Marconi V, Barthel RV, Fraser S, Agan BK, Wegner S. 2009. Is HIV becoming more virulent? Initial CD4 cell counts among HIV seroconverters during the course of the HIV epidemic: 1985-2007. Clin. Infect. Dis. 48:1285–1292 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 80. Sinicco A, Fora R, Raiteri R, Sciandra M, Bechis G, Calvo MM, Gioannini P. 1997. Is the clinical course of HIV-1 changing? Cohort study. BMJ 314:1232–1237 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 81. Dorrucci M, Phillips AN, Longo B, Rezza G. 2005. Changes over time in post-seroconversion CD4 cell counts in the Italian HIV-Seroconversion Study: 1985-2002. AIDS 19:331–335 [PubMed] [Google Scholar]
  • 82. Dorrucci M, Rezza G, Porter K, Phillips A. 2007. Temporal trends in postseroconversion CD4 cell count and HIV load: the Concerted Action on Seroconversion to AIDS and Death in Europe Collaboration, 1985-2002. J. Infect. Dis. 195:525–534 [DOI] [PubMed] [Google Scholar]
  • 83. Muller V, Maggiolo F, Suter F, Ladisa N, De Luca A, Antinori A, Sighinolfi L, Quiros-Roldan E, Carosi G, Torti C. 2009. Increasing clinical virulence in two decades of the Italian HIV epidemic. PLoS Pathog. 5:e1000454 doi:10.1371/journal.ppat.1000454 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 84. Crum-Cianflone NF, Ren Q, Eberly LE, Ganesan A, Weintrob A, Marconi V, Barthel RV, Agan BK. 2010. Are HIV-positive persons progressing faster after diagnosis over the epidemic? J. Acquir. Immune Defic. Syndr. 54:e6–e7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 85. Potard V, Weiss L, Lamontagne F, Rouveix E, Beck-Wirth G, Drogoul-Vey MP, Souala MF, Costagliola D. 2009. Trends in post-infection CD4 cell counts and plasma HIV-1 RNA levels in HIV-1-infected patients in France between 1997 and 2005. J. Acquir. Immune Defic. Syndr. 52:422–426 [DOI] [PubMed] [Google Scholar]
  • 86. Miller MD, Anton KE, Mulato AS, Lamy PD, Cherrington JM. 1999. Human immunodeficiency virus type 1 expressing the lamivudine-associated M184V mutation in reverse transcriptase shows increased susceptibility to adefovir and decreased replication capability in vitro. J. Infect. Dis. 179:92–100 [DOI] [PubMed] [Google Scholar]
  • 87. Yoshimura K, Feldman R, Kodama E, Kavlick MF, Qiu YL, Zemlicka J, Mitsuya H. 1999. In vitro induction of human immunodeficiency virus type 1 variants resistant to phosphoralaninate prodrugs of Z-methylenecyclopropane nucleoside analogues. Antimicrob. Agents Chemother. 43:2479–2483 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 88. Julias JG, Boyer PL, McWilliams MJ, Alvord WG, Hughes SH. 2004. Mutations at position 184 of human immunodeficiency virus type-1 reverse transcriptase affect virus titer and viral DNA synthesis. Virology 322:13–21 [DOI] [PubMed] [Google Scholar]
  • 89. Frost SD, Nijhuis M, Schuurman R, Boucher CA, Brown AJ. 2000. Evolution of lamivudine resistance in human immunodeficiency virus type 1-infected individuals: the relative roles of drift and selection. J. Virol. 74:6262–6268 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 90. Antinori A, Liuzzi G, Cingolani A, Bertoli A, Di Giambenedetto S, Trotta MP, Rizzo MG, Girardi E, De Luca A, Perno CF. 2001. Drug-resistant mutants of HIV-1 in patients exhibiting increasing CD4 cell count despite virological failure of highly active antiretroviral therapy. AIDS 15:2325–2327 [DOI] [PubMed] [Google Scholar]
  • 91. Devereux HL, Emery VC, Johnson MA, Loveday C. 2001. Replicative fitness in vivo of HIV-1 variants with multiple drug resistance-associated mutations. J. Med. Virol. 65:218–224 [DOI] [PubMed] [Google Scholar]
  • 92. Itoh Y, Mizuki N, Shimada T, Azuma F, Itakura M, Kashiwase K, Kikkawa E, Kulski JK, Satake M, Inoko H. 2005. High-throughput DNA typing of HLA-A, -B, -C, and -DRB1 loci by a PCR-SSOP-Luminex method in the Japanese population. Immunogenetics 57:717–729 [DOI] [PubMed] [Google Scholar]
  • 93. Koga M, Kawana-Tachikawa A, Heckerman D, Odawara T, Nakamura H, Koibuchi T, Fujii T, Miura T, Iwamoto A. 2010. Changes in impact of HLA class I allele expression on HIV-1 plasma virus loads at a population level over time. Microbiol. Immunol. 54:196–205 [DOI] [PubMed] [Google Scholar]
  • 94. Cilliers T, Nhlapo J, Coetzer M, Orlovic D, Ketas T, Olson WC, Moore JP, Trkola A, Morris L. 2003. The CCR5 and CXCR4 coreceptors are both used by human immunodeficiency virus type 1 primary isolates from subtype C. J. Virol. 77:4449–4456 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 95. Reeves JD, Gallo SA, Ahmad N, Miamidian JL, Harvey PE, Sharron M, Pohlmann S, Sfakianos JN, Derdeyn CA, Blumenthal R, Hunter E, Doms RW. 2002. Sensitivity of HIV-1 to entry inhibitors correlates with envelope/coreceptor affinity, receptor density, and fusion kinetics. Proc. Natl. Acad. Sci. U. S. A. 99:16249–16254 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 96. Arien KK, Gali Y, El-Abdellati A, Heyndrickx L, Janssens W, Vanham G. 2006. Replicative fitness of CCR5-using and CXCR4-using human immunodeficiency virus type 1 biological clones. Virology 347:65–74 [DOI] [PubMed] [Google Scholar]

Articles from Journal of Virology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES