Skip to main content
PMC home page
Wiley Open Access Collection logoLink to Wiley Open Access Collection
. 2012 Oct 19;337(1):61–72. doi: 10.1111/1574-6968.12010

Comparison of dkgB-linked intergenic sequence ribotyping to DNA microarray hybridization for assigning serotype to Salmonella enterica

Jean Guard 1, Roxana Sanchez-Ingunza 1, Cesar Morales 1, Tod Stewart 1, Karen Liljebjelke 1, JoAnn Kessel 2, Kim Ingram 1, Deana Jones 1, Charlene Jackson 1, Paula Fedorka-Cray 1, Jonathan Frye 1, Richard Gast 1, Arthur Hinton Jr 1
Editor: David Studholme
PMCID: PMC3558799  PMID: 22998607

Abstract

Two DNA-based methods were compared for the ability to assign serotype to 139 isolates of Salmonella enterica ssp. I. Intergenic sequence ribotyping (ISR) evaluated single nucleotide polymorphisms occurring in a 5S ribosomal gene region and flanking sequences bordering the gene dkgB. A DNA microarray hybridization method that assessed the presence and the absence of sets of genes was the second method. Serotype was assigned for 128 (92.1%) of submissions by the two DNA methods. ISR detected mixtures of serotypes within single colonies and it cost substantially less than Kauffmann–White serotyping and DNA microarray hybridization. Decreasing the cost of serotyping S. enterica while maintaining reliability may encourage routine testing and research.

Keywords: epidemiology, food safety, single nucleotide polymorphism

Introduction

Serotyping of Salmonella enterica ssp. I is the basis of national and international surveillance and communications, it facilitates determining associations between the pathogen and sources, and it gives some guidance in regards to preventing transmission (P. Fields, pers. commun.) (Foodnet, 2011). The historical method used to serotype S. enterica is the antibody-based Kauffman–White (KW) scheme (Kauffman & Edwards, 1952; Brenner et al., 2000). Positive results generate an antigenic formula based on structural details of the H-antigen of flagella and the O-antigen of lipopolysaccharide (H- and O-antigens, respectively) (Bopp et al., 1999; Popoff & Le Minor, 2001).

A major advantage of DNA analysis is that it is not impacted by variable expression of cell-surface antigens as are antibody-based agglutination assays like the KW scheme. Major obstacles to genome typing of S. enterica becoming broadly available include expense, the need for highly specialized equipment, and in some cases, sophisticated bioinformatics (Wattiau et al., 2011). A DNA-based method for assigning serotype to S. enterica at comparatively low cost and with readily accessible laboratory equipment commonly used for culturing and conducting the polymerase chain reaction (PCR) would be beneficial. A discrete region within S. enterica ssp. I was previously shown to differentiate closely related serotypes (Morales et al., 2006). The region of interest spans from the end of a 23S ribosomal gene, across a 5S gene and includes the last base pair preceding a tRNA aspU ribosomal gene neighboring dkgB (previously yafB) (Fig. 1). We wanted to know if dkgB-linked intergenic sequence ribotyping (ISR) would assign serotype similarly to an AOAC International certified DNA microarray hybridization method (DNAhyb) (Check & Trace by Checkpoints, Certificate 121001) (Malorny et al., 2003; Wattiau et al., 2008; Madajczak & Szych, 2010). The set of isolates examined were previously assigned a KW serotype and this historical information is included.

Fig. 1.

Fig. 1

Open in a new tab

Description of the ISR region within the genome of Salmonella enterica serovar Enteritidis strain P125109 (GenBank AM933172). The nucleotide sequence of each ISR is serotype specific and size ranges from 257 to 530 bp. Sequence is required to assign serotype to a submission. An ISR region includes sequence from the end of the rrlH gene (rRNA-23S ribosomal gene) and the start of the aspU (tRNA-Asp) gene that is adjacent to the dkgB gene.

Materials and methods

Salmonella enterica submissions included for analysis

The investigators providing the submissions listed in Table 1 reported serotype. In this laboratory, cultures were streaked on brilliant green (BG) agar (Acumedia; Neogen Corporation, Lansing, MI) and incubated for 24–48 h at 37 °C to obtain well-separated large colonies. One colony was then transferred to brain heart infusion (BHI) broth (Acumedia) and incubated for 16 h at 37 °C with shaking. For submissions that later appeared to have mixed cultures and for those with disagreement between methods, agglutination reactions for single colonies using commercially available absorbed antisera (Difco, BD, Franklin Lakes, NJ) were carried out, and in some cases, isolates were submitted for serotyping (Silliker, South Holland, IL). Thus, single colonies were processed by both ISR and DNAhyb (Check & Trace, Check Points, Wageningen, the Netherlands). In cases of disagreement between methods, a maximum of 10 well-isolated colonies were selected from agar plates and then transferred to BHI broth for individual analysis.

Table 1.

Serotype of Salmonella enterica ssp. I as determined by the KW scheme, DNAhyb, and dkgB-linked ISR

Accession Number KW scheme DNAhyb ISR ISR size Supplier Source Locality Category
(a) Submissions with agreement between DNA-based genomic methods DNAhyb and ISR, and with no conflict to serotype as reported using the KW scheme [115]
 21027 Enteritidis Enteritidis 2994.G Enteritidis 499 ESQRU, ARS, USDA Mouse spleen Northeast US TP
 21046 Enteritidis Enteritidis 2994.G Enteritidis 499 ESQRU, ARS, USDA Mouse spleen Northeast US TP
 22079 Enteritidis Enteritidis 2994.G Enteritidis 499 UC Creek California TP
 23023 Pullorum Gallinarum Pullorum 2978.H Pullorum 361 ESQRU, ARS, USDA Unknown Unknown TP
 24018 Newport Newport 12427 Newport 498 NVSL Unknown Unknown TP
 25001 Agona Agona 7205 Agona 498 SGSC Unknown Peru TP
 25006 Choleraesuis Choleraesuis or Paratyphi C 13545 Cholerasuis 499 SGSC Unknown Thailand TP
 25012 Dublin Dublin (probability 99.92%) 2488 Dublin 499 SGSC Cattle Idaho TP
 25013 Dublin Dublin (probability 99.92%) 2488 Dublin 499 SGSC Bovine France TP
 25021 Gallinarum Gallinarum Gallinarum 2978 Gallinarum 498 SGSC Human Connecticut TP
 25026 Infantis Infantis 9381 Infantis_2 500 SGSC Human North Carolina TN
 25030 Montevideo Montevideo 6690 Montevideo_1 362 SGSC Human Georgia TP
 25031 Montevideo Montevideo 6702 Montevideo_2 361 SGSC Human Florida TP
 25042 Paratyphi A Paratyphi A 14413 Paratyphi A 498 SGSC Unknown Unknown TP
 25049 Paratyphi C Choleraesuis or Paratyphi C 13545 Paratyphi C 395 SGSC Human France TP
 25052 Pullorum Gallinarum Pullorum 2978.H Pullorum 361 SGSC Unknown Germany TP
 25063 Typhi Typhi 7241 Typhi 267 SGSC Unknown Dakar TP
 25064 Typhi Typhi 7241 Typhi 267 SGSC Unknown Dakar TP
 26022 Cerro Cerro 4237 Cerro 361 EMSFL, ARS, USDA Fecal (dairy cow) Unknown TP
 26023 Cerro Cerro 4237 Cerro 361 EMSFL, ARS, USDA Lung (dairy cow) Unknown TP
 26024 Cerro Cerro 4237 Cerro 361 EMSFL, ARS, USDA Fecal (dairy cow) Unknown TP
 26028 Oranienburg Oranienburg 6717 r Oranienburg 365 EMSFL, ARS, USDA Fecal (dairy cow) Unknown TP
 26029 Oranienburg Oranienburg 6717 Oranienburg 365 EMSFL, ARS, USDA Fecal (dairy cow) Unknown TP
 26030 Typhimurium 5- Typhimurium 10909 Typhimurium 498 EMSFL, ARS, USDA Fecal (dairy cow) Unknown TP
 26039 Montevideo Montevideo 6702 Montevideo_3 362 EMSFL, ARS, USDA Milk Unknown TN
 26050 Agona Agona 7205 Agona 498 EMSFL, ARS, USDA Fecal (dairy cow) Unknown TP
 26080 Agona Agona 7205 Agona 498 EMSFL, ARS, USDA Fecal (dairy cow) Unknown TP
 29047 Typhimurium Typhimurium 10909 Typhimurium 498 ESQRU, ARS, USDA Unknown Unknown TP
 29054 Typhimurium Typhimurium 10909 Typhimurium 498 ESQRU, ARS, USDA Unknown Unknown TP
 29056 Typhimurium Typhimurium 10909 Typhimurium 498 ESQRU, ARS, USDA Unknown Unknown TP
 29096 Schwarzengrund Schwarzen. or Grumpensis 14909.B Schwarzengrund 257 PPSPR, ARS, USDA Scalder tank water Georgia TP
 99113 Pullorum Gallinarum Pullorum 2978.H Pullorum 361 CFIA Chicken House Unknown TP
 99117 Gallinarum Gallinarum Gallinarum 2978 Gallinarum 498 CFIA Chicken House Unknown TP
 99163 Typhimurium 5- Typhimurium 10909 Typhimurium 498 USDA, ARS, TX Pigeon Unknown TP
 99164 Typhimurium 5- Typhimurium 10909 Typhimurium 498 ESQRU, ARS, USDA Unknown Unknown TP
 99172 Typhimurium 5- Typhimurium 10909 Typhimurium 498 USDA, ARS Pigeon Unknown TP
100304.05 Kentucky Kentucky 10299 Kentucky 492 PPSPR, ARS, USDA Carcass rinse Georgia TP
100304.07 Kentucky Kentucky 10299 Kentucky 492 PPSPR, ARS, USDA Carcass rinse Georgia TP
100304.08 Kentucky Kentucky 10299 Kentucky 492 PPSPR, ARS, USDA Scalder tank foam Georgia TP
100304.19 1,4,[5],12:i:- 1,4,[5],12:i:- 2717 1,4,[5],12:i:- 498 PPSPR, ARS, USDA Carcass rinse Georgia TP
100304.32 Typhimurium 5- Typhimurium 10909 Typhimurium 498 PPSPR, ARS, USDA Carcass rinse Georgia TP
100304.43 Heidelberg Heidelberg 15835 Heidelberg 498 PPSPR, ARS, USDA Carcass rinse Georgia TP
100304.48 Heidelberg Heidelberg 15835 Heidelberg 498 PPSPR, ARS, USDA Carcass rinse Georgia TP
100304.52 Heidelberg Heidelberg 15835 Heidelberg 498 PPSPR, ARS, USDA Carcass rinse Georgia TP
100304.57 Typhimurium 5- Typhimurium 10909 Typhimurium 498 PPSPR, ARS, USDA Carcass rinse Georgia TP
100304.63 Typhimurium 5- Typhimurium 10909 Typhimurium 498 PPSPR, ARS, USDA Carcass rinse Georgia TP
100304.69 Thompson Thompson 14415 Thompson 259 PPSPR, ARS, USDA Carcass rinse Georgia TP
100304.74 Senftenberg Senftenberg 2156 Senftenberg 362 PPSPR, ARS, USDA Carcass rinse Georgia TP
100304.75 Senftenberg Schwarzen. or Grumpensis 14909.B Schwarzengrund 257 PPSPR, ARS, USDA Carcass rinse Georgia TP
100304.76 Senftenberg Schwarzen. or Grumpensis 14909.B Schwarzengrund 257 PPSPR, ARS, USDA Carcass rinse Georgia TP
100304.78 Thompson Thompson 14415 Thompson 259 PPSPR, ARS, USDA Carcass rinse Georgia TP
100304.79 Thompson Thompson 14415 Thompson 259 PPSPR, ARS, USDA Carcass rinse Georgia TP
100616.101 Kentucky Kentucky 10299 Kentucky 492 PPSPR, ARS, USDA Carcass rinse Georgia TP
100616.87 1,4,[5],12:i:- 1,4,[5],12:i:- 2717 1,4,[5],12:i:- 498 PPSPR, ARS, USDA Scalder tank foam Georgia TP
100616.89 Typhimurium Typhimurium 10909 Typhimurium 498 PPSPR, ARS, USDA Carcass rinse Georgia TP
100616.9 Typhimurium 5- Typhimurium 10909 Typhimurium 498 PPSPR, ARS, USDA Carcass rinse Georgia TP
100616.91 Typhimurium Typhimurium 10909 Typhimurium 498 PPSPR, ARS, USDA Carcass rinse Georgia TP
100709.01 Kentucky Kentucky 10299 Kentucky 492 PPSPR, ARS, USDA Carcass rinse Georgia TP
100709.02 Kentucky Kentucky 10299 Kentucky 492 PPSPR, ARS, USDA Carcass rinse Georgia TP
100709.03 Kentucky Kentucky 10299 Kentucky 492 PPSPR, ARS, USDA Carcass rinse Georgia TP
100709.04 Kentucky Kentucky 10299 Kentucky 492 PPSPR, ARS, USDA Carcass rinse Georgia TP
100709.05 Senftenberg Senftenberg 2156 Senftenberg 362 PPSPR, ARS, USDA Carcass rinse Georgia TP
100709.09 Heidelberg Heidelberg 15835 Heidelberg 498 PPSPR, ARS, USDA Scalder tank foam Georgia TP
100721.01-2 1,4,[5],12:i:- 1,4,[5],12:i:- 2717 1,4,[5],12:i:- 498 PPSPR, ARS, USDA Scalder tank water Georgia TP
100721.02 Infantis Infantis 9381 Infantis_1 500 PPSPR, ARS, USDA Carcass rinse Georgia TP
100721.05 Typhimurium Typhimurium 10909 Typhimurium 498 PPSPR, ARS, USDA Carcass rinse Georgia TP
100723.09 Enteritidis Enteritidis 2994.G Enteritidis 499 PPSPR, ARS, USDA Carcass rinse Georgia TP
100304.10 1,4,[5],12:i:- 1,4,[5],12:i:- 2717 1,4,[5],12:i:- 498 PPSPR, ARS, USDA Carcass rinse Georgia TP
100304.50 Heidelberg Heidelberg 15835 Heidelberg 498 PPSPR, ARS, USDA Carcass rinse Georgia TP
100709.10 Thompson Thompson 14415 Thompson 259 PPSPR, ARS, USDA Scalder dip tank foam Georgia TP
100723.10 Enteritidis Enteritidis 2994.G Enteritidis 499 PPSPR, ARS, USDA Scalder dip tank foam Georgia TP
100304.58-2 Kentucky Kentucky 10299 Kentucky 492 PPSPR, ARS, USDA Scalder tank foam Georgia TP
100304.62-2 Typhimurium 5- Typhimurium 10909 Typhimurium 498 PPSPR, ARS, USDA Scalder dip tank foam Georgia TP
100616.86-2 Typhimurium Typhimurium 10909 Typhimurium 498 PPSPR, ARS, USDA Carcass rinse Georgia TP
100723.01-2 Kentucky Kentucky 10299 Kentucky 492 PPSPR, ARS, USDA Carcass rinse Georgia TP
100723.14-2 Schwarzengrund Schwarzen. or Grumpensis 14909.B Schwarzengrund 257 PPSPR, ARS, USDA Carcass rinse Georgia TP
100723.02-2 Heidelberg Heidelberg 15835 Heidelberg 498 PPSPR, ARS, USDA Scalder tank foam Georgia TP
 25010 Derby Derby 50 Derby 498 SGSC Swine Minnesota TP
 25032 Muenchen Muenchen 11942 Muenchen 404 SGSC Unknown Unknown TP
 25039 Panama Panama 14909 Panama 362 SGSC Unknown Italy TP
 26063 Mbandaka Mbandaka 11813.C Mbandaka 499 EMSFL, ARS, USDA Fecal (dairy cow) Unknown TP
 26066 Mbandaka Mbandaka 11813.C Mbandaka 499 EMSFL, ARS, USDA Fecal (dairy cow) Unknown TP
100616.100 Rough Infantis 9381 Infantis_1 500 PPSPR, ARS, USDA Carcass rinse Georgia TP
100616.102 Rough Enteritidis 2866.G Enteritidis 499 PPSPR, ARS, USDA Scalder tank water Georgia TP
100616.84 Rough Typhimurium 10909 Typhimurium 498 PPSPR, ARS, USDA Carcass rinse Georgia TP
100616.97 Rough Typhimurium 10909 Typhimurium 498 PPSPR, ARS, USDA Carcass rinse Georgia TP
100616.99 Rough Typhimurium 10909 Typhimurium 498 PPSPR, ARS, USDA Carcass rinse Georgia TP
100709.06 Rough Senftenberg 2156 Senftenberg 362 PPSPR, ARS, USDA Carcass rinse Georgia TP
100709.07 Rough 1,4,[5],12:i:- 2717 1,4,[5],12:i:- 498 PPSPR, ARS, USDA Carcass rinse Georgia TP
100709.12 Rough Infantis 9381 Infantis_1 500 PPSPR, ARS, USDA Carcass rinse Georgia TP
100723.04 Rough Kentucky 10299 Kentucky 492 PPSPR, ARS, USDA Carcass rinse Georgia TP
100723.08 Auto agglutinator Heidelberg 15835 Heidelberg 498 PPSPR, ARS, USDA Scalder tank foam Georgia TP
100723.12 Rough Senftenberg 2156 r Senftenberg 362 PPSPR, ARS, USDA Carcass rinse Georgia TP
100723.15 Rough Schwarzen. or Grumpensis 14909.B Schwarzengrund 257 PPSPR, ARS, USDA Scalder tank water Georgia TP
 25046 Salmonella (B) Abony 5325 Abony 498 SGSC Water United Kingdom TP
 25050 Salmonella (C1) Oranienburg 6717 r Oranienburg 361 SGSC Human France TP
 29063 Salmonella (C1) Newport 13444 Newport_1 499 ESQRU, ARS, USDA Unknown Unknown TP
 29065 Salmonella (C1) Oranienburg 6717 r Oranienburg 365 ESQRU, ARS, USDA Unknown Unknown TP
 29066 Salmonella (B) Typhimurium 10909 Typhimurium 498 ESQRU, ARS, USDA Unknown Unknown TP
 29067 Salmonella (D) Enteritidis 2994.G Enteritidis 499 ESQRU, ARS, USDA Unknown Unknown TP
 25004 No O or H antigen Anatum 15087 Anatum 499 SGSC Swine Minnesota TP
 25037 Newport Newport 13519 Newport_2 395 SGSC Human Mexico TP
 25038 Newport Newport 14539 Newport_3 498 SGSC Snake Massachusetts TP
101116-10* Fresno (D2) Genovar 5216 UN0019 (D1) 258 Breeder farm Chickens Alabama or Tennessee TP
101116-12* Fresno (D2) Genovar 5216 UN0019 (D1) 258 Breeder farm Chickens Alabama or Tennessee TP
 25005 Choleraesuis Genovar 14861 UN0009 (C1) 361 SGSC Unknown Switzerland TP
 25007 Choleraesuis Genovar 11439 N UN0010 (C1) 498 SGSC Unknown Australia TP
 25017 Enteritidis Genovar 6660 UN0002 (D1) 360 SGSC Unknown Brazil TP
 25019* Enteritidis Genovar 2370 UN0003 (-) 498 SGSC Unknown Switzerland TP
 25009 Derby Genovar 6176 UN0022 (B) 498 SGSC Avian Oklahoma TP
 25014 Dublin Genovar 5324 UN0012 (D1) 498 SGSC Unknown Thailand TP
 25027 Infantis Genovar 14892 UN0023 (C1) 499 SGSC Unknown Senegal TP
 25034 Muenchen Genovar 13646 UN0036 (C2C3) 258 SGSC Human France TP
 99167 Typhimurium 5- Typhimurium 10909 Typhimurium 5- 395 USDA, ARS Pigeon Unknown TN
 99168 Typhimurium 5- Typhimurium 10909 Typhimurium 5- 395 USDA, ARS Pigeon Unknown TN
(b) Submissions with agreement between DNAhyb and ISR, but disagreeing with serotype as reported using the KW scheme [13]
 25040 Panama (D1) Javiana 12917 Javiana (D1) 367 SGSC Human North Carolina TP
 25041 Panama (D1) Javiana 12917 Javiana (D1) 367 SGSC Human North Carolina TP
 25035 Muenchen (C2) Manhattan 11706 Manhattan (C2) 396 SGSC Human North Carolina TP
 25051-1†‡ Pullorum (D1) Oranienburg 6717 r Oranienburg (-) 361 SGSC Unknown Unknown TP
 26026 Mbandaka (C1) Tennessee 2108 Tennessee (C1) 258 EMSFL, ARS, USDA Fecal (dairy cow) Unknown TP
100304.58-1†‡ Kentucky (C2C3) Typhimurium 10909 Typhimurium (B) 498 PPSPR, ARS, USDA Scalder tank foam Georgia TP
100304.62-1†‡ Typhimurium 5- (B) Schwarzen. or Grumpensis 14909.B Schwarzengrund (B) 257 PPSPR, ARS, USDA Scalder dip tank foam Georgia TP
100616.86-1†‡ Typhimurium (B) Infantis 9381 Infantis_1 (C1) 500 PPSPR, ARS, USDA Carcass rinse Georgia TP
100616.98-1† Typhimurium 5- (B) Kentucky 10299 Kentucky (C2C3) 492 PPSPR, ARS, USDA Carcass rinse Georgia TP
100721.01-1†‡ 1,4,[5],12:i:- (B) Kentucky 10299 Kentucky (C2C3) 492 PPSPR, ARS, USDA Scalder tank water Georgia TP
100304.53 Senftenberg (B) Typhimurium 10909 Typhimurium (B) 498 PPSPR, ARS, USDA Scalder tank water Georgia TP
 25011* Derby (B) Genovar 5160 UN0025 (C2C3) 498 SGSC Turkey Pennsylvania TP
 25048* Paratyphi C (C1) Genovar 14375 UN0024 (B) 499 SGSC Unknown France TP
(c) Submissions with disagreement between DNAhyb and ISR, but with DNAhyb in agreement with serotype as reported by the KW scheme [11]
 25036 Newport Newport 13444 UN0034 498 SGSC Human North Carolina FP
 25043-2 Paratyphi B (B) Paratyphi B (possibly Java) 13383 UN0015 498 SGSC Unknown Unknown FP
 25044 Paratyphi B (B) Paratyphi B (possibly Java) 13383 UN0011 499 SGSC Food Middle East FP
 25051-2 Pullorum (D1) Gallinarum Pullorum 2978.H UN0008 530 SGSC Unknown Unknown FP
 25057 Schwarzengrund Schwarzen. or Grumpensis 14909.B UN0006 365 SGSC Unknown Scotland FP
 26078 Kentucky Kentucky (10791) 6 UN0028 499 EMSFL, ARS, USDA Fecal (dairy cow) Unknown FP
101116-14 Javiana Javiana 12917 UN0007 361 Breeder farm Chickens Alabama or Tennessee FP
 25043-1†‡ Paratyphi B (B) Paratyphi B (possibly Java) 13383 Javiana (D1) 367 SGSC Unknown Unknown TN
100723.01-1†‡ Heidelberg (B) Heidelberg 15835 Kentucky (C2C3) 498 PPSPR, ARS, USDA Carcass rinse Georgia TN
100723.02-1†‡ Heidelberg (B) Heidelberg 15835 Kentucky (C2C3) 492 PPSPR, ARS, USDA Scalder tank foam Georgia TN
100723.14-1†‡ Kentucky (C2C3) Kentucky 10299 Schwarzengrund (B) 492 PPSPR, ARS, USDA Carcass rinse Georgia TN
Open in a new tab
*

O-antigen immunoreactivity group of KW scheme did not match ISR results, but O-antigens D1 and D2 are cross-reactive.

†

Submissions with hyphenation with numerical extension (-1) were classified as potentially containing a mixture of at least two serotypes as evidenced by forward/reverse ISR sequences that did not match when first evaluated. If a second serotype was isolated, it has extension -2 and is listed elsewhere in the table.

‡

Mixtures of serotypes were confirmed by processing at least 10 CFU.

Determination of ISR

The locations where primers hybridize the reference genome in S. enterica ssp. I Enteritidis strain P125109 are shown in Fig. 1. Forward (ISR-F1) and reverse (ISR-R1) primers incorporate the rRNA-23S ribosomal ribose nucleic acid (RNA) region neighboring dkgB (previously known as yafB). Reference genomes and primers used in these analyses are listed in Tables 2 and 3. Primers ISR-F1 and ISR-R1 replaced previously published primers ISRH-1 and ISRH-2 (Morales et al., 2006).

Table 2.

Reference ISR sequences available in public databases for Salmonella enterica ssp. I

Serotype designation ISR size (bp) Refseq GenBank accession
(a) Genome sequences used to obtain ISRs for Salmonella enterica ssp. I at The National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/)
 4,[5],12:i:- str. CVM23701 498 NZ_ABAO00000000 ABAO00000000
 Agona str. SL483 498 NZ_ABEK00000000 ABEK00000000
 Choleraesuis str. SC-B67 499 NC_006905 AE017220
 Dublin str. CT_02021853 499 NZ_ABAP00000000 ABAP00000000
 Heidelberg str. SL476 498 NC_011083 CP001120
 Heidelberg str. SL486 498 NZ_ABEL00000000 ABEL00000000
 Javiana str. GA_MM04042433 367 NZ_ABEH00000000 ABEH00000000
 Kentucky str. CDC 191 492 NZ_ABEI00000000 ABEI00000000
 Kentucky str. CVM29188 492 NZ_ABAK00000000 ABAK00000000
 Newport str. SL254 492 NC_011080 CP000604
 Newport str. SL317 492 NZ_ABEW00000000 ABEW00000000
 Paratyphi A str. ATCC 9150 498 NC_006511 CP000026
 Paratyphi B SPB7 498 NC_010102.1 CP000886
 Paratyphi C RKS4594 395 NC_012125.1 CP000857
 Saintpaul str. SARA23 498 NZ_ABAM00000000 ABAM00000000
 Saintpaul str. SARA29 498 NZ_ABAN00000000 ABAN00000000
 Schwarzengrund str. CVM19633 267 NC_011094 CP001127
 Schwarzengrund str. SL480 267 NZ_ABEJ00000000 ABEJ00000000
 Typhi Ty2 267 NC_004631 AE014613
 Typhi str. CT18 267 NC_003198 AL513382
 Typhimurium LT2 498 NC_003197 AE006468
 Virchow str. SL491 499 Not yet completed na
(b) Genome sequences used to obtain ISRs for Salmonella enterica ssp. I available at The Sanger Institute (http://www.sanger.ac.uk/Projects/Salmonella/)
 Enteritidis PT4 NCTC 13349 499 NC_011294.1 AM933172.1
 Gallinarum 287/91 NCTC 13346 498 NC_011274.1 AM933173.1
 Hadar 498 NA* NA
 Infantis 500 NA NA
 Typhimurium DT104 NCTC 13348 498 NA NA
 Typhimurium DT2 498 NA NA
 Typhimurium SL1344 NCTC 13347 498 NA NA
 Typhimurium D23580 498 NA NA
(c) ISR sequences for Salmonella enterica ssp. I submitted to the National Center for Biotechnology Information†
 Schwarzengrund_2 257 In process In process
 Cerro 361 In process JN105120
 Infantis_1 500 In process JN105121
 Oranienburg 365 In process JN105122
 Pullorum 361 In process JN105123
 Senftenberg 362 In process JN105124
 Thompson 259 In process JN105125
 Tennessee 258 BankIt1458394 SEQ_018 JN092310
 Mbandaka 499 BankIt1458394 SEQ_030 JN092322
 Montevideo_1 362 BankIt1458394 SEQ_031 JN092323
 Montevideo_2 361 BankIt1458394 SEQ_032 JN092324
 Montevideo_3 362 BankIt1458394 SEQ_033 JN092325
 Manhatten 258 BankIt1458394 SEQ_036 JN092328
 UN0001 404 BankIt1458394 SEQ_001 JN092293
 UN0002 360 BankIt1458394 SEQ_002 JN092294
 UN0003 498 BankIt1458394 SEQ_003 JN092295
 UN0004 362 BankIt1458394 SEQ_004 JN092296
 UN0005 361 BankIt1458394 SEQ_005 JN092297
 UN0006 365 BankIt1458394 SEQ_006 JN092298
 UN0007 361 BankIt1458394 SEQ_007 JN092299
 UN0008 530 BankIt1458394 SEQ_008 JN092300
 UN0009 361 BankIt1458394 SEQ_009 JN092301
 UN0010 498 BankIt1458394 SEQ_010 JN092302
 UN0011 499 BankIt1458394 SEQ_011 JN092303
 UN0012 498 BankIt1458394 SEQ_012 JN092304
 UN0013 498 BankIt1458394 SEQ_013 JN092305
 UN0014 395 BankIt1458394 SEQ_014 JN092306
 UN0015 489 BankIt1458394 SEQ_015 JN092307
 UN0016 396 BankIt1458394 SEQ_016 JN092308
 UN0017 395 BankIt1458394 SEQ_017 JN092309
 UN0019 258 BankIt1458394 SEQ_019 JN092311
 UN0021 499 BankIt1458394 SEQ_021 JN092313
 UN0022 498 BankIt1458394 SEQ_022 JN092314
 UN0023 499 BankIt1458394 SEQ_023 JN092315
 UN0024 499 BankIt1458394 SEQ_024 JN092316
 UN0025 498 BankIt1458394 SEQ_025 JN092317
 UN0026 498 BankIt1458394 SEQ_026 JN092318
 UN0027 499 BankIt1458394 SEQ_027 JN092319
 UN0028 499 BankIt1458394 SEQ_028 JN092320
 UN0034 498 BankIt1458394 SEQ_034 JN092326
 UN0035 498 BankIt1458394 SEQ_035 JN092327
Open in a new tab
*

Not available due to incomplete annotation.

†

Serotype names replace the unique accession number following multiple confirmations and agreement between methods.

Table 3.

Primers used to correlate genotype to serotype of Salmonella enterica by ISR

Primer name Orientation Primer sequence (5′–3′) Reference Amplicon size (bp)*
ISR-F1 Forward GCCAATGGCACTGCCCGGTA This study 14641
ISR-R1 Reverse TACCGTGCGCTTTCGCCCAG
ISRH-1 Forward GATGCGTTGAGCTAACCGGTACTA Morales et al. (2006) Does not apply
ISRH-2 Reverse ATTCTTCGACAGACACGGCATCAC
ISRHfs Forward GTGGAGCGGTAGTTCAGTTGGTTA Morales et al. (2006) Does not apply
ISRHrs Reverse TAACCAACTGAACTACCGCTCCAC
Open in a new tab
*

Amplicon size in S. Typhimurium str. LT2 genome (GenBank AE006468).

For primer amplification, DNA was extracted from 1 mL of pelleted cells using the PureLink Genomic DNA Mini Kit (Invitrogen Life Technologies, Grand Island, NY). One microliter of DNA was added to 2× Gene Amp Fast PCR Master Mix (Applied Biosystems, Foster City, CA) and 200 nM forward (ISR-F1) and reverse (ISR-R1) primers in a final volume of 30 μL. The PCR was performed on a Veriti 96 well Fast Thermal cycler (Applied Biosystems) as follows: 95 °C for 10 s, 35 cycles at 94 °C, 40 s at 64 °C, and 10 s at 72 °C. After confirmation of the predicted amplicon of approximately 1400 bp by gel electrophoresis, PCR products were purified using the QIAquick PCR purification kit (Qiagen, Valencia, CA). DNA concentrations were measured (NanoDrop, Wilmington, DE) prior to submitting PCR products for Sanger sequencing (Retrogen Inc., San Diego, CA) on an Applied Biosystems, Incorporated (ABI) Prism® 3730 DNA Analyzer using primers ISRHfs and ISRHfr.

Analysis and naming of ISR sequences

ISR sequences were aligned using SeqMan Pro of the Lasergene 8 software (DNASTAR, Madison, WI). Parameters were set to 100% minimum match percentage and a match size of at least 50 bp. Primers were designed to assure linkage to dkgB, which is required to assure that the correct region is under investigation. Serotype names were assigned to an ISR sequence when a 100% match was made to a reference sequence or when DNAhyb and KW serotyping agreed. Otherwise, ISR sequences are identified as ‘UN’ followed by four-digit numbers. The initial (5′ ATGTTTTGGCG 3′) and final (5′ CGGTGGAGCGG 3′) eleven nucleotides should be similar for ISRs, with the exception that the first nucleotide in the ISR sequence can sometimes be a cytosine rather than an adenine nucleotide.

DNAhyb assay

The DNAhyb protocol was performed as directed (Check & Trace) on single Salmonella colonies grown for 24–48 h on BG agar at 37 °C. Large colonies are recommended to reach the recommended DNA concentration. Images of products were obtained on a single-channel ATR03 reader and processed by the Salmonella Check-Points software which indicates a serotype name, or alternatively, a genovar number. Images of spot patterns were discussed with the manufacturer in unusual situations, such as finding genetic variants of Salmonella Kentucky. In this case, three isolates were submitted to the source of the kit for independent verification that new variants were being identified and that all positive and negative controls worked.

Results

ISR and DNAhyb assign serotype to S. enterica similarly

Details from analysis of S. enterica by ISR and DNAhyb are shown in Table 1. Of the 139 submissions, 115 (82.7%) had substantial agreement between DNAhyb and ISR, as well as the reported KW serotype (Table 1a). Some genetic variation was noted in ISRs in this grouping, but serotype association was maintained in comparison with both DNAhyb and the KW scheme and thus these were counted as agreements. Further analysis of ISR variation showed that 15 named serotypes had at least three independent submissions. Of this group, 10 (66.7%) had uniform ISRs with no variation. Five (5) serotypes had multiple ISRs, namely Salmonella Infantis (two variants), Salmonella Typhimurium (two variants), S. Kentucky (two variants), Salmonella Newport (four variants), and Salmonella Montevideo (three variants). For the purpose of determining specificity and sensitivity in this study, results with disagreement about how much variation is accounted for by DNAhyb vs. ISR were counted as true negatives (TN), because the ISR method produced information somewhat different, but not necessarily in disagreement, to DNAhyb. In summary, 128 of the 139 isolates (92.1%) had agreement between DNAhyb and ISR (Table 1b + 1a). Detail about ISR variation within a single named serotype will be discussed in following text.

For 10 submissions, the forward/reverse (F/R) sequences did not match. Individually processing multiple colonies for nine of these submissions in this category recovered a second serotype. The frequency with which a second serotype accounted for disagreement between genomic methods and KW serotype suggests that minority subpopulations are common. In addition, techniques appear to vary in their ability to detect multiple serotypes. Seven other submissions (25011, 25048, 25040, 25041, 25035, 26026, and 100304.53) had KW serotypes with O-antigens that did not match what was received for analysis but there was no disagreement in F/R sequences. In these cases, misinterpretation of the second cell-surface molecule flagella could have contributed to misinterpretation of serotype. Alternatively, these submissions could have also been mixed when initially examined for KW serotype and undergone separation of serotypes prior to analysis during the current study. For submissions 101116-10 and 101116-12, which were classified as Salmonella Fresno and ISR UN0019, O-antigen D2 epitopes would be expected to cross-react with factor 9 antisera used to detect D1 epitopes (Curd et al., 1998).

Table 1c shows paired samples with disagreement between DNAhyb and ISR. Four of these submissions yielded mixed serotypes, namely 25043-1, 100723.01-1, 100723.02-1, and 100723-14.1. They are included in Table 1c to reflect the incidence with which disagreement was encountered. However, disagreements between DNAhyb and ISR and KW were resolved for these four isolates. The other seven submissions in Table 1c had a unique (UN) ISR sequence that was identified by DNAhyb as a genovar with an available reference sequence. However, slight differences in the ISR suggested genetic variants could be present as observed for the first group in Table 1a. These submissions were grouped in Table 1c because the serovar they might be associated with could not be further verified at this time. Acquisition of more isolates is needed to resolve the relationship between KW serotype, DNAhyb and ISR sequence in these cases.

ISR appears more sensitive than DNAhyb for the detection of genetic variation within serotype

ISR appears to give a more sensitive assessment of serotype than DNAhyb. To explain further, some specific examples are cited. These are as follows:

  1. ISR sometimes detected two types of S. Typhimurium, namely Typhimurium and Typhimurium 5-, whereas DNAhyb did not (Table 1, accession numbers 100304.57, 100304.74, 100304.32, 100304.62-2, 100616.9, 99163, 99164 and 99172). Thus, DNAhyb is not currently capable of detecting the 5- variant. ISR indicated that UN0014 was linked to the Typhimurium 5- KW serotype, but this correlation was not observed for all examples (see 100304.62-2). Thus, variation in expression of cell-surface epitopes may account for the 5- variant in addition to genetic variation as observed by ISR.

  2. Only one publicly available reference sequence out of 27 disagreed with assignment of serotyping by the three methods. The ISRs for the reference sequences of S. Schwarzengrund NC_011094 and NZ_ABEJ00000000 were 267 bp and no SNP differences were present. The strains of S. Schwarzengrund analyzed here had ISRs of 257 bp regardless of method used to assign serotype. Further analysis is required to explain this discrepancy, which could be due to strain variation or some discrepancy with annotation in the reference strain.

  3. Five submissions of S. Newport had different ISR sequences and four DNAhyb patterns despite having a single serotype assigned by the KW scheme. Alignment of the sequence of five ISRs from submissions that serotyped as S. Newport showed that ISR UN0017 had a deletion within the intergenic region between the end of the 23S and 5S rRNA genes (Fig. 2, Top).

  4. O-antigen group D submissions had an even more complex ISR outcome than did S. Newport (Fig. 2, Bottom). Alignment showed that, in comparison with S. Enteritidis, ISR UN0002 had a somewhat similar deletion as that seen occurring within Salmonella Pullorum in the intergenic region between the 5S rRNA and tRNA aspU. In this same region, ISR UN0008 has an insertion that was 100% similar to a region from S. Newport found in a different ribosomal region. The insert accounted for the exceptional length of the ISR. Specifically, there was a 146 bp insert in ISR UN0008 that was the same as base pairs 4165975-4166120 in the genome of S. Newport strain SL254 (NC_011080). Other serotypes that had ISR variants within a serotype included S. Kentucky, S. Montevideo, and S. Infantis.

Fig. 2.

Fig. 2

Open in a new tab

Alignment of ISR sequences to evaluate variation within serotype. (Top) Alignment of ISRs from Salmonella enterica serovar Newport. The shortest ISR shown is UN0017, which had a deletion occurring before the 5S ribosomal gene. The 5S ribosomal gene of Salmonella Enteritidis was included for reference purposes. (Bottom) Alignment of ISRs from the O-antigen group D serotypes of S. enterica. The submission with ISR UN0002 was S. Enteritidis by the KW scheme and Genovar 6660 by DNAhyb. ISR UN0008 was Salmonella Pullorum by the KW scheme and Genovar Gallinarum Pullorum 2978H by DNAhyb. Alignment of ISR sequences from Group D serotypes indicated that UN0002 is more like S. Pullorum. ISR UN0008 is more like S. Gallinarum or S. Enteritidis, except that it has a 146 bp insertion also found in S. Newport.

ISR and DNAhyb are limited to assignment of serotype to S. enterica

The limit of detection of ISR was found by analysis of S. Enteritidis submissions 22079, 21027, and 21046, which were included to as control strains because they were previously characterized by whole-genome analysis (Guard et al., 2011). Strains 21027 and 21046 are clonally related and are within the same phage type lineage 13a/8, whereas 22079 is phage type 4. Despite belonging to the same phage type, strains 21027 and 21046 are phenotypically distinct and are known to have 16 genes with altered open reading frames as well as other SNPs. All three subpopulations of S. Enteritidis had the same KW serotype, DNAhyb genovar, and ISR. Thus, the two DNA methods were equivalent in regards to determining serotype only.

Determination of sensitivity and specificity of ISR in comparison with DNAhyb

Table 1 includes the category of each ISR for the purposes of determining sensitivity and specificity in comparison with DNAhyb. True positives (TP) were defined as submissions assigned a serotype by ISR in complete agreement with DNAhyb, TN indicated ISR was different for the serotype assigned by DNAhyb due to the presence of genetic variation (including mixtures of serotypes), false positives (FP) were assigned a serotype by ISR but not by DNAhyb, and false negatives (FN) should have returned an ISR sequence but did not. As all submissions were S. enterica ssp. I and produced an ISR and a DNAhyb genovar, the FN value is 0. Calculating sensitivity from the values 124/124 + 0 (TP/TP + FN) suggests unity (similar performance) of the two methods. Calculating specificity from the values 8/7 + 8 = 0.53 (TN/FP + TN) suggests that DNAhyb is more specific, or in other words, it detects less genetic variation than does ISR. Removing submissions with mixtures did not change the finding that ISR appears to give more specific information than DNAhyb. Given that detection of new serotypes is a continuous process for S. enterica ssp. I, application of ISR has the potential to expand knowledge about diversity of serotypes. In these analyses, we used S. enterica serovar Enteritidis to provide a crucial control that shows ISR does not provide fine-scale differentiation achieved with whole-genome sequencing.

Discussion

A limit of detection of ISR is that it targets a single region of the bacterial chromosome. Homologous recombination and other genomic events that mobilize DNA could generate a hybrid strain with potential to alter the correlation between an ISR region and the rest of the chromosome (Porwollik & McClelland, 2003). Methods that target multiple regions around the bacterial chromosome, such as DNAhyb and whole-genome sequencing, will thus still be required for critical stages of analysis. The primary use proposed for ISR is to facilitate routine and inexpensive serotyping of S. enterica. The method has been applied to processing DNA samples from South America in cooperation with the United States, and further development of software that incorporates a validated database will streamline analysis for users (Pulido-Landinez et al., 2012). SNP analysis by ISR complements methods such as DNAhyb that evaluate the whole genome, and each genome method can be used to check the quality of results from the other.

Disagreement between the KW scheme and genotyping by either DNA method could be attributed to at least four causes with a biological or molecular explanation.

  1. Flagella H-antigen immunoreactivity may contribute disproportionately to interpretive differences between investigators;

  2. A genetic variant may have a unique ISR or DNAhyb genovar that, in consensus with previous knowledge, is a genetic variant of an existing serotype;

  3. Mixtures of serotypes could be present within cultures, which can be detected by some methods but not others.

  4. The most troublesome group was new variants with undefined relationships to named serotypes. ISR UN0002 (ISR 360 bp) and UN0008 (ISR 530 bp) were associated with submissions serotyped by the KW scheme as S. Enteritidis and S. Pullorum, respectively, despite their unique ISR sequences. Classifying them by the KW scheme as S. Enteritidis or S. Pullorum could have unintended consequences, because the biological impact of these strains on susceptible hosts is not known. For example, S. Pullorum on-farm can initiate depopulation of chickens in order to protect poultry health (http://www.aphis.usda.gov/animal_health/animal_dis_spec/poultry/), whereas S. Enteritidis in people and foods can initiate control measures to protect human health (http://www.fda.gov/Food/FoodSafety/Product-SpecificInformation/EggSafety/EggSafetyActionPlan/ucm170746.htm). No information is available on the comparative virulence properties of UN0002 (ISR 360 bp) and UN0008 (530 bp) to S. Pullorum (ISR 361 bp) or S. Enteritidis (ISR 499 bp). Further research using biological assays is needed to characterize the virulence of strains identified by ISR as being potentially new strains of concern to either human or animal health.

Assay costs were from $10 to $12 per sample for ISR, $35 to $185 for KW serotyping and $50 for the method of DNAhyb used here. The point of comparison begins when a colony is identified on agar that is suspected of being Salmonella. The low cost and simplicity of conducting ISR make it a method that supports public health laboratories and food producers with in-house laboratories in their efforts to monitor S. enterica. Other efficiencies such as submission of DNA to centralized facilities and applying robotics for sample preparation may lower the cost of conducting ISR further. If a simple method for serotyping S. enterica is available, farm management and plant processors may test samples and monitor environments more frequently. The ability of ISR to detect a mixture of serotypes, its independence of cell-surface epitopes, cost, and simple software requirements are relative strengths. We suggest that it will a useful addition for assigning serotype at minimal cost rather than being another typing method with no clear advantage (Achtman, 1996; Achtman et al., 2012).

Acknowledgments

Authors have no conflict of interest, financial or otherwise. Use of commercially available products by the United States Department of Agriculture (USDA) does not constitute endorsement. This manuscript was primarily supported by USDA-ARS Project Number 6612-32000-007-00 “Genetic Analysis of Poultry-Associated Salmonella enterica (abbr).” Submissions were collected in association with USDA-ARS Project Numbers 1265-32000-078-00, 6612-41420-017-00 and 6612-32420-001-00.

References

  1. Achtman M. A surfeit of YATMs? J Clin Microbiol. 1996;34:1. doi: 10.1128/jcm.34.7.1870-1870.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Achtman M, Wain J, Weill FX, et al. Multilocus sequence typing as a replacement for serotyping in Salmonella enterica. PLoS Pathog. 2012;8:e1002776. doi: 10.1371/journal.ppat.1002776. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bopp C, Brenner FW, Wells J, Strokbine N. EscherichiaShigella, and Salmonella. In: Murray P, Baron E, Pfaller M, Tenover F, Yolken R, editors. Manual of Clinical Microbiology. Washington, DC: ASM Press; 1999. pp. 459–474. [Google Scholar]
  4. Brenner FW, Villar RG, Angulo FJ, Tauxe R, Swaminathan B. Salmonella nomenclature. J Clin Microbiol. 2000;38:2465–2467. doi: 10.1128/jcm.38.7.2465-2467.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Curd H, Liu D, Reeves PR. Relationships among the O-antigen gene clusters of Salmonella enterica groups B, D1, D2, and D3. J Bacteriol. 1998;180:1002–1007. doi: 10.1128/jb.180.4.1002-1007.1998. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Foodnet. Vital signs: incidence and trends of infection with pathogens transmitted commonly through food–foodborne diseases active surveillance network, 10 U.S. sites, 1996–2010. MMWR Morb Mortal Wkly Rep. 2011;60:749–755. [PubMed] [Google Scholar]
  7. Guard J, Morales CA, Fedorka-Cray P, Gast RK. Single nucleotide polymorphisms that differentiate two subpopulations of Salmonella Enteritidis within phage type. BMC Res Notes. 2011;4:369. doi: 10.1186/1756-0500-4-369. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Kauffman F, Edwards P. A simplification of the Kauffmann-White schema. Am J Clin Path. 1952;22:692–697. doi: 10.1093/ajcp/22.7_ts.692. [DOI] [PubMed] [Google Scholar]
  9. Madajczak G, Szych J. Evaluation of PremiTest Salmonella kit for identification of not-typable by conventional methods Salmonella. Med Dosw Mikrobiol. 2010;62:29–36. [PubMed] [Google Scholar]
  10. Malorny B, Guerra B, Zeltz P, Rissler K, Helmuth R. Typing of Salmonella by DNA-microarrays. Berl Munch Tierarztl Wochenschr. 2003;116:482–486. [PubMed] [Google Scholar]
  11. Morales CA, Gast R, Guard-Bouldin J. Linkage of avian and reproductive tract tropism with sequence divergence adjacent to the 5S ribosomal subunit rrfH of Salmonella enterica. FEMS Microbiol Lett. 2006;264:48–58. doi: 10.1111/j.1574-6968.2006.00432.x. [DOI] [PubMed] [Google Scholar]
  12. Popoff M, Le Minor L. Antigenic Formulas of the Salmonella Serovars. Institut Pasteur, Paris: World Health Organization Collaborating Centre for Reference and Research on Salmonella; 2001. 8th revision. [Google Scholar]
  13. Porwollik S, McClelland M. Lateral gene transfer in Salmonella. Microbes Infect. 2003;5:977–989. doi: 10.1016/s1286-4579(03)00186-2. [DOI] [PubMed] [Google Scholar]
  14. Pulido-Landinez M, Laviniki V, Sanchez-Ingunza R, Guard J, Pinheiro do Nascimento V. Use of FTA cards for the transport of DNA samples of Salmonella spp. from poultry products from southern Brazil. Acta Sci Vet. 2012;40:1073. [Google Scholar]
  15. Wattiau P, Van Hessche M, Schlicker C, Vander Veken H, Imberechts H. Comparison of classical serotyping and PremiTest assay for routine identification of common Salmonella enterica serovars. J Clin Microbiol. 2008;46:4037–4040. doi: 10.1128/JCM.01405-08. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Wattiau P, Boland C, Bertrand S. Methodologies for Salmonella enterica subsp. enterica subtyping: gold standards and alternatives. Appl Environ Microbiol. 2011;77:7877–7885. doi: 10.1128/AEM.05527-11. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Fems Microbiology Letters are provided here courtesy of Wiley

RESOURCES