Skip to main content
PLOS One logoLink to PLOS One
. 2013 Jan 30;8(1):e54617. doi: 10.1371/journal.pone.0054617

Anti-Obesity Effect of Lactobacillus gasseri BNR17 in High-Sucrose Diet-Induced Obese Mice

Ji-Hee Kang 1,*, Sung-Il Yun 1, Mi-Hee Park 1, Jun-Hong Park 1, So-Young Jeong 1, Han-Oh Park 1
Editor: Kathrin Maedler2
PMCID: PMC3559800  PMID: 23382926

Abstract

Previously, we reported that Lactobacillus gasseri BNR17 (BNR17), a probiotic strain isolated from human breast milk, inhibited increases in body weight and adipocyte tissue weight in high-sucrose diet-fed Sprague-Dawley (SD) rats and reduced glucose levels in type 2 diabetes mice. In the current study, we conducted further experiments to extend these observations and elucidate the mechanism involved. C57BL/6J mice received a normal diet, high-sucrose diet or high-sucrose diet containing L. gasseri BNR17 (109 or 1010 CFU) for 10 weeks. The administration of L. gasseri BNR17 significantly reduced the body weight and white adipose tissue weight regardless of the dose administered. In BNR17-fed groups, mRNA levels of fatty acid oxidation-related genes (ACO, CPT1, PPARα, PPARδ) were significantly higher and those of fatty acid synthesis-related genes (SREBP-1c, ACC) were lower compared to the high-sucrose-diet group. The expression of GLUT4, main glucose transporter-4, was elevated in BNR17-fed groups. L. gasseri BNR17 also reduced the levels of leptin and insulin in serum. These results suggest that the anti-obesity actions of L. gasseri BNR17 can be attributed to elevated expression of fatty acid oxidation-related genes and reduced levels of leptin. Additionally, data suggested the anti-diabetes activity of L. gasseri BNR17 may be to due elevated GLUT4 and reduced insulin levels.

Introduction

Obesity is caused by a multiple factors, including genetic, metabolic, behavioral and cultural factors. More specifically, a high fat intake and low energy expenditure are the main causes of obesity, as well as metabolic disorders such as insulin resistance, type 2 diabetes, and cardiovascular diseases [1], [2]. A variety of programs and treatments including drug therapeutics, surgical intervention and dietary control for obesity management or prevention have been developed; however, these are often associated with safety issues. Therefore, the development of a safe and effective dietary supplement to assist with body weight management is essential.

Lactobacilli and bifidobacteria are representative probiotic microorganisms that benefit human health through modulation of the immune system [3], prevention of cancer [4], enhancement of intestinal functions [5] and a hypocholesterolemic effect [6]. Recently, some studies have expended the functionality of probiotics to obesity management. Some probiotics have been demonstrated to have an anti-obesity property by regulating lipid and glucose metabolism [7], [8], producing conjugated linoleic acid [9], [10], reducing the adipocyte size and increasing the number of small adipocytes in white adipose tissue [11], and regulating leptin [12].

We have observed the effects of L. gasseri BNR17, a probiotic strain isolated from human breast milk, on the high-sucrose diet-fed SD rat and transgenic db/db mouse [13], [14]. In those studies, L. gasseri BNR17 suppressed the body weight and fat weight gain, fasting and postprandial blood glucose, and improved oral glucose tolerance. The purpose of the current study was to extend these observations and elucidate the mechanism involved in the anti-obesity activity of L. gasseri BNR17. We investigated the impact of L. gasseri BNR17 on body weight gain, fat accumulation, and mRNA expression of obesity-related genes in diet-induced obese mice.

Materials and Methods

Animals and Experiment

Male C57BL/6J mice (6-week-old, n = 8 per group) were obtained from Central Lab Animal Inc. (Seoul, South Korea). All animals were housed in standard plastic cages (two mice per cage), and maintained under a 12-h light-dark cycle at constant temperature and humidity (23±1°C and 55±5%, respectively) with free access to food and water. This study was carried out in accordance with the recommendations in the guide for the care and use of the Animal, Plant and Fisheries Quarantine and Inspection Agency (Republic of Korea). The protocol was approved by the Committee on the Ethics of Animal Experiments of the Bioneer Corporation (AEC-20081229-0004). Following acclimatization for 1 week, the mice were fed a normal diet (ND) (2918C, containing 6.0% fat and 18.5% protein by weight; Koatech Animal Inc., Pyeongtaek, South Korea), or a high-sucrose diet (HSD) (AIN-76A, 5.0% fat, 50.0% sucrose, 15.0% cornstarch and 20.0% protein by weight; Central Lab Animal Inc.), or high-sucrose diet and BNR17 109 CFU (HSD+BNR17(9)) or 1010 CFU (HSD+BNR17(10)) for 10 weeks. L. gasseri BNR17 was prepared fresh daily and orally administered twice per day. Body weight and food intake were measured once a week. At the end of the 10-week treatment period, mice were killed by cervical dislocation after blood gathering. Liver, spleen, kidney, and adipose tissues (mesenteric, subcutaneous, epididymal, perirenal) were dissected precisely and weighed. An in vivo CT analysis (Inveon™, Siemens Medical Solutions USA Inc.) was carried out prior the killing of animals under 1.5–2% isoflurane in O2 anesthesia.

Real-time PCR Analysis

RNA was extracted from ∼0.1 g of tissues using the RNeasy Mini kit (Qiagen) for liver and RNeasy Lipid Tissue Mini kit (Qiagen) for white adipose tissue, according to the manufacturer’s protocols. cDNA was synthesized using the Accupower® Rocketscript™ Cycle RT Premix kit from Bioneer (Daejeon, South Korea). qPCR was performed using an Exicycler (Bioneer) with Accupower® 2× Greenstar qPCR Master Mix (Bioneer). Primer sequences for the targeted mouse genes are listed in Table 1.

Table 1. Primer sequences of mouse mRNA.

Target gene Forward Primer (5′–3′) Reverse Primer (5′–3′) Ref.
PPARα GTACGGTGTGTATGAAGCCATCTT GCCGTACGCGATCAGCAT [15]
PPARδ GCCATATTCCCAGGCTGTC CAGCACAAGGGTCATCTGTG
CPT1 GTGACTGGTGGGAGGAATAC GAGCATCTCCATGGCGTAG
ACO GTGCAGCTCAGAGTCTGTCCAA TACTGCTGCGTCTGAAAATCCA
UCP3 CCAGAGCATGGTGCCTTCGCT CTCGTGTCAGCAGCAGTG
GLUT4 GGAAGGAAAAGGGCTATGCTG TGAGGAACCGTCCAAGAATGA
SREBP-1c ACGGAGCCATGGATTGCACA AAGGGTGCAGGTGTCACCTT
ACC ATGGGCGGAATGGTCTCTTTC TGGGGACCTTGTCTTCATCAT
LPL CCACAGCAGCAAGACCTTC AGGGCGGCCACAAGTTTG
FAS TGCTCCCAGCTGCAGGC GCCCGGTAGCTCTGGGTGTA
Adiponectin GAGATGCAGGTCTTCTTGGTC GCTCTCCTTTCCTGCCAG
TNF-α AAGCCTGTAGCCCACGTCGTA GGCACCACTAGTTGGTTGTCTTTG
ANGPTL4 AAAGAGGCTGCCCGAGAT TCTCCCCAACCTGGAACA
β-Actin GAGCGCAAGTACTCTGTGTG CGGACTCATCGTACTCCTG

PPARα, peroxisome proliferator-activated receptor α; PPARδ, peroxisome proliferator-activated receptor δ; CPT, carnitine palmitoyl-transferase; ACO, acyl CoA oxidase; UCP3, uncoupling proteins3; GLUT4, glucose transporter 4; SREBP-1c, sterol regulatory element-binding protein-1c; ACC, acetyl-CoA carboxylase; FAS, fatty acid synthetase; PPARγ, peroxisome proliferator-activated receptor γ; LPL, lipoprotein lipase; TNF-α, tumor necrosis factor-α.

Biochemical Analyses

Endocrine peptides (ghrelin, GIP, GLP-1, glucagon, insulin, leptin) were determined using a Bio-Plex suspension array system (Luminex, Austin, USA). Metabolic parameters including glucose, total cholesterol, HDL-cholesterol, and LDL-cholesterol levels in serum were analyzed using a Clinical Analyzer 7020 (HITACHI, Tokyo, Japan).

Measurement of Adipocyte Size

Adipocyte sizes in the mesenteric, subcutaneous, epididymal and perirenal adipose tissue were measured in paraffin-embedded tissue. Briefly, adipocyte tissues were fixed in 10% neutral formalin solution, embedded in paraffin, cut into 4-µm sections, and stained with hematoxylin and eosin. Cell sizes were measured using a DIXI3000 (Leica, Wetzlar, Germany).

Statistical Analysis

The data were expressed as mean values with their standard errors. Analyses were performed using pairwise t-tests and Wilcoxon rank sum tests. Differences were considered to be statistically significant at values of P<0.05.

Results

L. gasseri BNR17 Inhibits High-sucrose Diet-induced Body Weight Gain and Fat Weight Accumulation

High-sucrose diet feeding induced significant body weight gain throughout the study period compared to the ND group (Figure 1A and Table 2). The administration of BNR17 induced less body weight gain than the HSD group, although not in a dose-dependent manner. Food intake differed significantly between the ND and HSD groups (Figure 1B and Table 2); whereas no significant differences were observed in daily food intake between the HSD and HSD+BNR17 groups. Moreover, energy intake were similar for all groups. This suggests that BNR17 contributed to the reduced body weight gain. Total cholesterol and LDL-cholesterol in the HSD group and HSD+BNR17 groups increased compared to the ND group; however, no significant reduction was caused by BNR17 administration (Table 2). In addition, glucose levels did not change with BNR17 administration. High-sucrose diet also induced increased adipose tissue weight as compared with normal diet feeding (Table 2). BNR17 administration significantly suppressed the increase of fat mass in all white adipose tissues, including mesenteric, subcutaneous, epididymal and perirenal adipose tissue (Table 2). Further, CT imaging showed a significant reduction in body fat profile with BNR17 treatment (Figures 1C and D). Moreover, HE staining of white adipose tissues revealed that supplementation with BNR17 was associated with a significant reduction in average adipocyte size in mesenteric, subcutaneous, epididymal and perirenal adipose tissues, as compared with the HSD group (Figures 1E and F).

Figure 1. L. gasseri BNR17 supplementation decreases high-sucrose diet-induced body weight gain and fat mass accumulation.

Figure 1

(A) Change in body weight, (B) change in food intake, (C) representative CT scanning images of abdominal (left) and whole body (right) fat accumulation (in black) at 10 weeks (D) correspond to the volume of subcutaneous and abdominal fat, (E) representative adipose tissue-staining images in mice of four groups, (F) adipocyte mean area (µm2). Data represent the means ± SD. Pairwise t-test: *P<0.05, **P<0.01, ***P<0.001 versus the ND group; # P<0.05, ## P<0.01, ### P<0.001 versus the HSD group.

Table 2. Body weight, fat weight and organs weight of mice fed the experimental diets for 10 weeks.

ND HSD HSD+BNR17(9) HSD+BNR17(10)
Initial body weight (g) 22.41±1.06 22.88±1.20 22.44±1.19 22.90±0.77
Final body weight (g) 27.63±1.77 30.59±1.46** 27.98±1.93## 28.35±0.93#
Food intake(g/mouse/day) 3.15±0.20 2.57±0.15*** 2.58±0.14*** 2.47±0.16***
Energy intake(kcal/mouse/day) 9.75±0.63 9.74±0.56 9.78±0.53 9.36±0.60
Mesenteric fat pad (g) 0.27±0.10 0.44±0.10** 0.29±0.08## 0.37±0.05
Subcutaneous fat pad (g) 0.64±0.10 1.15±0.22*** 0.73±0.15### 0.95±0.13**
Epididymal fat pad (g) 0.78±0.17 1.11±0.23** 0.80±0.20## 0.87±0.14
Perirenal fat pad (g) 0.43±0.12 0.65±0.14** 0.47±0.14# 0.55±0.10
Liver weight (g) 1.16±0.13 1.18±0.09 1.01±0.09* , ## 1.06±0.15
Spleen weight (g) 0.16±0.03 0.18±0.02 0.15±0.02# 0.16±0.02
Kidney weight (g) 0.30±0.02 0.29±0.01 0.28±0.02 0.29±0.02
Cholesterol 140.57±12.88 192.00±24.60** 177.63±19.30** 188.18±18.88**
HDL-cholesterol 69.22±4.91 75.00±4.60 79.28±7.91* 79.32±8.16
LDL-cholesterol 6.19±0.95 18.2±3.40** 16.47±3.44** 18.34±3.20**
Glucose 209.63±30.29 204.00±32.70 200.06±62.73* 214.21±56.52

C57BL/6J mice were fed a normal diet (ND), a high-sucrose diet (HSD) or a HSD containing L. gasseri BNR17 (109 or 1010 CFU) for 10 weeks. After measurement of body weight and feed intake, the white adipose tissue, liver, spleen and kidney were removed and weighed. Data represent the means ± SD of eight mice per group. Pairwise t-test:

*

P<0.05,

**

P<0.01,

***

P<0.001 versus the ND group;

#

P<0.05,

##

P<0.01,

###

P<0.001 versus the HSD group.

L. gasseri BNR17 Affects the mRNA Expression of Obesity and Diabetes-related Genes in Liver and White Adipose Tissue

The effect of BNR17 on the expression of obesity-related genes was investigated using real-time RT-PCR. The mRNA expressions of ACO, CPT1, PPARα, PPARδ and ANGPTL4 were significantly higher in the BNR17 groups compared to the HSD group (Figure 2). Furthermore, mRNA expressions of ACC and SREBP-1c showed tendencies to be lower in BNR17 groups.

Figure 2. L. gasseri BNR17 affects mRNA expression in the liver.

Figure 2

C57BL/6J mice were given ND, HSD, or HSD containing BNR17 (109 or 1010 CFU) for 10 weeks. The liver was then removed and mRNA expression was measured by real-time RT-PCR using β-actin as a housekeeping gene. Data represent the means ± SD. Pairwise t-test: *P<0.05, **P<0.01, versus the ND group; # P<0.05, ## P<0.01 versus the HSD group.

The mRNA expressions of adiponectin, UCP3, LPL, PPARγ and TNF-α in white adipose tissue were measured. There were no significant differences between the HSD and BNR17-fed groups (Figure 3). However, the mRNA expression of GLUT4 was higher in the BNR17 groups compared with the HSD group.

Figure 3. L. gasseri BNR17 affects mRNA expression in white adipose tissue.

Figure 3

C57BL/6J mice were given ND, HSD, or HSD containing BNR17 (109 or 1010 CFU) for 10 weeks. The white adipose tissue was then removed and mRNA expression was measured by real-time RT-PCR using β-actin as a housekeeping gene. Data represent the means ± SD. Pairwise t-test: *P<0.05, **P<0.01 versus the ND group; # P<0.05 versus the HSD group.

L. gasseri BNR17 Reduces the Levels of Leptin and Insulin in Serum

The effect of BNR17 on the gastrointestinal hormones involved in body weight control was investigated. The level of leptin increased in the HSD group compared to the ND group; however it decreased in BNR17-fed groups (Figure 4). Similarly, the level of insulin was significantly lower in BNR17-administered mice. Levels of other hormones among the HSD group and BNR17-fed groups were not different.

Figure 4. L. gasseri BNR17 affects endocrine hormones.

Figure 4

C57BL/6J mice were given ND, HSD, or HSD containing BNR17 (109 or 1010 CFU) for 10 weeks. Serum was obtained by centrifugation of whole blood and analyzed. GIP, glucose-dependent insulinotropic polypeptide; GLP, glucagon-like peptide. Data represent the means ± SD. Wilcoxon rank-sum test: *P<0.05, **P<0.01, ***P<0.001 versus the ND group; # P<0.05, ## P<0.01 versus the HSD group.

Discussion

Although there was no difference in food and energy intake between the HSD group and BNR17 groups (Figure 1B and Table 2), the increase in body weight was suppressed in the BNR17 groups (Figure 1A and Table 2). There was a significant reduction in subcutaneous and abdominal fat mass in BNR17-fed groups compared to the HSD group (Figure 1C and D). Subcutaneous fat and abdominal fat are the major types of white adipose tissue. Abdominal obesity is associated with increased risk of insulin resistance and cardiovascular diseases, whereas increased subcutaneous fat correlates with a favorable plasma lipid profile [16], [17]. Indeed, the mean adipocyte sizes of all white adipose tissues were remarkably reduced in BNR17-fed mice (Figures 1E and F). Subcutaneous adipocytes are the main source of leptin and adiponectin [16]. Leptin is an adipocyte hormone that controls body weight by regulating food intake and energy expenditure [18], [19]. Leptin concentrations are correlated with the percentage of body fat; higher serum levels have been found in obese individuals compared with non-obese individuals [20]. BNR17 suppressed the elevation of plasma leptin (Figure 3), suggesting that the reductions in fat mass and body weight are associated with a reduction in leptin. Similar effects have been observed in other studies [9], [20], [21]. For the liver, the weight reduction were observed in BNR17 groups (Table 2), however HE staining and O-red staining of liver tissue did not show any changes between groups (Data not shown).

In this study, glucose was not change between groups. In the paper that investigated the role of fatty acid composition in the development of metabolic disorders in sucrose-induced obese rates, the different time courses of the increases in plasma glucose, insulin, and triglycerides during the course of developing obesity suggest that some time- or tissue-dependent process is necessary to induce these metabolic abnormalities [22].

Some studies have reported that the feeding of a low-protein, high-carbohydrate diet (6% protein and 74% carbohydrate) induced an increase in lipid content in the whole carcass, epididymal adipose tissue and retroperitoneal adipose tissue [23][25]. Long-term (16 weeks) feeding of a high-sucrose (65%) diet to C57BL/6 mice induced obesity, hepatic steatosis, and insulin resistance [26]. In Asian populations, including Koreans, Chinese and Japanese, the traditional diet is characterized as being high in carbohydrate rather than fat, thus the increasing prevalence of obesity is associated with a high carbohydrate intake. Among Korean adults, a high carbohydrate intake is inversely associated with HDL-cholesterol [27]. In the current study, significant increases in body weight and fat mass in HSD groups were induced for 10 weeks as compared to the normal diet (Figure 1 and Table 2), and increases in lipid profile (total cholesterol, LDL- and HDL-cholesterol) were induced by high-sucrose diet feeding.

Because obesity results from low energy expenditure and increased fatty acid synthesis, we measured the mRNA expression levels of related genes in liver and white adipose tissues. In the liver, the administration of BNR17 significantly increased mRNA expression of ACO, CPT1, ANGPTL4, PPARα and PPARδ, as compared to the HSD group (Figure 2). ACO and CPT1 are considered to be rate-limiting enzymes in mitochondrial fatty acid oxidation [28] and ANGPTL4 is a circulating lipoprotein lipase (LPL) inhibitor that controls triglyceride deposition into adipocytes [29]. These genes are target genes of PPARs, which have essential roles in energy homeostasis and adipogenesis [30], and their expression is increased by the activation and elevation of PPARα and PPARδ, resulting in anti-obesity effects. Excess adipose tissue mass is caused mainly by the differentiation of precursor cells into new adipocytes (adipogenesis). Several transcription factors including CCAAT/enhancer binding protein-α (C/EBPα), PPARγ, SREBP-1c are involved in this process [31]. PPARγ regulates the expression of adipocyte genes such as adipocyte-fatty acid binding protein (A-FABP) [32], and SREBP-1c controls the expression of lipogenic genes such as FAS and ACC [33], [34]. We observed tendencies for reduced SREBP-1c and ACC in the BNR17-fed groups compared to the HSD group; however, we did not detect a reduction in mRNA expression of FAS, the rate-limiting enzyme of fatty acid synthesis in the liver (Figure 2). Moreover, PPARγ and LPL, which are related to fat intake, did not differ among the HSD group and BNR17-fed groups (Figure 3). Therefore, it seems that the anti-obesity effect of BNR17 is responsible for the increased expression of fatty acid metabolism-related genes rather than reduced fatty acid synthesis and fat intake in the liver.

In this study, BNR17 did not show dose-dependent suppression of body weight and fat mass gain as there was no significant difference in biomarkers between the BNR17(9) and BNR17(10) groups. This suggests that BNR17 exhibits anti-obesity activity at doses >109 CFU. This is not consistent with a previous study of the dose-dependent anti-diabetic activity of BNR17 in db/db mice [14]. Although we did not clarify the reason in this study, recently, it has been reported that immunomodulation of dendritic cells by probiotics showed very different profiles according to the bacterial inoculum, so the probiotic effect may differ depending on the frequency and size of doses ingested [35]. This means that the determination of the optimal effective dose of probiotics may be required for the future development of commercial products.

Interestingly, we observed changes in several diabetes-related biomarkers in this study. GLUT4 is one of the main glucose transporters expressed in skeletal muscle and adipose tissue. An increase in GLUT4 expression in skeletal muscle is known to ameliorate insulin resistance associated with obesity or diabetes [36], while it has been reported that adipose GLUT4 gene expression changes were more related to insulin resistance and type 2 diabetes rather than obesity [37]. In our study, BNR17 significantly increased GLUT4 mRNA expression in white adipose tissue (Figure 3). Furthermore, the insulin level increased in the HSD group, which was decreased significantly by BNR17 supplementation (Figure 4). In the case of pre-diabetes, increases in blood glucose stimulate the secretion of insulin and subsequently induce hyperinsulinemia with a normal blood glucose range. Hyperinsulinemia is frequently accompanied by obesity, and a biomarker of insulin resistance [38]. It is expected that the regulation of GLUT4 and insulin can likely be attributed to the anti-diabetes activity of BNR17.

Recently, many studies have reported the preventive activity of probiotic lactic acid bacteria on obesity and metabolic syndrome. L. plantarum KY1032 cell extract reduced fat mass by modulating adipogenesis in maturing preadipocytes [31]. L. paracasei decreased fat storage by increasing the level of ANGPTL4 [29]. VSL no. 3, a mixture of bifidobacteria, lactobacilli and Streptococcus thermophilus, improved diet-induced obesity, hepatic steatosis and insulin resistance by increasing hepatic natural killer T-cells and reducing inflammatory signaling in mice [39]. On the other hand, it was reported recently that gut microbes play an important role in body weight regulation. Endogenous Bifidobacterium spp. were significantly and positively correlated with improved glucose tolerance, glucose-induced insulin secretion and normalized inflammatory tone (decreased endotoxemia, plasma and adipose tissue proinflammatory cytokines) in high-fat-diet and prebiotic-treated mice [40]. Whether supplementation with exogenous probiotic strains has the same mechanism of action is unclear [41]. However, Lactobacillus and Bifidobacteria are main members of the gut microbiota, and therefore it is worthwhile to investigate the effect of probiotics on the relationship between the gut microbiota and obesity or obesity-related diseases. In summary, the probiotic L. gasseri BNR17 lowered body weight and adiposity by increasing the expression of fatty-acid oxidation genes and reducing the levels of leptin and insulin in high-sucrose diet-induced obese mice. This suggests that L. gasseri BNR17 may facilitate alleviating metabolic syndrome.

Funding Statement

This work was supported by High Value-Added Food Technology Development Program; Ministry for Food, Agriculture, Forestry and Fisheries, Republic of Korea. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Wood SC, Seeley RJ, Porte JD, Schwarts MW (1998) Signal that regulate food intake and energy homeostasis. Science 280: 1378–1383. [DOI] [PubMed] [Google Scholar]
  • 2. Wickelgren I (1998) Obesity: How big a problem? Science 280: 1364–1367. [DOI] [PubMed] [Google Scholar]
  • 3. Gill H, Prasad J (2008) Probiotics, immunomodulation, and health benefits. Adv Exp Med Biol 606: 423–454. [DOI] [PubMed] [Google Scholar]
  • 4. Kumar M, Kumar A, Naqpal R, Mohania D, Behare P, et al. (2010) Cancer-preventing attributes of probiotics: An update. Int J Food Sci Nutr 61: 473–496. [DOI] [PubMed] [Google Scholar]
  • 5. Menniqen R, Bruewer M (2009) Effect of probiotics on intestinal barrier function. Ann N Y Acad Sci 1165: 183–189. [DOI] [PubMed] [Google Scholar]
  • 6. Shin HS, Park SY, Lee DK, Kim SA, An HM, et al. (2010) Hypocholesterolemic effect of sonication-killed Bifidobacterium longum isolated from healthy adult Koreans in high cholesterol fed rats. Arch Pharm Res 33: 1425–1431. [DOI] [PubMed] [Google Scholar]
  • 7. Xie N, Cui Y, Yin YN, Zhao X, Yang JW, et al. (2011) Effects of two Lactobacillus strains on lipid metabolism and intestinal microflora in rats fed a high-cholesterol diet. BMC Complement Altern Med 11: 53. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Ali AA, Velasquez MT, Hansen GT, Mohamed AI, Bhathena SJ (2005) Modulation of carbohydrate metabolism and peptide hormones by soybean isoflavones and probiotics in obesity and diabetes. J Nutr Biochem 16: 693–699. [DOI] [PubMed] [Google Scholar]
  • 9. Lee HY, Park JH, Seok SH, Baek MW, Kim DJ, et al. (2006) Human originated bacteria, Lactobacillus rhamnosus PL60, produce conjugated linoleic acid and show anti-obesity effects in diet-induced obese mice. Biochim Biophys Acta 1761: 736–744. [DOI] [PubMed] [Google Scholar]
  • 10. Lee K, Paek K, Lee HY, Park JH, Lee Y, et al. (2007) Antiobesity effect of trans-10, cis-12-conjugated linoleic acid-producing Lactobacillus plantarum PL62 on diet-induced obese mice. J Appl Microbiol 103: 1140–1146. [DOI] [PubMed] [Google Scholar]
  • 11. Takemura N, Okubo T, Sonoyama K (2010) Lactobacillus plantarum strain No.14 reduces adipocyte size in mice fed high-fat diet. Exp Biol Med 235: 849–856. [DOI] [PubMed] [Google Scholar]
  • 12. Sousa R, Halper J, Zhang J, Lewis SJ, Li Wi, et al. (2008) Effect of Lactobacillus acidophilus supernatants on body weight and leptin expression in rats. BMC Complement Altern Med 8: 5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Kang JH, Yun SI, Park HO (2010) Effects of Lactobacillus gasseri BNR17 on body weight and adipose tissue mass in diet-induced overweight rats. J Microbiol 48: 712–714. [DOI] [PubMed] [Google Scholar]
  • 14. Yun SI, Park HO, Kang JH (2009) Effect of Lactobacillus gasseri BNR17 on blood glucose levels and body weight in a mouse model of type 2 diabetes. J Appl Microbiol 107: 1681–1689. [DOI] [PubMed] [Google Scholar]
  • 15. Ikarashi N, Toda T, Okaniwa T, Ito K, Ochiai W, et al. (2011) Anti-obesity and anti-diabetic effects of acacia polyphenol in obese diabetic KK-Ay mice fed high-fat diet. Evid Based Complement Alternat Med 2011: 952031. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Weyer C, Foley JE, Bogardus C, Tataranni PA, Pratley RE (2000) Enlarged subcutaneous abdominal adipocyte size, but not obesity itself, predicts type II diabetes independent of insulin resistance. Diabetol 43: 1498–1506. [DOI] [PubMed] [Google Scholar]
  • 17. Wronska A, Kmiec Z (2012) Structural and biochemical characteristics of various white adipose tissue depots. Acta Physiol 205: 194–208. [DOI] [PubMed] [Google Scholar]
  • 18. Jéquier E (2002) Leptin signaling, adiposity, and energy balance. Ann N Y Acad Sci 967: 379–388. [DOI] [PubMed] [Google Scholar]
  • 19. Frederucg RC, Hamann A, Anderson S, Löllmann B, Lowell BB, et al. (1995) Leptin levels reflect body lipid content in mice: evidence for diet-induced resistance to leptin action. Nat Med 1: 1311–1314. [DOI] [PubMed] [Google Scholar]
  • 20. Considine RV, Shinha MK, Heiman ML (1996) Serum immunoreactive leptin concentrations in normal weight and obese humans. N Eng J Med 334: 292–295. [DOI] [PubMed] [Google Scholar]
  • 21. An HM, Park SY, Lee DK, Kim JR, Cha MK, et al. (2011) Antiobesity and lipid-lowering effects of Bifidobacterium spp. in high fat diet-induced obese rats. Lipids Health Dis 10: 116. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Fukuchi S, Hamaguchi K, Seike M, Himeno K, Sakata T, et al. (2004) Role of fatty acid composition in the development of metabolic disorders in sucrose-induced obese rats. Exp Biol Med (Maywood) 229: 486–493. [DOI] [PubMed] [Google Scholar]
  • 23. Aparecida de França S, Dos Santos MP, Garófalo MA, Naveqantes C, Kettelhut Ido C, et al. (2009) Low protein diet changes the energetic balance and sympathetic activity in brown adipose tissue of growing rats. Nutrition 25: 1186–1192. [DOI] [PubMed] [Google Scholar]
  • 24. Buzelle SL, Dos Santos MP, Baviera AM, Lopes CF, Garófalo MAR, et al. (2010) A low-protein, high-carbohydrate diet increases the adipose lipid content without increasing the glycerol-3-phosphate or fatty acid content in growing rats. Can J Physiol Pharmacol 88: 1157–1165. [DOI] [PubMed] [Google Scholar]
  • 25. Dos Santos MP, de França SA, dos Santos JT, Buzelle SL, Bertolini GL, et al. (2012) A low-protein, high-carbohydrate diet increases fatty acid uptake and reduces norepinephrine-induced lipolysis in rat retroperitoneal white adipose tissue. Lipids 47: 279–289. [DOI] [PubMed] [Google Scholar]
  • 26. Song Z, Deaciuc I, Zhou Z, Song M, Chen T, et al. (2007) Involvement of AMP-activated protein kinase in beneficial effects of betaine on high-sucrose diet-induced hepatic steatosis. Am J Physiol Gastrointest Liver Physiol 293: G894–902. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Choi HU, Song SJ, Kim JH, Chung JJ, Yoon JH, et al. (2012) High carbohydrate intake was inversely associated with high-density lipoprotein cholesterol among Korean adults. Nutr Res 32: 100–106. [DOI] [PubMed] [Google Scholar]
  • 28. Kobayashi Y, Miyazawa M, Kamei A, Abe K, Kojima T (2010) Ameliorative effects of mulberry (morus alba L.) leaves on hyperlipidemia in rats fed a high-fat diet: Induction of fatty acid oxidation, inhibition of lipogenesis, and suppression of oxidative stress. Biosci Biotechnol Biochem 74: 2385–2395. [DOI] [PubMed] [Google Scholar]
  • 29. Aronsson L, Huang Y, Parini P, Korach-Andre M, Håkansson J, et al. (2010) Decreased fat storage by Lactobacillus paracasei is associated with increased levels of angiopoietin-like 4 protein (ANGPTL4). PLos ONE 5: e13087. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Ahmed W, Ziouzenkova O, Brown J, Devchand P, Francis S, et al. (2007) PPARs and their metabolic modulation: new mechanisms for transcriptional regulation? J Intern Med 262: 184–198. [DOI] [PubMed] [Google Scholar]
  • 31. Park DY, Ahn YT, Huh CS, Jeon SM, Choi MS (2011) The inhibitory effect of Lactobacillus plantarum KY1032 cell extract on the adipogenesis of 3T3-L1 cells. J Med Food 14: 670–675. [DOI] [PubMed] [Google Scholar]
  • 32. Furuhashi M, Hotamisligil GS (2008) Fatty acid-binding proteins: Role in metabolic diseases and potential as drug targets. Nat Rev Drug Discov 7: 489–503. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Kim JB, Sarraf P, Wright M, Yao KM, Mueller E, et al. (1998) Nutritional and insulin regulation of fatty acid synthetase and leptin gene expression through ADD1/SREBP1. J Clin Invest 101: 1–9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Guillou H, Martin PG, Pineau T (2008) Transcriptional regulation of hepatic fatty acid metabolism. SubCell Biochem 49: 3–47. [DOI] [PubMed] [Google Scholar]
  • 35. Evrard B, Coudeyras S, Dosgilbert A, Charbonnel N, Alamé J, et al. (2011) Dose-dependent immunomodulation of human dendritic cells by the probiotic Lactobacillus rhamnosus Lcr35. PLos one 6: e18735. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Zorzano A, Palacín M, Gumà A (2005) Mechanisms regulating GLUT4 glucose transporter exrpression and glucose transport in skeletal muscle. Acta Physiol Scand 183: 43–58. [DOI] [PubMed] [Google Scholar]
  • 37.Kouidhi S, Berrhouma R, Rouissi K, Jarboui S, Clerget-Froidevaux MS, et al.. (2011) Human subcutaneous adipose tissue Glut4 mRNA expression in obesity and type 2 diabetes. Acta Diabetol (in press). [DOI] [PubMed]
  • 38. Tabák AG, Herder C, Rathmann W, Brunner EJ, Kivimäki M (2012) Prediabetes: A high-risk state for diabetes development. Lancet 379: 2279–2290. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Ma X, Hua J, Li Z (2008) Probiotics improve high fat diet-induced hepatic steatosis and insulin resistance by increasing hepatic NKT cells. J Hepatol 49: 821–830. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Cani PD, Neyrinck AM, Fava F, Knauf C, Burcelin RG, et al. (2007) Selective increases of bifidobacteria in gut microflora improve high-fat-diet-induced diabetes in mice through a mechanism associated with endotoxaemia. Diabetol 50: 2374–2383. [DOI] [PubMed] [Google Scholar]
  • 41.Blaut M, Bischoff SC (2010) Probiotics and obesity. Ann Nutr Metab 57 (Suppl. 1), 20–23. [DOI] [PubMed]

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES