Abstract
The quorum-sensing system of Staphylococcus aureus, the accessory gene regulator (Agr) system, is responsible for increased transcription of certain exoprotein genes and decreased transcription of certain cell wall-associated proteins during the postexponential phase of growth. This regulation is important for virulence, as evidenced by a reduction in virulence associated with a loss of the Agr system. The enterotoxin D (sed) determinant is upregulated by the Agr system. To define the Agr-regulated cis element(s) within the sed promoter region, we utilized promoters not regulated by Agr to create hybrid promoters. Hybrid promoters were created by using sed sequences combined with the enterotoxin A (sea) promoter or the S. aureus lac operon promoter sequences. The results obtained indicated that the Agr control element of the sed promoter resides within the −35 promoter element and at the Pribnow box to the +1 site of the promoter. At these positions of the sed promoter, a directly repeated 6-bp sequence was found. This repeat is important for overall promoter activity, and maximal regulation of the promoter activity requires both repeat elements. Furthermore, Agr control of sed promoter activity was found to be dependent upon the presence of a functional Rot protein. Therefore, the postexponential increase in sed transcription results from the Agr-mediated reduction in Rot activity rather than as a direct effect of the Agr system.
Staphylococcus aureus is a significant human pathogen which causes a wide range of diseases, including cutaneous infections, food poisoning, endocarditis, pneumonia, osteomyelitis, and septic arthritis (7, 23, 40). The virulence factors of this organism include a variety of exoproteins and cell wall-associated proteins (1). The exotoxins include enterotoxins (A to E and G to R); leukotoxin; exofoliative toxins; alpha-, beta-, gamma-, and delta-hemolytic toxins; toxic shock syndrome toxin; coagulase; and secreted enzymes, such as nuclease and proteases (1, 4, 19, 26). Staphylococcal enterotoxins are superantigens and are responsible for staphylococcal gastroenteritis. The symptoms of staphylococcal gastroenteritis include emesis and abdominal cramping (4, 40).
Coordinated regulation of expression of the many virulence genes is a critical feature of the pathogenicity of S. aureus, and the regulatory networks might provide sites of possible therapeutic intervention in treating staphylococcus infections. To date, several global regulators have been reported to regulate the production of virulence-associated exoproteins and cell wall components (5, 6, 9, 10, 15, 19, 24, 32). Among these regulatory systems, the accessory gene regulator (Agr) system has been the best characterized. The Agr system is a quorum-sensing system and a two-component regulatory system which responds to an autoinducer peptide (18, 37). The agr operon produces two distinct transcripts, designated RNAII and RNAIII (19, 25). RNAII encodes AgrBDCA, which is the quorum-sensing system (19, 25). AgrA is the response regulator and, when phosphorylated, upregulates the expression of the P2 and P3 promoters to increase the production of RNAII and RNAIII (3). AgrC is the transmembrane histidine kinase responsible for sensing the level of autoinducer in the environment (21). AgrD encodes a polypeptide that appears to be processed and exported by AgrB (37). AgrD accumulates extracellularly as the peptide inducer (18). RNAIII encodes delta-hemolysin, but the RNAIII itself serves as the regulatory signal of the Agr system (17, 25). As the cell density increases in a growing culture, the intracellular level of RNAIII increases due to the activity of the Agr system. The increased RNAIII level leads to increased transcription of many exotoxin genes and reductions of transcription of certain cell wall protein determinants and their associated protein genes (19, 25, 36). Inactivation of the Agr system leads to a nonhemolytic and nonproteolytic phenotype, which is due to the failure of exoprotein induction (19).
The sarA locus encodes a transcriptional factor which upregulates the expression of RNAIII, thus influencing the expression of Agr-regulated genes (9). However, it has also been shown to regulate gene expression in an Agr-independent fashion (10).
The repressor of toxin (rot) locus was first identified through a transposon mutagenesis study (24). The inactivation of rot was able to partially restore the alpha-hemolysin- and protease-positive phenotypes in an agr null mutant (24). Rot is a member of the Sar family of transcriptional factors of S. aureus. Rot is a repressor of transcription of various genes, including those encoding certain toxins, but also has positive regulatory activity for 86 determinants (32). Its activity is regulated by the Agr system. Results of Northern blot analysis have shown that the transcription of Rot is not affected by the Agr system but that Rot activity is negatively regulated by the Agr system (24). The exact mechanism of Rot regulation by the Agr system is not known. An examination of Rot regulatory effects by microarray analysis has shown that Rot acts as a global regulator that affects several virulence factors, including geh, ssp protease, alpha-toxin, protein A, and clumping factor (32).
A number of staphylococcal enterotoxins that are distinguished by serological or amino acid sequence differences have been identified. They are designated staphylococcal enterotoxin A (SEA) through SER, excluding SEF, which was previously the designation of toxic shock syndrome toxin (4, 22, 26, 27, 29, 35, 40). The enterotoxin genes are carried on accessory genetic elements in S. aureus. The expression patterns for the different serotype enterotoxins have been found to vary. For, example, SEA is produced primarily during exponential growth, whereas SEB, SEC, and SED appear in culture media in the largest quantities during the transition from exponential growth to stationary-phase growth, a characteristic of their regulation by the Agr system (2, 8, 11, 22, 29, 35, 38). Loss of the Agr signal transduction system results in substantial reductions in enterotoxin protein and mRNA production. The reductions in mRNA levels were fourfold for SEB and two- to threefold for SEC (22, 29). The reduction in enterotoxin protein production was more dramatic. For example, SEC was reduced 16- to 32-fold and SED was reduced 5-fold, as evidenced by Western blot analysis (2, 29).
The sed determinant is encoded along with sej and ser on a large penicillinase plasmid in S. aureus, and its promoter has been characterized by Zhang and Stewart and others (2, 26, 39). A 59-bp promoter-containing fragment was fused to a reporter gene, cat, and was found to retain the promoter strength and Agr stimulatory effect seen with the entire intergenic sequence between sed and sej (39). In further analysis of the sed promoter, two 6-bp direct repeats were found to be contained within this minimum promoter fragment. In this report, we describe the role of these repeat sequences in the regulation of this promoter by the Agr system. Hybrid promoters were constructed by using the non-Agr-regulated sea and lactose operon promoters. The promoter elements were evaluated for regulation by Agr and Rot.
MATERIALS AND METHODS
Media and culture conditions.
Escherichia coli cultures were grown in L broth (1% NaCl, 1% tryptone, 0.5% yeast extract) with shaking at 200 rpm or on L agar (L broth with 1.5% agar) at 37°C overnight. S. aureus cultures were grown in tryptic soy broth (TSB; Difco) with shaking at 200 rpm or on tryptic soy agar (Difco) at 37°C overnight. The bacterial strains used are listed in Table 1. All S. aureus strains are 8325-4 derivatives. Antibiotic concentrations utilized were ampicillin, 100 μg/ml; erythromycin, 400 μg/ml for E. coli and 20 μg/ml for S. aureus; kanamycin, 25 μg/ml; and tetracycline, 20 μg/ml for E. coli and 5 μg/ml for S. aureus. Skim milk plates were prepared according to the Difco formulation.
TABLE 1.
Bacterial strains used in this study
| Bacterial strain | Relevant characteristic(s) | Source or reference |
|---|---|---|
| E. coli | ||
| DH5α | φ80dlacZΔM15 recA1 endA1 gyrA96 thi-1 hsdR17(rK− mk−) supE44 relA1 deoR Δ(lacZYA-argF)U169 | Gibco-BRL |
| TOP10F′ | F′[lacIq Tn10 (TetR)] mcrA Δ(mrr-hsdRMS-mcrBC) φ80lacZΔM15 ΔlacX74 deoR recA1 araΔ 139 Δ(ara-leu)7697 galU galK rpsL endA1 nupG | Invitrogen |
| S. aureus | ||
| GP269 | (rsbUVWsigB)+-tetL Tcr | 12 |
| KSS5186 | Δagr rot::tetM | This study |
| KSS5523 | Δagr sarA::kan | This study |
| PM466 | Δagr | 24 |
| PM783 | rot::tetM | 24 |
| RN4220 | Accepts foreign DNA (r−) | 20 |
| KSI2054 | agr+ | 38 |
| UAMS-979 | cna sarA::kan | 6 |
DNA manipulations and plasmids.
Promoter elements and the Rot expression fragment were cloned by PCR. Site-directed mutagenesis was carried out with oligonucleotide primers containing the desired mutations as described previously (39). PCR primer pairs are listed in Table 2. The plasmids used are listed in Table 3. PCR-amplified promoter elements were inserted into pMH109 (16) following SacI and XbaI digestion. Subsequently, the inserted DNA fragments were subjected to DNA sequencing to confirm the identity of the inserted sequence. The promoter cloning plasmid, pMH109, has a copy number of 10 in S. aureus (16), which is comparable to the copy numbers reported for the large penicillinase-type plasmids similar to the sed-bearing pIB485 (31). The Rot expression plasmid pDT34 utilizes a constitutive mutant version of the S. aureus lac operon promoter (28) to express Rot in an agr- and rot-independent fashion. This shuttle plasmid utilizes the pE194 (14) replicon and ermC for selection in S. aureus and the pCR2.1 (Invitrogen) backbone for replication and selection in E. coli. The plasmid was constructed by subcloning the S. aureus lac promoter element from pZS2747 into pUC19 by XbaI and SacI digestion. The resultant plasmid, pUClac, was digested with PstI and AflIII and ligated with the 2.3-kb PstI- and AflIII-digested fragment from pE194 to produce pDT42. A 1.8-kb SacI fragment from pDT42, bearing the pE194 replicon and ermC plus the S. aureus lac promoter fragment, was inserted into the SacI site of pCR2.1 to create pDT33. Plasmids were electroporated into RN4220 by the method of Schenk and Laddaga (33). To verify the inserted elements, plasmid DNA was isolated from RN4220 and transformed into E. coli strain DH5α. Plasmid DNA was isolated with Wizard Plus Minipreps (Promega) and subjected to DNA sequence analysis. The confirmed plasmids were then transduced from RN4220 into strains with different genetic backgrounds by the method of Rubin and Rosenblum (30).
TABLE 2.
Primers used for PCR amplification
| Primer name | Sequencea | Plasmid(s) constructed |
|---|---|---|
| lac5pX | gctctagaTTGATTTATTGTTTGTTTATG | pZS2747 |
| lac3pSc | gcgagctcGAAAAGGCTTTCAATTTG | pZS2747 |
| rot3pSc | gagctcGTGTAAATAAACTTGCTTTC | pDT41 |
| rot5p-2X | tctagaCAGTAGATGCTCATCTTTTTTTAG | pDT41 |
| rotexpf | CAAGTTTTGGGATTGTTGGGATGTTTG | pDT32, pDT34 |
| rotexpr | gaagagcTTACACAGCAATAATTGCGTTTAAAC | pDT32, pDT34 |
| sea5p | gctctagaTAGACAAATATAAAAAG | pZS2962 |
| sea11 | gcgagctcATTTAATTATACATAC | pZS2962 |
| seaD-bX | gctctagaATGAAAAATATAAAAAGTGTATAGTATAATGAAA | pZS2963 |
| sea11 | gcgagctcATTTAATTATACATAC | pZS2963 |
| seaD-10X | gctctagaTAGACAAATATAAAAAGTGTATAGTATAATGAAA | pZS2964 |
| seaD-10Sc | gcgagctcCATTTAATTATACATTTTCATTATACTATACACT | pZS2964 |
| seaD-bX | ctctagaATGAAAAATATAAAAAGTGTATAGTATAATGAAA | pZS2965 |
| seaD-bSc | gcgagctcCATTTAATTATACATTTT | pZS2965 |
| seaD-10Sc | gcgagctcCATTTAATTATACATTTTCATTATACTATACACT | pDT27 |
| seaD-10X | gctctagaTAGACAAATATAAAAAGTGTATAGTATAATGAAA | pDT27 |
| seaD-bSc | gcgagctcCATTTAATTATACATTTTCATTATACATTACACT | pDT26 |
| seaD-bX | gctctagaATGAAAAATATAAAAAGTGTATAGTATAATGAAA | pDT26 |
| sedA-10bSC | gcgagctcTCTATCCAACTTGCTCACACATATATTATCAATA | pDT29, pDT30 |
| sedA-10X | gctctagaATGAAATGGATCAAATATATTGATAATATATGTG | pDT30 |
| sedA-35Sc | gcgagctcTCTATCCAACTTGCTCACTTTCATTATAYCAATA | pDT28 |
| sedA-35X | gctctagaTAGACATGGATCAAATATATTGATATAATGAAAG | pDT28 |
| sedA-bX | gctctagaTAGACATGGATCAAATATATTGATAATATATGTG | pDT29 |
| sedlac | gcgagctcGATTACGTTTAAATTATAAACAATATATTT | pZS2740 |
| sed-M1 | gctctagaGAAGTGGATCAAATAT | pZS2719 |
| sed-M2 | gctctagaTGAAATGGATCCAATATATTG | pZS2720 |
| sed-M3 | gctctagaTGAAATGGATCGAATATATTG | pZS2721 |
| sed-M7 | gcgagctcGCCGCAATCTATCAAACT | pZS2748 |
| sed-M8 | gcgagctcGCCGCAATCTATCGAACT | pZS2749 |
| sed-M9 | gcgagctcGCCGCAATCTATCCAAAT | pZS2750 |
| sed-M10 | gcgagctcGCCCCAATCTATCCAAGT | pZS2751 |
| sed-M13 | gctctagaTGAAATGGATCAAATATAT | pZS2772 |
| sed-M14 | gctctagaTGAAATTGATCAAATATATTG | pZS2773 |
| sed-M15 | gcgagctcGCCGCAATCTATCCAACTTGCTAACTTTCATTATATC | pZS2774 |
| sed-M16 | gcgagctcGCCGCAATCTATCCAACTTGCTCAATTTACTTATATC | pZS2775 |
| sed-M30 | gctctagaATGAAATGGATCAAATATATTGATATAATTAAAGTGAGCAAG | pZS2874 |
| sed-M31 | gctctagaATGAAATGGATCAAATATATTGATATAATCAAAGTGAGCAAG | pZS2875 |
| sed-M32 | gctctagaATGAAATGGATCAAATATATTGATATAATGCAAGTGAGCAAG | pZS2876 |
| sed-M33 | gctctagaATGAAATGGATCAAATATATTGATATAATGTTAGTGAGCAAG | pZS2877 |
Lowercase letters represent bases included for the introduction of restriction sites; boldface letters represent the positions of site-directed mutations.
TABLE 3.
Plasmids used in this study
| Plasmid name | Inserted sequence or descriptiona | Plasmid backbone | Source or reference |
|---|---|---|---|
| pCR2.1 | PCR cloning vector | Invitrogen | |
| pDT26 | sea promoter with sed upstream and extended downstream repeats | pMH109 | This study |
| pDT27 | sea promoter with sed extended downstream repeat | pMH109 | This study |
| pDT28 | sed promoter with sea −35 element | pMH109 | This study |
| pDT29 | sed promoter with sea −35 element and Pribnow box extended sequence | pMH109 | This study |
| pDT30 | sed promoter with sea Pribnow box extended sequence | pMH109 | This study |
| pDT32 | rot ORF | pCR2.1 | This study |
| pDT33 | pDT42 SacI 1.6-kb fragment | pCR2.1 | This study |
| pDT34 | rot ORF | pDT33 | This study |
| pDT41 | rot promoter | pMH109 | This study |
| pDT42 | pE194 2.3-kb PstI AflIII fragment | pUClac | This study |
| pE194 | MLSr plasmid | 14 | |
| pMH109 | Promoter cloning shuttle plasmid | 16 | |
| pUClac | S. aureus lac operon promoter | pUC19 | This study |
| pZS2704 | sed promoter | pMH109 | 39 |
| pZS2719 | sed promoter with A→G at −29 | pMH109 | 39 |
| pZS2720 | sed promoter with A→C at −22 | pMH109 | 39 |
| pZS2721 | sed promoter with A→G at −21 | pMH109 | 39 |
| pZS2739 | lac-sed hybrid promoter | pMH109 | This study |
| pZS2740 | sed-lac hybrid promoter | pMH109 | This study |
| pZS2747 | lac promoter | pMH109 | 39 |
| pZS2748 | sed promoter with G→T at +11 | pMH109 | 39 |
| pZS2749 | sed promoter with G→C at +11 | pMH109 | 39 |
| pZS2750 | sed promoter with G→T at +8 | pMH109 | 39 |
| pZS2751 | sed promoter with G→C at +8 | pMH109 | 39 |
| pZS2772 | sed promoter with G→T at −13 | pMH109 | 39 |
| pZS2773 | sed promoter with G→T at −27 | pMH109 | 39 |
| pZS2774 | sed promoter with G→T at +2 | pMH109 | 39 |
| pZS2775 | sed promoter with G→T at −1 | pMH109 | 39 |
| pZS2859 | sed-lac-sed hybrid promoter | pMH109 | This study |
| pZS2874 | sed promoter with G→T at −5 | pMH109 | 39 |
| pZS2875 | sed promoter with G→C at −5 | pMH109 | 39 |
| pZS2876 | sed promoter with A→C at −4 | pMH109 | 39 |
| pZS2877 | sad promoter with GA→TT at −5, −4 | pMH109 | 39 |
| pZS2785 | lac promoter | pMH109 | 39 |
| pZS2887 | sea-sed hybrid promoter | pMH109 | This study |
| pZS2888 | sed-sea hybrid promoter | pMH109 | This study |
| pZS2889 | sed-lac-sed-sea hybrid promoter | pMH109 | This study |
| pZS2962 | sea promoter | pMH109 | This study |
| pZS2963 | sea promoter with sed downstream repeat element | pMH109 | This study |
| pZS2964 | sea promoter with sed −35 repeat sequence | pMH109 | This study |
| pZS2965 | sea promoter with sed −35 and downstream repeat elements | pMH109 | This study |
ORF, open reading frame.
CAT assay.
Chloramphenicol acetyltransferase (CAT) assays were performed by the spectrophotometric method of Shaw (34). Bacterial cultures were grown in TSB with appropriate antibiotic selection overnight at 37°C. Ten milliliters of prewarmed TSB (37°C) was inoculated with an overnight culture to an A540 of 0.2. The cultures were then incubated at 37°C with shaking until the A540 was 2.5. The CAT activity at this postexponential phase of growth was substantially higher than that obtained with stationary-phase cultures (39), although the relative values (ratios of wild-type to mutant promoters or of activities in different mutant host backgrounds) were identical at the two growth phases. The growth kinetics of the different mutant strains did not differ significantly from that of the wild-type S. aureus strain. Five milliliters of each bacterial culture was collected, the cells were harvested by centrifugation (5,000 × g, 10 min), and the cell pellets were washed with Tris-EDTA buffer (50 mM Tris-HCl, 10 mM EDTA [pH 8.0]). The cell pellets were resuspended in 1 ml of Tris-EDTA buffer, and the cells were then lysed with 0.1-mm-diameter glass beads twice for 1 min at 4°C with an eight-sample bead beater (Biospec Products). Between cycles, the suspensions were cooled on ice for 1 min. The lysed bacterial samples were centrifuged (2,500 × g, 10 min) at 4°C, and the supernatant was saved and stored at −70°C. Two to twenty-five microliters of cell lysate was added to 37.5 μl of 0.4% 5,5′-dithiobis-2-nitrobenzoic acid (DTNB; Sigma) in 100 mM Tris-HCl (pH 8.0) and 7.5 μl of 5 mM acetyl coenzyme A (Amersham Pharamcia). Distilled water was added to give a final volume of 250 μl. The reaction mixtures were then incubated at 37°C for 10 min prior to the addition of 5 pmol of chloramphenicol (in 10 μl of 50% ethanol). The changes in absorbance at 412 nm were measured with a microplate reader (Molecular Devices), and the CAT values were calculated as the change in absorbance per minute divided by 13.6 (the molar extinction value for DTNB) and by the cell dry weight. CAT values were expressed as nanomoles of chloramphenicol acetylated per milligram (dry weight) of cells per minute.
Statistical analysis.
Each result was represented as the mean ± the standard deviation for at least three samples, and the three-sample experiment was repeated. Results were subjected to a pair-sampled two-tailed Student t test. Differences with P values less than 0.05 were considered to be significant.
RESULTS
Mutation analysis of the sed promoter.
Like many other staphylococcal exoprotein virulence genes, most enterotoxin genes are positively regulated by the agr system. The mechanism by which the agr system increases the transcription of exoprotein genes is unknown. The minimal Agr-regulated sed promoter, which retains the promoter strength and regulation of extended sequences (39), is presented in Fig. 1. To define the regulation of the sed promoter, we created various mutant sed promoters by keying initially on the GC pairs in the promoter sequence. The activities of these promoters were analyzed by measuring the cat expression levels in both wild-type and agr mutant strains. Our results showed that base substitutions in the spacer sequence between the −35 element and the Pribnow box and in sequences distal to the transcription start point had little effect on agr regulation (Table 4). Because sequences within this minimal promoter fragment are important for the activity of the promoter (39), base substitutions often had pronounced negative effects on promoter activity, which made it impossible to evaluate any agr-associated effects.
FIG. 1.
The sed promoter element. Shown is the minimum sequence required for agr regulation. Boldface letters indicate the −35 and −10 boxes, and the underlining arrows indicate the 6-bp repeated sequence.
TABLE 4.
Point mutations in the sed promoter fragment
| Plasmid | Sequence | Rel. exp.a | ASIb |
|---|---|---|---|
| −35−10 +1 | |||
| pZS2704 (wt)c | ATGAAATGGATCAAATATATTGATATAATGAAAGTGAGCAAGTTGGATAGATTGCGGC | 1.0 | 2.5 |
| pZS2719 | -----G---------------------------------------------------- | 0.9 | 1.6 |
| pZS2720 | ------------C--------------------------------------------- | 0.9 | 1.5 |
| pZS2721 | -------------G-------------------------------------------- | 0.8 | 1.7 |
| pZS2748 | --------------------------------------------T------------- | 1.0 | 1.5 |
| pZS2749 | --------------------------------------------C------------- | 0.8 | 1.5 |
| pZS2750 | ------------------------------------------T--------------- | 2.5 | 1.3 |
| pZS2751 | ------------------------------------------C--------------- | 1.9 | 1.3 |
| pZS2772 | ---------------------T------------------------------------ | 0.03 | 0.3 |
| pZS2773 | -------T-------------------------------------------------- | 1.0 | 1.5 |
| pZS2774 | -----------------------------------T---------------------- | 3.6 | 3.8 |
| pZS2775 | ----------------------------------T----------------------- | 1.6 | 2.1 |
| pZS2874 | -----------------------------T---------------------------- | 0.1 | ND |
| pZS2875 | -----------------------------C---------------------------- | 0.2 | 1.4 |
| pZS2876 | ------------------------------C--------------------------- | 0.2 | 2.2 |
| pZS2877 | -----------------------------TT--------------------------- | 0.0 | ND |
Rel. exp., relative expression (ratio of activity of the mutant promoter to that of the wild-type promoter).
ASI, Agr stimulation index (ratio of activity of the promoter in a wild-type host to that in an Agr deletion mutant); ND, not determined.
wt, wild type.
Agr regulation of the sed promoter.
To circumvent the effects of base-pair changes on promoter strength, a hybrid promoter approach was undertaken. Fusion of the sed promoter with non-agr-regulated staphylococcal gene promoters sea (8, 35) and lac created a series of hybrid promoters. The resulting promoter-containing plasmids were introduced into S. aureus agr mutant and agr+ hosts. The promoter activity for each hybrid was analyzed by measuring the level of cat expression activity in each host's genetic background (Table 5). Replacement of sed sequences upstream of the Pribnow box with the corresponding sequences from the staphylococcal lac operon promoter (pZS2739) generated a promoter that was stronger than the sed wild-type promoter (pZS2704) and that was not affected by the Agr system. Replacement of the Pribnow box and distal sequences with lac sequences (pZS2740) produced a largely inactive promoter, consistent with the requirement for sequences downstream of the start site of transcription for the expression of the sed promoter (39). Although it was a poor promoter, it retained the Agr host expression effect. Substitution of the downstream sequences with those from the Agr-independent sea promoter (pZS2888) resulted in an active promoter which did not display differential expression in the two Agr-type hosts. These results suggest that the upstream sed sequences may make a weak contribution to the Agr effect, and because the effect is weak, it is only observable with poor promoters. Substitution of the spacer sequences separating the −35 and Pribnow box elements with the lac operon promoter spacer sequence had no effect on Agr regulation of the sed promoter. This result indicates that the Agr system cis element in the sed promoter must lie within the −35 element and/or within the sequences distal to the spacer sequence.
TABLE 5.
Regulation of hybrid promotersa
| Plasmid | Sequenceb | CAT values (Agr wt/Agr Δ)c | ASId |
|---|---|---|---|
| pZS2704 (wt) | ATGAAATGGATCAAATATATTGATATAATGAAAGTGAGCAAGTTGGATAGATTGCGGC | 131.7 ± 6.1/58.2 ± 2.5 | 2.3* |
| pZS2739 (lac-sed) | TTGATTTATTGTTTGTTTATGTT----------------------------------- | 345.3 ± 53.1/341.0 ± 19.1 | 1.0 |
| pZS2740 (sed-lac) | -----------------------TATAATTTAAACGTAATCAAATTGAAAGCCTTTTC | 6.2 ± 0.7/2.6 ± 2.2 | 2.3* |
| pZS2859 (sed-lac-sed) | ------TATTGTTTGTTTATGTT----------------------------------- | 143.8 ± 2.0/85.8 ± 12.5 | 1.7* |
| pZS2887 (sea-sed) | TAGACAAATATAAAAAGTGTATA----------------------------------- | 246.1 ± 15.4/222.7 ± 10.9 | 1.1 |
| pZS2888 (sed-sea) | -----------------------TAATATATGTATGTATAATTAAATG | 54.3 ± 5.4/45.8 ± 3.6 | 1.2 |
| pZS2889 (sed-lac-sed-sea) | ------TATTGTTTGTTTATGTT------------GTATAATTAAATG | 233.6 ± 6.5/140.6 ± 15.2 | 1.7* |
wt, wild type.
Dashes represent bases identical to those in the wild-type sed promoter. Boldface sequences are the −35 and −10 promoter elements.
Means ± standard deviations (in nanomoles per milligram of cell dry weight per minute). Each value represents the average of at least of four determinants. Agr Δ, agr mutant.
ASI, Agr stimulation index (ratio of activity of the promoter in a wild-type host to that in an Agr deletion mutant). An asterisk indicates that results for agr mutant and agr+ hosts were significantly different.
Hybrid promoters were created with the Agr-independent enterotoxin A gene promoter. We found that the sed +1-distal sequences could be replaced by the corresponding bases from the sea gene with retention of promoter activity. Substitution of the sequences upstream of the sed Pribnow box by sea sequences (pZS2887) or substitution of sequences distal to the promoter spacer sequence with sea sequences (pZS2888) produced promoters with no statistically significant Agr influence on promoter activity. This finding suggests that both the upstream and the downstream sequences are important in Agr control of this promoter's expression. Hybrid promoters with the sea −35 element were usually stronger promoters than those with the sed −35 sequences, consistent with the conclusion that this element is weak in the sed promoter (39).
The hybrid promoter in pZS2889 contains the lac sequence in the promoter spacer region and sea sequences distal to the start site of transcription but retains the sed −35 and Pribnow box sequences. This promoter exhibits statistically significant Agr stimulation of transcription. This result rules out contributions of the promoter spacer and transcription start site-distal sequences in the Agr control of the sed promoter. Thus, we concluded that the Agr cis-regulatory region of the sed promoter is located in both the −37 to −34 and the −12 to −1 regions.
Role of the directly repeated sequence in Agr control of the sed promoter.
Included in the sed promoter sequence is a directly repeated 6-bp sequence (ATGAAA; −37 to −32 and −9 to −5 [Fig. 1]). This repeated sequence comprises the −35 element of the promoter, and the downstream repeat overlaps the Pribnow box from −9 to −5. These repeat elements are located within the region required for Agr regulation. The sea promoter was selected as a backbone for the incorporation of the sed repeat sequences to determine their effect on Agr responsiveness.
A series of promoters containing one or both repeat elements and a set with an extended downstream element to cover the entire Pribnow box were constructed. The sequences of the promoter elements and their CAT values are given in Table 6. The sea promoter is not under the control of the Agr system, in agreement with the findings of Tremaine et al. (35). Incorporation of the sed upstream repeat resulted in a hybrid promoter which displayed a significant level of Agr enhancement of transcription (pZS2964). Incorporation of the downstream element (pZS2963) or both 6-bp elements (pZS2965) did not result in significant Agr regulatory effects. When the sed downstream sequence was extended by 3 bp to include the entire sed Pribnow box, an Agr effect was detected when the upstream element was present (pDT26) but not when the upstream element was absent (pDT27). The high Agr stimulation index value observed with pDT26 is due in part to the low promoter activity detected with this construct.
TABLE 6.
Promoter activities of sea-sed hybrid promotersa
| Plasmid | Sequenceb | CAT values (Agr wt/Agr Δ)c | ASId |
|---|---|---|---|
| sea mutant promoters | |||
| pZS2962 (wt) | TAGACAAATATAAAAAGTGTATAGTAATATATGTATGTATAATTAAATG | 289.6 ± 7.1/305.6 ± 19.6 | 1.0 |
| pZS2963 | ----------------------------ATGAAA--------------- | 365.9 ± 18.6/316.0 ± 17.1 | 1.2 |
| pZS2964 | ATGAAA------------------------------------------- | 256.7 ± 23.2/164.8 ± 12.7 | 1.6* |
| pZS2965 | ATGAAA----------------------ATGAAA--------------- | 66.9 ± 4.4/56.9 ± 6.7 | 1.2 |
| pDT26 | ATGAAA------------------TATAATGAAA--------------- | 33.6 ± 1.1/4.8 ± 0.5 | 6.8* |
| pDT27 | ------------------------TATAATGAAA--------------- | 295.4 ± 26.1/235.8 ± 19.9 | 1.3 |
| sed mutant promoters | |||
| pZS2704 (wt) | ATGAAATGGATCAAATATATTGATATAATGAAAGTGAGCAAGTTGGATAGATTGCGGC | 131.7 ± 6.1/58.2 ± 2.5 | 2.3* |
| pDT28 | TAGACA--------------------------------------------- | 445.8 ± 24.8/333.4 ± 42.8 | 1.3* |
| pDT29 | TAGACA-----------------TAATATATGT------------------ | 256.9 ± 14.4/213.2 ± 10.7 | 1.2* |
| pDT30 | -----------------------TAATATATGT------------------ | 9.8 ± 0.7/3.9 ± 0.7 | 2.5* |
wt, wild type.
Boldface sequences are the −35 and −10 promoter elements. For hybrid promoters with the sea promoter as the backbone, the dashes represent bases identical to those in the wild-type sea sequence and the sed base substitutions are indicated. For hybrid promoters with the sed promoter as the backbone, the dashes represent bases identical to those in the wild-type sed sequence and the sea base substitutions are indicated.
Means ± standard deviations (in nanomoles per milligram of cell dry weight per minute). Each value represents the average of at least four determinants. Agr Δ, agr mutant.
ASI, Agr stimulation index (ratio of activity of the promoter in a wild-type host to that in an Agr deletion mutant). An asterisk indicates that results for agr mutant and agr+ hosts were significantly different.
The converse set of promoter constructs were made to determine whether loss of the repeat sequences is associated with loss of Agr regulation of the sed promoter. In this case, replacement of the upstream element (pDT28) or both elements (pDT29) resulted in loss of most of the Agr effect on transcription, although the small residual differences were still found to be statistically significant. In keeping with the results obtained with the sea-based promoters, replacement of only the downstream element (pDT30) did not result in a loss of the Agr effect.
Full acquisition of Agr enhancement of transcription by the sea promoter required both the upstream and the extended downstream elements. Substantial loss of Agr regulation of the sed promoter occurred when the upstream element or a combination of upstream and downstream elements were replaced with sea sequences.
Rot regulation of sed promoter element.
Rot has recently been identified as a global regulator (32). To determine whether rot has a regulatory role in enterotoxin D gene expression, an agr rot mutant strain was constructed by transduction of the inactivated rot allele (provided by P. J. McNamara) into the agr deletion strain. The agr rot mutant genotype was confirmed by its protease- and urease-positive phenotypes and by genotyping by PCR (data not shown). To test whether Rot has a regulatory effect on sed expression, the activity of the minimum sed promoter element was examined in rot mutant and agr rot mutant genetic backgrounds. The sea, lac, and rot promoter elements fused with cat were also transduced into the rot mutant and agr rot mutant genotypic backgrounds for comparisons. The results of these comparisons are listed in Tables 7 and 8. The staphylococcal lac promoter element is not affected by Rot. Rot appears to inhibit the transcription of both the sea and the sed promoters. The effect on the activity of the sea promoter was surprising, because expression of this enterotoxin gene was thought to be unregulated.
TABLE 7.
Rot and SigB effects on CAT values for sed, sea, lac, and rot promoters
| Phenotypea | CAT value (mean ± SD) forb:
|
|||
|---|---|---|---|---|
| sea (pZS2962) | sed (pZS2704) | lac (pZS2785) | rot (pDT41) | |
| Agr+ | 242.3 ± 20.8 | 131.7 ± 6.1 | 190.7 ± 12.8 | 194.1 ± 11.3 |
| Agr− | 214.7 ± 23.1 | 78.9 ± 3.6 | 180.5 ± 46.6 | 189.1 ± 12.1 |
| Agr+ Rot− | 221.4 ± 16.5 | 155.4 ± 6.7 | 193.8 ± 6.0 | 201.2 ± 7.7 |
| Agr− Rot− | 383.8 ± 24.9 | 155.0 ± 1.4 | 207.5 ± 20.1 | 142.2 ± 4.6 |
| Agr+ SigB+ | 426.2 ± 45.6 | 82.2 ± 12.2 | ND | 117.3 ± 9.8 |
| Agr+ SarA− | ND | 83.8 ± 9.8 | ND | 224.0 ± 30.3 |
| Agr− SarA− | ND | 58.9 ± 4.4 | ND | 96.0 ± 8.3 |
+, wild type; −, knockout.
CAT values are expressed in nanomoles of chloramphenicol acetylated per milligram (dry weight) of cells per minute. n ≥ 3, repeated. ND, not determined.
TABLE 8.
Rot and SigB effects on sed, sea, lac, and rot promoter activities
| Effect | Phenotypes of compared organismsa | Difference in activity level (fold)b
|
|||
|---|---|---|---|---|---|
| sea (pZS2962) | sed (pZS2704) | lac (pZS2785) | rot (pDT41) | ||
| Agr effect with Rot present | Agr+ Rot+ vs Agr− Rot+ | 1.0 | 1.7* | 1.1 | 1.0 |
| Rot effect independent of Agr | Agr− Rot− vs Agr− Rot+ | 1.3* | 2.0* | 1.1 | 0.8* |
| Agr effect independent of Rot | Agr− Rot− vs Agr+ Rot− | 1.2* | 1.0 | 1.1 | 0.7* |
| SigB effect | SigB+ Agr+ vs SigB− Agr+ | 1.7* | 0.6* | 0.6* | |
| SarA effect (Agr+) | SarA+ Agr+ vs SarA− Agr+ | 1.6* | 0.9 | ||
| SarA effect independent of Agr | SarA+ Agr− vs SarA− Agr− | 1.3* | 2.0* | ||
+, wild type; −, knockout.
An asterisk indicates a P value of <0.05 (pair sample, two-tailed t test).
The most important finding from this study is that the sed promoter does not exhibit any agr regulatory effect in the rot mutant background. This finding indicates that the reported Agr regulation of the sed promoter is an indirect action mediated through the Agr regulation of Rot activity. In agreement with the results of Saïd-Salim et al. (32), rot promoter activity is not transcriptionally regulated by Agr, (compare CAT values from the agr+ and agr mutant host strains with pDT41). The hybrid sed promoter bearing the lac spacer sequence (sed-lac-sed; pZS2859) was also transduced into rot mutant backgrounds, and the promoter activities obtained were 143.8 ± 2.0, 85.8 ± 12.5, 160.5 ± 16.0, and 153.2 ± 6.7 nmol/mg (dry weight) of cells/min for the wild-type, agr mutant, rot mutant, and agr rot mutant strains, respectively, and these values are also in agreement with the results for the sed wild-type promoter. The TG dinucleotide at position −14/−13 that was shown to be required for expression from the sed promoter with its weak −35 element (39) is retained in the sed-lac-sed hybrid promoter as a contribution from the lac spacer sequence, although the position is shifted to −16/−15 (Table 5).
Effect of Rot expression on promoter activities.
To examine whether Agr regulates Rot activity in a transcriptionally independent manner and to confirm that the sea, sed, and rot promoter elements are truly regulated by Rot, we tested whether the expression of rot from an Agr-independent promoter would influence the activity of the target promoters.
PCR was used to amplify the rot open reading frame, including its ribosome binding site, and this fragment was inserted into pCR2.1 (pDT32). To establish an unregulated constitutive and compatible expression system for rot with pMH109, the staphylococcal lac promoter (lacking its operator sequences) was employed and pE194 was used as the expression plasmid backbone. The rot expression plasmid (pDT34) and its negative control plasmid lacking the rot encoding sequence (pDT33) were transduced into the wild-type and agr rot mutant genotypic background strains. The strains were tested for protease and urease activities to confirm their Rot-negative phenotypes. The presence of the rot expression plasmid caused no phenotypic change in a wild-type background. In an agr rot mutant genetic background, the plasmid only partially rescued the urease phenotype (data not shown); however, it completely suppressed protease production (Fig. 2). This finding provides evidence that the Rot protein is produced in cells bearing pDT34. The sea, sed, and rot promoter-containing plasmids were then transduced into the rot expression plasmid-bearing strain and its negative control strains. The CAT values and fold differences are listed in Tables 9 and 10. The presence of the Rot expression plasmid reduced the activities of the sea and sed promoters relative to those in cells bearing the control vector. However, the activity of the rot promoter increased in the presence of pDT34, suggesting a positive transcriptional effect. No pDT34-associated changes were observed with the lac promoter. The experiments were repeated with a rot-negative host, in which all of the Rot protein would result from expression from pDT34. Again, the enterotoxin promoters showed reduced promoter activity and the rot promoter exhibited increased activity in the presence of pDT34. The repression of the sed promoter did not equal the twofold effect seen in wild-type cells. The effect of the pDT34-encoded Rot on the enterotoxin and rot promoters was not equivalent to the effect of the native copy of rot (see last row of Table 10), supporting the concept that the plasmid copy did not precisely mimic the wild-type condition. In agreement with this idea, the presence of pDT34 was insufficient to produce a Rot-positive (urease-negative) phenotype, so complementation by pDT34 is incomplete. Strains bearing the plasmids pDT33 and pDT34 were cultured in the presence of erythromycin to select for the presence of the plasmid. Given the potential effect of antibiotics on exoprotein gene transcription (13), the data obtained with pDT34 should be compared only to values for the control bearing pDT33, and these values should not be compared with values obtained from plasmid-free strains.
FIG. 2.
The protease activities of different genotypes as demonstrated on skim milk agar. Column 1, agr+ rot+ host cells; column 2, agr rot mutant host cells; row A, plasmid-free cells; row B, cells with pDT34 (rot expression plasmid); row C, cells with pDT33 (control vector).
TABLE 9.
CAT values for wild-type and agr rot mutant hosts with Rot expression plasmids
| Phenotypea | CAT value (avg ± SD) forb:
|
|||
|---|---|---|---|---|
| sed promoter | sea promoter | lac promoter | rot promoter | |
| Agr+ | 131.7 ± 6.1 | 242.3 ± 20.8 | 190.7 ± 12.8 | 194.1 ± 11.3 |
| Agr+ with pDT33 | 150.7 ± 12.0 | 243.7 ± 14.2 | 213.2 ± 26.7 | 218.8 ± 34.9 |
| Agr+ with pDT34 | 111.2 ± 6.4 | 184.2 ± 14.6 | 225.2 ± 13.8 | 487.8 ± 10.4 |
| Agr− | 78.9 ± 3.6 | 214.7 ± 23.1 | 180.5 ± 46.6 | 189.1 ± 12.1 |
| Agr+ Rot− | 155.4 ± 6.7 | 221.4 ± 16.5 | 193.8 ± 6.0 | 201.2 ± 7.7 |
| Agr− Rot− | 155.0 ± 1.4 | 383.8 ± 24.9 | 207.5 ± 20.1 | 142.2 ± 4.6 |
| Agr− Rot− with pDT33 | 157.0 ± 12.3 | 382.4 ± 12.8 | 182.8 ± 12.4 | 136.2 ± 30.6 |
| Agr− Rot− with pDT34 | 123.1 ± 4.2 | 310.2 ± 4.3 | 182.7 ± 11.0 | 221.4 ± 40.2 |
+, wild type; −, knockout; pDT34, Rot expression plasmid; pDT33, negative control of Rot expression plasmid.
CAT values are expressed as nanomoles of chloramphenicol acetylated per milligram (dry weight) of cells per minute (n ≥ 3, repeated).
TABLE 10.
Fold differences for wild type and agr rot mutant hosts with Rot expression plasmidsa
| Effect | Characteristics of compared organisms | Difference in activity level (fold)b
|
|||
|---|---|---|---|---|---|
| sed promoter | sea promoter | lac promoter | rot promoter | ||
| Rot regulation with Rot expression in Agr+ background | Agr+ with pDT33 vs Agr+ with pDT34 | 1.4* | 1.3* | 0.9 | 0.4* |
| Rot regulation with Rot expression in Agr− Rot− background | Agr− Rot− with pDT33 vs Agr− Rot− with pDT34 | 1.3* | 1.2* | 1.0 | 0.6* |
| Agr− Rot+ genetic background vs pDT34 in Agr− Rot− | Agr− vs Agr− Rot− with pDT34 | 0.7* | 0.7* | 1.0 | 1.2 |
+, wild type; −, knockout; pDT34, Rot expression plasmid; pDT33, negative control of Rot expression plasmid.
An asterisk indicates a P value of <0.05 (pair sample, two-tailed t test).
Effect of σB and SarA on sed promoter activity.
The stress response sigma factor (σB) is thought to be a regulator of virulence gene expression in S. aureus (5, 15). Derivatives of strain 8325-4 carry a small deletion in rsbU and do not, therefore, produce a functional σB (12, 15). The effect of a functional σB on the activity of the sed promoter was investigated by using an isogenic 8325-4 strain with the rsbU deletion repaired (GP269 [12], SigB+ in Tables 7 and 8). The sed promoter activity was reduced to 60% of the level obtained with the isogenic rsbU-negative strain parent strain. There was a corresponding reduction in rot promoter activity in the σB-positive strain, and therefore the reduction in sed promoter activity likely results from a Rot-independent mechanism. The effect of SarA on sed promoter activity was also examined (Tables 7 and 8). Strains lacking the SarA protein exhibited only two-thirds of the promoter activity of the isogenic SarA-producing strain. In the agr deletion strain, the loss of the SarA protein resulted in a 25% reduction in sed promoter activity. Part of the effect of SarA on sed transcription appears to be through an agr-independent mechanism. Interestingly, although inactivation of sarA or agr individually did not significantly affect the activity of the rot promoter, the loss of both the agr operon and sarA resulted in a twofold reduction in rot promoter activity.
DISCUSSION
The Agr system results in the postexponential phase activation of transcription of a variety of exoproteins and also reduces the expression of a number of cell wall-associated proteins. The kinetics of transcriptional activation and repression have been reported to differ, suggesting that different mechanisms may be involved in the two activities (36). Activation of the Agr system results in the elevated intracellular accumulation of RNAIII. The mechanisms of transcription activation and attenuation following RNAIII accumulation remain unknown. We have examined the promoter sequence of the Agr-regulated enterotoxin D determinant of S. aureus. A small DNA fragment extending from the −35 promoter element to +17 has been shown to retain all of the expression and Agr regulation properties (39). In searching for the Agr cis element of this promoter, we found that the spacer sequence between the −35 and Pribnow box elements of the promoter was not involved in Agr regulation. Furthermore, sequences distal to the +1 site were also not involved. Only the −35 element and the Pribnow box region remained as candidates. Included in these sequences was a directly repeated 6-bp sequence (ATGAAA). The creation of hybrid promoters by use of the sed promoter and the Agr-unregulated sea promoter allowed the evaluation of the contribution of these repeats in the Agr regulation of this enterotoxin gene.
Although the results of this study suggest that these repeats are important for the Agr system's effects on sed transcription, clear-cut results were not obtained. The reason for this lack of clear-cut results lies in the nature of the Agr system itself. The Agr-regulated exotoxin genes are all expressed from poorly to moderately expressed promoter elements. The Agr system may be a means of upregulating poorly transcribed virulence factors. Therefore, the effects mediated by Agr may be masked as promoter activity is increased. A problem with the enterotoxin D promoter fragment is that base changes or substitutions associated with the hybrid promoters often have dramatic effects on promoter strength. In those cases in which promoter activity was reduced, we usually obtained a larger Agr stimulatory index value. The repeat sequence does not also appear to be a common feature of Rot-regulated genes based on examination of promoter-region sequences of Rot-regulated genes.
Rot was identified by a transposon insertion which activated protease and alpha-toxin activity in an agr null mutant (24). Because of Rot's effects on these Agr-regulated exotoxins, we evaluated its activity on enterotoxin D expression. We found that all of the reported Agr effect on enterotoxin D gene transcription can be explained by the control of Rot activity by the Agr system. There is no postexponential stimulation of sed transcription in rot-negative strains of S. aureus. Transcription of the rot determinant has been shown to be independent of the Agr system; however, the activated Agr system downregulates the activity of Rot by an undefined mechanism (24, 32). One possibility is that Rot is an RNAIII-binding protein and that the activation of Agr and its associated intracellular accumulation of RNAIII may titrate Rot away from its gene targets, as originally proposed by McNamara et al. (24).
In the course of these studies, we also found suggestive evidence that Rot has a modest, but reproducible, effect on sea expression, a determinant which has been shown not to be influenced by Agr.
Acknowledgments
We thank Peter McNamara for providing the PM466 and PM783 strains, Markus Bischoff for providing strain GP269, and Mark Smeltzer for providing strain UAMS-979. We thank David George for technical assistance with the DNA sequencer.
This work was supported by Public Health Services grant AI45778 from the National Institutes of Health.
Footnotes
Contribution 03-409-J from the Kansas Agricultural Experiment Station.
REFERENCES
- 1.Arvidson, S., and K. Tegmark. 2001. Regulation of virulence determinants in Staphylococcus aureus. Int. J. Med. Microbiol. 291:159-170. [DOI] [PubMed] [Google Scholar]
- 2.Bayles, K. W., and J. J. Iandolo. 1989. Genetic and molecular analyses of the gene encoding staphylococcal enterotoxin D. J. Bacteriol. 171:4799-4806. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Benito, Y., F. A. Kolb, P. Romby, G. Lina, J. Etienne, and F. Vandenesch. 2000. Probing the structure of RNAIII, the Staphylococcus aureus agr regulatory RNA, and identification of the RNA domain involved in repression of protein A expression. RNA 6:668-679. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Bergdoll, M. S., J. K. Czop, and S. S. Gould. 1974. Enterotoxin synthesis by the staphylococci. Ann. N. Y. Acad. Sci. 236:307-316. [DOI] [PubMed] [Google Scholar]
- 5.Bischoff, M., J. M. Entenza, and P. Giachino. 2001. Influence of a functional sigB operon on the global regulators sar and agr in Staphylococcus aureus. J. Bacteriol. 183:5171-5179. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Blevins, J. S., K. E. Beenken, M. O. Elasri, B. K. Hurlburt, and M. S. Smeltzer. 2002. Strain-dependent differences in the regulatory roles of sarA and agr in Staphylococcus aureus. Infect. Immun. 70:470-480. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Bodi, M., C. Ardanuy, and J. Rello. 2001. Impact of gram-positive resistance on outcome of nosocomial pneumonia. Crit. Care Med. 29(Suppl. 4):N82-N86. [DOI] [PubMed] [Google Scholar]
- 8.Borst, D. W., and M. J. Betley. 1994. Promoter analysis of the staphylococcal enterotoxin A gene. J. Biol. Chem. 269:1883-1888. [PubMed] [Google Scholar]
- 9.Chien, Y., and A. L. Cheung. 1998. Molecular interactions between two global regulators, sar and agr, in Staphylococcus aureus. J. Biol. Chem. 273:2645-2652. [DOI] [PubMed] [Google Scholar]
- 10.Dunman, P. M., E. Murphy, S. Haney, D. Palacios, G. Tucker-Kellogg, S. Wu, E. L. Brown, R. J. Zagursky, D. Shlaes, and S. J. Projan. 2001. Transcription profiling-based identification of Staphylococcus aureus genes regulated by the agr and/or sarA loci. J. Bacteriol. 183:7341-7353. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Gaskill, M. E., and S. A. Khan. 1988. Regulation of the enterotoxin B gene in Staphylococcus aureus. J. Biol. Chem. 263:6276-6280. [PubMed] [Google Scholar]
- 12.Giachino, P., S. Engelmann, and M. Bischoff. 2001. σB activity depends on RsbU in Staphylococcus aureus. J. Bacteriol. 183:1843-1852. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Herbert, S., P. Barry, and R. P. Novick. 2001. Subinhibitory clindamycin differentially inhibits transcription of exoprotein genes in Staphylococcus aureus. Infect. Immun. 69:2996-3003. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Horinouchi, S., and B. Weisblum. 1982. Nucleotide sequence and functional map of pE194, a plasmid that specifies inducible resistance to macrolide, lincosamide, and streptogramin type B antibiotics. J. Bacteriol. 150:804-814. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Horsburgh, M. J., J. L. Aish, I. J. White, L. Shaw, J. K. Lithgow, and S. J. Foster. 2002. σB modulates virulence determinant expression and stress resistance: characterization of a functional rsbU strain derived from Staphylococcus aureus 8325-4. J. Bacteriol. 184:5457-5467. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Hudson, M. C., and G. C. Stewart. 1986. Differential utilization of Staphylococcus aureus promoter sequences by Escherichia coli and Bacillus subtilis. Gene 48:93-100. [DOI] [PubMed] [Google Scholar]
- 17.Janzon, L., and S. Arvidson. 1990. The role of the δ-lysin gene (hld) in the regulation of virulence genes by the accessory gene regulator (agr) in Staphylococcus aureus. EMBO J. 9:1391-1399. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Ji, G., R. C. Beavis, and R. P. Novick. 1995. Cell density control of staphylococcal virulence mediated by an octapeptide pheromone. Proc. Natl. Acad. Sci. USA 92:12055-12059. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Kornblum, J., B. N. Kreiswirth, S. J. Projan, H. Ross, and R. P. Novick. 1990. Agr: a polycistronic locus regulating exoproteins synthesis in Staphylococcus aureus, p. 370-402. In R. P. Novick (ed.), Molecular biology of the staphylococci. VCH Publishers, New York, N.Y.
- 20.Kreiswirth, B. N., S. Lofdahl, M. J. Betley, M. O'Reilly, P. M. Schlievert, M. S. Bergdoll, and R. P. Novick. 1983. The toxic shock syndrome exotoxin structural gene is not detectably transmitted by a prophage. Nature 305:709-712. [DOI] [PubMed] [Google Scholar]
- 21.Lina, G., S. Jarraud, G. Ji, T. Greenland, A. Pedraza, J. Etienne, R. P. Novick, and F. Vandenesch. 1998. Transmembrane topology and histidine protein kinase activity of AgrC, the agr signal receptor in Staphylococcus aureus. Mol. Microbiol. 28:655-662. [DOI] [PubMed] [Google Scholar]
- 22.Mamood, R., and S. A. Khan. 1990. Role of upstream sequences in the expression of the staphylococcal enterotoxin B gene. J. Biol. Chem. 265:4652-4656. [PubMed] [Google Scholar]
- 23.Mandal, S., A. R. Berendt, and S. J. Peacock. 2002. Staphylococcus aureus bone and joint infection. J. Infect. 44:143-151. [DOI] [PubMed] [Google Scholar]
- 24.McNamara, P. J., K. C. Milligan-Monroe, S. Khalili, and R. A. Proctor. 2000. Identification, cloning, and initial characterization of rot, a locus encoding a regulator of virulence factor expression in Staphylococcus aureus. J. Bacteriol. 182:3197-3203. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Novick, R. P., H. F. Ross, S. J. Projan, J. Kornblum, B. Kreiswirth, and S. L. Moghazeh. 1993. Synthesis of staphylococcal virulence factors is controlled by a regulatory RNA molecule. EMBO J. 12:3967-3975. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Omoe, K., D.-L. Hu, H. Takahashi-Omoe, A. Nakane, and K. Shinagawa. 2003. Identification and characterization of a new staphylococcal enterotoxin-related putative toxin encoded by two kinds of plasmids. Infect. Immun. 71:6088-6094. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Orwin, P. M., D. Y. Leung, T. J. Tripp, G. A. Bohach, C. A. Earhart, D. H. Ohlendorf, and P. M. Schlievert. 2002. Characterization of a novel staphylococcal enterotoxin-like superantigen, a member of the group V subfamily of pyrogenic toxins. Biochemistry 41:14033-14040. [DOI] [PubMed] [Google Scholar]
- 28.Oskouian, B., and G. C. Stewart. 1990. Repression and catabolite repression of the lactose operon of Staphylococcus aureus. J. Bacteriol. 172:3804-3812. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Regassa, L. B., J. L. Couch, and M. J. Betley. 1991. Steady-state staphylococcal enterotoxin type C mRNA is affected by a product of the accessory gene regulator (agr) and by glucose. Infect. Immun. 59:955-962. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Rubin, S. J., and E. D. Rosenblum. 1971. Effects of the recipient strain and ultraviolet irradiation on transduction kinetics of the penicillinase plasmid of Staphylococcus aureus. J. Bacteriol. 108:1192-1199. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Rush, M., R. Novick, and R. DeLap. 1975. Detection and quantitation of Staphylococcus aureus penicillinase plasmid deoxyribonucleic acid by reassociation kinetics. J. Bacteriol. 124:1417-1423. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Saïd-Salim, B., P. Dunman, F. McAleese, D. Macapagal, E. Murphy, P. McNamara, S. Arvidson, T. Foster, S. Projan, and B. Kreiswirth. 2003. Global regulation of Staphylococcus aureus genes by Rot. J. Bacteriol. 185:610-619. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33.Schenk, S., and R. A. Laddaga. 1992. Improved method for electroporation of Staphylococcus aureus. FEMS Microbiol. Lett. 94:133-138. [DOI] [PubMed] [Google Scholar]
- 34.Shaw, W. V. 1975. Chloramphenicol acetyltransferase from chloramphenicol-resistant bacteria. Methods Enzymol. 43:737-755. [DOI] [PubMed] [Google Scholar]
- 35.Tremaine, M. T., D. K. Brockman, and M. J. Betley. 1993. Staphylococcal enterotoxin A gene (sea) expression is not affected by the accessory gene regulator (agr). Infect. Immun. 61:356-359. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Vandenesch, F., J. Kornblum, and R. P. Novick. 1991. A temporal signal, independent of agr, is required for hla but not spa transcription in Staphylococcus aureus. J. Bacteriol. 173:6313-6320. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37.Zhang, L., L. Gray, R. P. Novick, and G. Ji. 2002. Transmembrane topology of AgrB, the protein involved in the post-translational modification of AgrD in Staphylococcus aureus. J. Biol. Chem. 277:34736-34742. [DOI] [PubMed] [Google Scholar]
- 38.Zhang, S., J. J. Iandolo, and G. C. Stewart. 1998. The enterotoxin D plasmid of Staphylococcus aureus encodes a second enterotoxin determinant (sej). FEMS Microbiol. Lett. 168:227-233. [DOI] [PubMed] [Google Scholar]
- 39.Zhang, S., and G. C. Stewart. 2000. Characterization of the promoter elements for the staphylococcal enterotoxin D gene. J. Bacteriol. 182:2321-2325. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 40.Zhang, S., and G. C. Stewart. 2001. Enterotoxins, p. 117-136. In A. L. Honeyman, H. Friedman, and M. Bendinelli (ed.), Staphylococcus aureus and infection. Plenum Press, New York, N.Y.