Skip to main content
NCBI home page
Infection and Immunity logoLink to Infection and Immunity
. 2004 Mar;72(3):1715–1724. doi: 10.1128/IAI.72.3.1715-1724.2004

Conservation and Diversity of sap Homologues and Their Organization among Campylobacter fetus Isolates

Zheng-Chao Tu 1,2, John Hui 1, Martin J Blaser 1,2,3,*
PMCID: PMC356032  PMID: 14977980

Abstract

Campylobacter fetus surface layer proteins (SLPs), encoded by sapA homologues, are important in virulence. In wild-type C. fetus strain 23D, all eight sapA homologues are located in the 54-kb sap island, and SLP expression reflects the position of a unique sapA promoter in relation to the sapA homologues. The extensive homologies in the sap island include both direct and inverted repeats, which allow DNA rearrangements, deletion, or duplication; these elements confer substantial potential for genomic plasticity. To better understand C. fetus sap island diversity and variation mechanisms, we investigated the organization and distribution of sapA homologues among 18 C. fetus strains of different subspecies, serotypes, and origins. For all type A strains, the boundaries of the sap island were relatively consistent. A 187-bp noncoding DNA insertion near the upstream boundary of the sap island was found in two of three reptile strains studied. The sapA homologue profiles were strain specific, and six new sapA homologues were recognized. Several homologues from reptile strains are remarkably conserved in relation to their corresponding mammalian homologues. In total, the observed differences suggest that the sap island has evolved differing genotypes that are plastic, perhaps enabling colonization of varied niches, in addition to antigenic variation.

Campylobacter fetus, a microaerophilic spiral gram-negative bacterium, has been recognized as an important pathogen in both animals and humans (6, 19, 23, 33, 35, 36, 38). C. fetus has been isolated from numerous hosts including mammals (ungulates, swine, monkeys, and humans), birds, and reptiles (6, 33), and has been divided into two closely related subspecies, fetus and venerealis (1, 31). All subsp. venerealis strains are serotype A (type A), whereas subsp. fetus may be either serotype A or serotype B (type B) (25, 28, 29).

As with many other bacterial species (34), C. fetus possesses an outermost crystalline surface layer of regular closely packed high-molecular-weight protein subunits (S-layer proteins [SLPs]) (9, 10, 17, 24, 26). In C. fetus, the SLPs are encoded by five to nine sapA homologues in each strain (11, 18, 40). The C. fetus SLPs have been shown to play a critical role in C. fetus virulence (2, 4, 5, 21, 22, 27) by protecting the bacterium from phagocytosis and serum killing (3). In addition, SLP phase variation results in antigenic variation and thus allows the bacterium to escape from host immune defenses (5, 8, 9, 20, 21).

In wild-type C. fetus subsp. fetus strain 23D, nine (eight complete and one partial) sapA homologues, the unique sap promoter, and the SLP secretion system genes are clustered on a 54-kb chromosomal region termed the sap island, as described previously (41) (Fig. 1). To better understand the conservation and diversity of the C. fetus sap island and to gain further insights into C. fetus antigenic variation mechanisms, we investigated the distribution and profiles of the sapA homologues and the sap island boundaries among C. fetus strains differing in subspecies and serotype. In the course of the present study, we also identified six new sap homologues that further our understanding of sap homologue evolution.

FIG. 1.

FIG. 1.

Open in a new tab

Schematic representation and genomic organization of the sap island and its flanking regions in C. fetus strain 23D. For ease of reading, selected ORFs (02, 09, 20, 31, 44, and A to Ap8) representing Cf0002, Cf0009, Cf0020, Cf0031, Cf0044, and sapA to sapAp8, are labeled, respectively. Each arrow represents the ORF orientation.

MATERIALS AND METHODS

Bacterial strains.

The 18 C. fetus strains examined have been extensively studied (40, 45) (Table 1). The strains were grown on Brucella Broth (BBL Microbiology Systems, Cockeysville, Md.) supplemented with 7 U of polymyxin B/ml, 10 μg of vancomycin/ml, 50 μg of nalidixic acid/ml, and 10 μg of trimethoprim lactate/ml. Frozen stocks were stored at −80°C supplemented with 15% glycerol. Escherichia coli strains were grown on Luria-Bertani medium or in Luria-Bertani broth (Difco), and for plasmid selection 100 μg of ampicillin/ml was used.

TABLE 1.

Wild-type C. fetus strains used in this studya

Strain no. Strain designation Source Major SLP
No. of sap homologues
Typeb Size (kDa)
1 80-109 Human A 127 8
2 82-40 Human A 97 8
3 83-94 Human A 97 5
4 84-32 Bovine A 97 8
5 84-86 Human A 97 8
6 84-92 Bovine A 97 7
7 85-388 Reptile A 97 9
8 85-389 Reptile A 149 8
9 84-112 Bovine A 149 8
10 99-256 Bovine A 97 8
11 99-257 Human A 97 7
12 85-387 Reptile A/B 97 8
13 84-87 Human B 97 8
14 84-90 Bovine B NDc 7
15 84-91 Human B 97 8
16 84-94 Human B 127 8
17 84-104 Monkey B 97 7
18 84-107 Human B 97 7
Open in a new tab
a

As determined elsewhere (40, 45).

b

That is, the SLP type (45).

c

ND, not determined.

DNA isolation and manipulation.

After 48 h of bacterial growth on two agar plates, C. fetus chromosomal DNA was prepared from cells of each strain as described previously (47). Plasmid DNA was isolated from E. coli by using a QIAgen Spin Miniprep kit (Qiagen, Inc., Valencia, Calif.). Standard protocols were used for cloning, transformation, restriction digestion, and ligation of plasmid DNA (32).

PCR.

Amplifications of the eight sapA homologues in the 18 C. fetus strains were performed by using two sets of homologue-specific primers (Table 2). To detect the presence of Cf0002 and to define the sap island upstream boundaries, PCRs were performed with primer MF paired with MR or paired with AR or BR, respectively (Table 2 and Fig. 2D). The presence of the sap island downstream gene Cf0031 and the sap island downstream boundary were examined by PCRs by using primer DF paired with DR and primer DR paired with AbF or 3F1, respectively (Table 2 and Fig. 3). Cf0009 presence and its location related to sapA homologues were investigated by PCRs with primers HF paired with HR and primer HR paired with AR or BR (Fig. 4A). The Cf0020 and sapC status within the sap island were identified by PCRs with primer TR paired with 2F and with primer CR paired with AR or BR, respectively (Table 2 and Fig. 4E and G). The positions of sapF with sap homologues were examined by using a PCR with primer FF paired with AR or BR (Table 2 and Fig. 4J). Amplifications were performed with 100 ng of chromosomal DNA, 20 pM (each) forward and reverse primers, 350 nM deoxynucleoside triphosphates, 5 μl of the provided buffer, and 0.5 U of Taq polymerase (Qiagen) in a final volume of 50 μl per reaction mixture. PCR conditions consisted of denaturation at 94°C for 1 min, annealing at 5°C below the predicted melting temperature of the primers for 1 min, and extension at 72°C for 1 min kb−1.

TABLE 2.

PCR primers used in this study

Primer Sequence (5′-3′) Gene Orien- tationa 5′ Posi- tionb
A0F AACTCAGTCATCATAACTAC sapA F 1903
A0R TTCCATCATCAACTACAACA sapA R 2809
0F1 AGCTTATTACAGTGAAACTA sapA F 2014
0R1 GATCTAGCGTACCTGAAA sapA R 2775
A1F GGTAGTGATGATACTGTAAA sapA1 F 1953
A1R AATCCAGCAAGCTTAATCAA sapA1 R 2720
1F1 TCAAACTGCAGCTAGTAAAA sapA1 F 1240
1R1 ATTGTATCATTTCCTTCACC sapA1 R 1700
2F CTAACACTATAACCGTTACT sapA2 F 2741
A2R AGCATCAACAGTGTCATTAA sapA2 R 3291
2F1 GATGATGCATTAACAATAATA sapA2 F 2889
2R1 GCAGTGTCTGGAGTAACG sapA2 R 3211
A3F TTTCAACGGTGCTAAGCTTA sapA3 F 2496
A3R GTCTTATGGGTGGGTTAAAAG sapA3 R 2973
3F1 TAAATGCTGCGGACTAAA sapA3 F 2049
3R1 AGATAGATCTATGGCTACAC sapA3 R 2426
A4F ATCTGCGTTTGATACGATAA sapA4 F 1921
A4R CTCCAAGAGTTAAATTAGCTA sapA4 R 2467
4F1 GATCTGTAGATGCGCTAA sapA4 F 983
4R1 GTGAATGAATCGTTAGCCA sapA4 R 1553
A5F ATGTAAGCGTAGAGAATAAG sapA5 F 2618
A5R GTAAGGCTATCTAAATCAAC sapA5 R 3290
5F1 GTTACTGCTGCTGCTAAAATAG sapA5 F 2971
A6F ATCTTACAGCTATCGATATCA sapA6 F 2783
A6R TTGCATCTTTTGTTGTGCTA sapA6 R 3562
6R1 CCTATGGCTATCTTATCTATA sapA6 R 2961
6F1 CTAGCGCTTCACTAAAATTAG sapA6 F 2183
A7F GGACTAGAAGTAGGAAATA sapA7 F 2044
A7R AAGAAGCTATAGTTGAAGCA sapA7 R 2243
7F1 ATGTGAAGGTACAAAAGGAA sapA7 F 3362
7R1 CGTCTATAAGCTGTAGATTAA sapA7 R 3850
MF ACCACTAGCATCAAATCTTA mtfB F 37
MR CCAACTATAACTAGATCGATA mtfB R 734
AR ATCAAGATCACTAGCACTA sapA R 531
BR TCAACACTACTACTATTACTA sapB R 525
HF AGCAGGAGGATTTGTTGAA Cf0009 F 651
HR CAATAGCATTTGCATTTGTG Cf0009 R 1737
IF CTTTGTTTTGTTTATTCATTGAA sapAx F −261
IR GCATTAGAATAGCATTAATACT sapAx R −112
AbF GATTTTATTTTATTTTATTAAGGA sapA(B) F −32
AbR TATCTACTATTTATTAAGGTTTGG sapA(B) R −184
FF ACTATTAGAAATTTAGAAAGAG sapF F 1268
DF AGCTGAGCTAAATACACA Cf0031 F 50
SF GATTTTATTTTATTTTATTAAGGA sap F −32
SR TATCTACTATTTATTAAGGTTTGG sap R 185
DR CAGTTCCTTCTCTTTGATAT Cf0031 R 362
CR TCTGCTTGCGTATCTATACA sapC R 671
TR CGTCGTTTTCATGATCGA Cf0020 R 321
Open in a new tab
a

F, forward; R, reverse.

b

Based on the position in the specified gene (accession no. AY211269).

FIG. 2.

FIG. 2.

Open in a new tab

Identification of the sap island upstream boundary in 18 C. fetus strains. (A) Detection of the presence of Cf0002 (mtfB) by PCR with primers MF and MR. (B) Southern hybridization of Cf0002 with HindIII-digested genomic DNA. The probe is a 707-bp mtfB fragment amplified by PCR from strain 23D. (C) PCR detection of the proximity of Cf0002 to sapA homologues with primers MF and AR (lanes 1 to 11) or primers MF and BR (lanes 12 to 18). (D) Schematic representation of the sap island upstream boundary and the strain 85-388 insertion site and sequence. The black box represents the 5′ conserved regions of the sapA or sapB homologues. The PCR primers and orientations are designated by arrows. (E) PCR amplification of the insertion fragment found between Cf0002 and sapA homologue in strain 85-388 with primers IF and IR.

FIG. 3.

FIG. 3.

Open in a new tab

Identification of the sap island downstream boundary. (A) Strategy for detection of Cf0031 location relative to the sap island. The primers are shown as arrows, and the black area indicates the 5′ conserved regions of the sapA or sapB homologues. (B) PCR amplification for Cf0031 in the 18 C. fetus strains with primers DF and DR. (C) PCR identification of the proximity of Cf0031 with sapA or sapB homologues with primers AbF and DR. (D) PCR identification of the proximity of cf0031 with sapA3 with primers 3F1 and DR.

FIG.4.

FIG.4.

Open in a new tab

Analyses of Cf0009, Cf0020, sapC, and sapF locations related to sapA or sapB homologues within the sap island of 18 C. fetus strains. (A) Schematic representation of PCR for Cf0009 analyses, with primers indicated by the arrows; (B) PCR for detection of the presence of Cf0009; (C) Southern hybridization for Cf0009; (D) PCR amplifications for the location of Cf0009 related to the sapA homologues with primer HR paired with AR (for type A strains) or BR (for type B strains); (E) schematic representation of PCR for Cf0020 analysis, with the primers indicated by the arrows; (F) detection of the location of Cf0020 in relation to sapA2 (or sapB2) by PCR with primers 2F and TR; (G) schematic representation of PCR for sapC analysis, with the primers indicated by arrows; (H) PCR for sapC amplification and orientation with primers AR and CR; (I) PCR for sapC analysis with primers BR and CR; (J) schematic representation of PCR for sapF analysis, with the primers indicated by arrows; (K) PCR for sapF amplification and orientation with primers AR or BR and FF.

DNA sequencing and analysis.

DNA sequencing was carried out by using a dideoxy dye termination method on an ABI sequencer (Perkin-Elmer Cetus) by the Rockefeller University Core facility. Sequence analyses were performed with the Genetics Computer Group programs (Madison, Wis.). The nucleotide sequences of sapA8, sapB9, sapA10, sapB11, sapA12, and sapA13 have been deposited in GenBank under accession numbers AY450397 to AY450402.

Southern hybridization.

Chromosomal DNA was digested with HindIII, electrophoresed on a 1% agarose gel, and transferred to a positively charged nylon membrane. The eight sapA homologue-specific, Cf0002-specific, and Cf0009-specific probes were PCR-amplified products labeled by using the Renaissance Chemiluminescence kit (NEN Research Products, Boston, Mass.).

SDS-PAGE and immunoblotting.

The sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis and immunoblotting procedures were used as described previously (40). For immunological detection, recombinant SLP proteins were detected by immunoblotting them on 7% SDS-polyacrylamide gels, with polyclonal rabbit serum against the 97-kDa SLP from C. fetus strain 82-40 LP, as described previously (26). The goat anti-rabbit immunoglobulin G alkaline phosphatase conjugate was used as secondary antibody at a 1:1,000 dilution.

RESULTS

Upstream boundaries of the sap islands.

Cf0002 (mtfB), homologous to other genes encoding mannosyltransferase B, has been shown to be located upstream of the sap island in strain 23D (41). To identify the upstream boundaries of the other 17 C. fetus strains, we first investigated whether mtfB is present. PCR with mtfB specific primers indicated that mtfB exists in all 11 type A strains, but not in any of the type B strains (Fig. 2A), and Southern hybridization with the mtfB-specific PCR product as a probe verified this result (Fig. 2B). The two different bands in reptile strain 85-389 (Fig. 2B, lane 8) may suggest two copies of mtfB; this analysis was repeated and the repeat blot showed the same result (data not shown). The various band sizes in different strains indicate substantial polymorphism in the location of the HindIII restriction sites.

Next, PCRs with primers MF and AR (or BR) indicated that mtfB is located upstream of a sapA homologue in type A strains but, as expected, not in type B strains (Fig. 2C). The product sizes were conserved in all of the type A strains, except for 85-388 and 85-389, in which larger bands were seen, suggesting an insertion in these two strains (Fig. 2C). Sequence analysis of the product from strain 85-388 indicated a 187-bp polymorphic region, with 24 (TTT) trimers beginning 293 bp and ending 107 bp upstream of the nearest sapA homologue (Fig. 2D). A search of GenBank failed to reveal any significant homology to the 187-bp noncoding sequence. The 187-bp insertion fragment present in strain 85-388 appeared only to be present in the other type A reptile strain (85-389), as determined by PCR with primers IF and IR (Fig. 2E).

In strain 23D, the homologue adjacent to mtfB is sapA4. To determine whether this relation is conserved in the other type A strains, we performed PCR with MF and A4R. The result showed that sapA4 is the homologue closest to the boundary in only 4 (including strain 23D) of 11 strains (data not shown).

Downstream boundaries of the sap islands.

Since the downstream boundary of the sap island in strain 23D is flanked by Cf0031, we performed PCRs with a Cf0031-specific reverse primer (DR) paired with either its forward specific primer DF or a sapA/B-specific forward primer AbF (Fig. 3A). The results show that Cf0031 is present and is adjacent to the sap island in all 18 strains (Fig. 3B). The PCR with a sapA3-specific primer and Cf0031-specific primer indicate that sapA3 is adjacent to Cf0031 in 10 of the 18 strains (Fig. 3D), a finding consistent with their presence in these strains (see Fig. 5, sapA3-I). These observations indicate that the downstream border of the sap island is conserved, in contrast to the upstream boundary, where the specific homolog present is not conserved.

FIG. 5.

FIG. 5.

Open in a new tab

Distribution of eight sapA homologues in 18 C. fetus strains by using two differing sets (I or II) of sap homologue-specific primers (Table 2). The numbers in parentheses indicate the primer locations in the specified genes. The lane numbers representing the strains are the same as in Table 1; lane C represents the no-DNA control.

Internal boundaries within the sap island.

In strain 23D, the eight sapA homologues were separated by internal regions varying in size from 0.7 to 12.4 kb. Our previous results showed that each sapA homologue could potentially change position in the sap island due to DNA rearrangement mediated by homology between their 5′ conserved regions (41). However, for sapA4, the 3′ internal region was stable in strain 23D (41). To investigate the positions of the sapA homologues relative to the non-sapA genes within the island, we sought to characterize the Cf0009, Cf0020, sapC, and sapF locations. The PCR and Southern hybridization results indicate that Cf0009 is present in all mammalian but not reptilian strains and that it is located upstream of sapA or sapB homologues in each case (Fig. 4A to D). Cf0020 is located downstream of sapA2 or sapB2 in 14 of the 15 strains in which either are present (Fig. 4E and F). Thus, for most strains, sapA2 (or sapB2) appears to be at the internal boundary of the homologues and nonhomologues within zone 2 of the island (Fig. 1). The PCR results indicate that within zone 2, sapC always is located upstream of a sapA or a sapB (in a type B strain) homologue (Fig. 4G, H, and I). As in strain 23D, sapF is located upstream of sap homologues, with the exception of strain 14, in which the expected PCR product was absent (Fig. 4K).

Conservation of the sapA homologues among the 18 C. fetus strains.

In C. fetus strain 23D, all eight sapA homologues (sapA and sapA1 to sapA7) showed at least a 553-bp 5′ conserved region, partially conserved midregions, and substantially divergent 3′ regions. To assess the presence and genetic diversity of these eight sapA homologues in the other 17 C. fetus strains, we performed PCR with sap homologue-specific primers located within the divergent 3′ regions. All eight sapA homologues are present in six strains (strains 1, 2, 4, 5, 6, and 10), but one or more homologues were absent in the others (Fig. 5). In particular, of the three reptile strains, strains 7 and 8 showed only sapA and sapA7 PCR products, and strain 12 showed only the sapA7 PCR product. For each PCR product, variation only encompassed homologue presence or absence in a strain; there was no size variation. For each homologue, we performed two independent PCRs to determine whether a negative result was due to primer mismatches or to the absence of the homologue. In each case, except for sapA3, sapA4, and sapA7, results were consistent for the two sets of primers; the observed differences could be due to polymorphisms in the primer regions or suggest new close homologues.

Southern hybridizations were performed with one of the sap homologue-specific PCR products as a probe for each homologue (Fig. 6). Most of the sap homologue-specific hybridizations, with the exception of reptile strains 7, 8, and 13, revealed the same size bands, indicating a close genomic relationships across the strains. The hybridizations with the sapA2 and sapA5 probes showed extra bands in some of the type B strains, suggesting the presence of other gene copies or close homologues.

FIG. 6.

FIG. 6.

Open in a new tab

Southern analysis of the distribution of eight sap homologues among C. fetus strains. Each lane contains HindIII-digested genomic DNA from the 18 different C. fetus strains, hybridized with each of eight sap homologue-specific probes and amplified by one set of the PCR products from strain 23D shown in Fig. 5. The numbers in parentheses indicate the probe locations within the specified genes.

Six new sapA homologues and their encoded SLPs.

Only sapA and sapA7 homologues were detected in the reptile strains, and yet the general architecture of their sap islands indicated conserved features (Fig. 3 and 4), suggesting the presence of other sapA homologues. To address this hypothesis, we performed PCR for strains 85-387 and 85-388 by using the sap noncoding (upstream) region conserved forward primer SF paired with the reverse primer SR (Table 2), which flank the expressed homologues in strain 23D (41). The products were cloned into pGEM-T-Easy, and 32 clones were selected for subsequent study from each strain. Based on HindIII digestion of chromosomal DNA from several of these colonies indicating variation, DNA sequencing was performed. The four homologues identified in strain 85-387 were potential sapA1 and sapA7 (based on partial sequence; data not shown) and new sap B11 and sapA12. Thus, we now provide direct genetic evidence for the basis of the A/B chimerism (40) of strain 85-387. In strain 85-388, the three sapA homologues identified are sapA (based on partial sequence; data not shown) and new sapA10 and sapA13 (Fig. 7). By using a similar method, we also identified sapB9 and sapA8 in strains 84-104 and 82-40, respectively (Fig. 7). All of the new sapA homologues were expressed in E. coli and recognized by polyclonal rabbit serum against the 97-kDa SLP expressed by strain 82-40 (Fig. 7B), with the exception of sapB11, the type B SLP from reptile strain 85-387. A phylogeny of the now 16 known sapA/sapB homologues (7, 12, 41) shows a major dichotomy (Fig. 7C). The homologues on the top branch all encode proteins of ∼97 kDa, whereas the sizes are >111 kDa on the lower branch. Earlier work showed that 97-kDa SLPs had hexagonal crystalline structure, whereas the larger products formed tetragonal crystals (17).

FIG.7.

FIG.7.

Open in a new tab

Sequence and antigenicity of sapA homologues identified in the present study. (A) Schematic representation of the structures of new sapA homologues compared to their closest homologues in strain 23D. The different colors indicate regions of sequence identity, the white boxes represent diverse sequences, and the red outlined box in sapA10 represents a deletion in the (gray) semiconserved region compared to sapA4 and sapB9. (B) Immunoblot of recombinant SLPs probed with polyclonal rabbit antiserum to the 97-kDa SLP of type A strain 84-20LP. The SLPs are encoded by sapA8, sapA12, sapB11, sapA13, sapB9, sapA, and sapA10, respectively. An immunoreactive product was observed in each case, except for sapB11. (C) Phylogenetic tree constructed from the nucleotide sequences of 16 sapA or sapB homologues, including the six new homologues. The tree was constructed by using PAUP 4.0bs neighbor-joining method based on Kimura's two-parameter model distance matrices. The size of the deduced or experimentally determined SLP encoded by the homologue is shown at the left. The major branching perfectly conforms to the dichotomy between 97-kDa SLP (hexagonal) and >97-kDa SLP (tetragonal) in crystalline structure (17).

DISCUSSION

Prior genetic studies indicated that C. fetus strains contain five to nine sapA homologues that are clustered in a narrow chromosomal DNA region (11, 18, 40). In strain 23D, all eight sapA homologues are located in the 54-kb sap island. That 18 of 28 predicted open reading frame (ORFs) in the sap island, representing 86% of the coding region length, encode surface-associated proteins and actual or putative protein secretion systems (37, 42), suggests that the sap island plays an important role in the interaction between the pathogen and host. The genomic constituent and DNA structure analyses comparing the sap island with its flanking region and the sap homologues with non-sap homologues suggest that the sap island was not acquired by recent horizontal gene transfer but is an ancient C. fetus genomic constituent (40, 41, 42). However, we had not determined whether the sap island exists as a fixed region in strains that differ in subspecies, serotype, and origin.

Our present studies indicate that all 18 C. fetus sap islands show a consistent downstream boundary adjacent to Cf0031 and that all type A C. fetus sap islands are located downstream of a potential lipopolysaccharide (LPS) locus. Type B strains do not possess mtfB, a finding which is consistent with the compositional differences between type A and type B LPS (25, 48). Our results do not exclude the possibility that sap islands in type B C. fetus strains share a consistent upstream boundary or that they could be located downstream of their LPS locus. In total, these data provide further evidence that the sap island entered the C. fetus genome before the different subspecies and serotypes diverged and that the type A and type B sapA homologue divergence must have occurred after the island had been present. That Cf0009, encoding a putative high-molecular-weight surface protein (41), only exists in the 15 mammalian, but not reptilian, strains suggests that Cf0009 might have entered the C. fetus genome after the divergence between mammalian and reptilian strains, a finding consistent with analyses of G+C content and dinucleotide signatures (42).

The substantial global direct (18.0%) and inverted (16.5%) repeats in the sap island (42) can mediate DNA rearrangement and lead to instability of the island (14, 30, 39, 43, 44). Southern hybridization with the 5′ conserved region as a probe showed different profiles among the strains, suggesting that the sap islands are relatively variable (40). That all eight sapA homologues in C. fetus strain 23D can switch sap island position with one another at high (10−1 to 10−2) frequency due to DNA recombination mediated by their conserved 5′ noncoding and coding regions is consistent with the plasticity of the sap island (41). The stable existence of sap island internal genes Cf0009, Cf0020, and sapC among the different strains suggests that the island components and boundaries may be conserved, but we cannot exclude the existence of further smaller polymorphisms.

Reptile and mammalian C. fetus isolates have a number of differences that can be shown in phylogenetic studies (40). Of the eight sapA homologues examined, sapA and sapA7 homologues were detected in strains 85-388 and 85-389, but no sapA homologues were detected in strain 85-387 by PCR or by Southern hybridization. However, the sequence analyses of the cloned sapA homologues in strain 85-387 indicate that sapA1 and sapA7 are present. The reasons for these dichotomous results reflect sequence divergence between the sapA homologues in strains 23D and 85-387. The latter sequence failed to be amplified by the PCR or demonstrated by Southern hybridization due to primer mismatching and internal HindIII sites, respectively (data not shown).

C. fetus strains may be either type A or type B based on the LPS structure and SLP type. The finding that sapA and sapB homologues coexist in strain 85-387 confirms our previous study (40) that strain 85-387 is a type A/B chimera. We excluded the possibility that the strain is a mixture of type A and type B strains. If the sample tested reflected a mixture of two different strains, we would find relatively equal numbers of sapA and sapB bands. However, the probe of the 85-387 genome with the sapA and sapB conserved regions showed six sapB bands and only one sapA band (40). These results indicate that 85-387 indeed represents a single strain. SLPs bind specifically to LPS molecules from homologous (type A or B) but not heterologous cells (49). What the LPS type is for this strain and how the different SLPs bind to LPS remains unknown.

In each C. fetus strain, the unique sapA promoter potentially permits transcription of all of the sapA homologues, resulting in the expression of different SLP antigens (13-16, 39, 41). C. fetus antigenic variation involving the C. fetus SLPs has been observed in vivo and in vitro (21, 30, 45, 46). That different C. fetus strains possess new sap homologues and that their encoded SLPs are antigenically cross-reactive with one another indicate an extensive family of related proteins. The phylogenetic analyses showed no greater difference between mammalian and reptile isolates than between two mammalian strains. The SLP encoded by sapB11 in strain 85-387 did not show cross-antigenicity using the polyclonal antibody against the 97-kDa SLP encoded by the sapA homologue in type A C. fetus strain 82-40LP, indicating that they do not share major epitopes. This result suggests that the design of potential C. fetus vaccines should include a pool of different antigens. Finally, the deep branching of the phylogeny of the homologues corresponds exactly to the observed differences in protein size and in crystalline structure (17). These results both confirm the utility of the distinction and suggest that an ancient gene duplication event led to the major branching. That the sapB homologues are present on separate branches suggests recombination events to explain this homoplasy.

Acknowledgments

This study was supported in part by R01 AI24145 from the National Institutes of Health and by the Medical Research Service of the Department of Veterans Affairs.

Editor: W. A. Petri, Jr.

REFERENCES

  • 1.Berg, R. L., J. W. Jutila, and B. D. Firehammer. 1971. A revised classification of Vibrio fetus. Am. J. Vet. Res. 32:11-22. [PubMed] [Google Scholar]
  • 2.Blaser, M. J., P. F. Smith, J. A. Hopkins, I. Heinzer, J. H. Bryner, and W. L. Wang. 1987. Pathogenesis of Campylobacter fetus infections: serum resistance associated with high-molecular-weight surface proteins. J. Infect. Dis. 155:696-706. [DOI] [PubMed] [Google Scholar]
  • 3.Blaser, M. J., P. F. Smith, J. E. Repine, and K. A. Joiner. 1988. Pathogenesis of Campylobacter fetus infections. Failure of encapsulated Campylobacter fetus to bind C3b explains serum and phagocytosis resistance. J. Clin. Investig. 81:1434-1444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Blaser, M. J., and Z. Pei. 1993. Pathogenesis of Campylobacter fetus infections: critical role of high-molecular-weight S-layer proteins in virulence. J. Infect. Dis. 167:372-377. [DOI] [PubMed] [Google Scholar]
  • 5.Blaser, M. J., E. Wang, M. K. Tummuru, R. Washburn, S. Fujimoto, and A. Labigne. 1994. High-frequency S-layer protein variation in Campylobacter fetus revealed by sapA mutagenesis. Mol. Microbiol. 14:453-462. [DOI] [PubMed] [Google Scholar]
  • 6.Blaser, M. J. 1998. Campylobacter fetus emerging infection and model system for bacterial pathogenesis at mucosal surfaces. Clin. Infect. Dis. 27:256-258. [DOI] [PubMed] [Google Scholar]
  • 7.Casademont, I., D. Chevrier, and J. L. Guesdon. 1998. Cloning of a sapB homologue (sapB2) encoding a putative 112-kDa Campylobacter fetus S-layer protein and its use for identification and molecular genotyping. FEMS Immunol. Med. Microbiol. 21:269-281. [DOI] [PubMed] [Google Scholar]
  • 8.Corbeil, L. B., G. G. Schurig, P. J. Bier, and A. J. Winter. 1975. Bovine veneral vibriosis: antigenic variation of the bacterium during infection. Infect. Immun. 11:240-244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Dubreuil, J. D., M. Kostrzynska, J. W. Austin, and T. J. Trust. 1990. Antigenic differences among Campylobacter fetus S-layer proteins. J. Bacteriol. 172:5035-5043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Dubreuil, J. D., S. M. Logan, S. Cubbage, D. N. Eidhin, W. D. McCubbin, C. M. Kay, T. J. Beveridge, F. G. Ferris, and T. J. Trust. 1988. Structural and biochemical analyses of a surface array protein of Campylobacter fetus. J. Bacteriol. 170:4165-4173. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Dworkin, J., M. K. Tummuru, and M. J. Blaser. 1995. A lipopolysaccharide-binding domain of the Campylobacter fetus S-layer protein resides within the conserved N terminus of a family of silent and divergent homologs. J. Bacteriol. 177:1734-1741. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Dworkin, J., M. K. Tummuru, and M. J. Blaser. 1995. Segmental conservation of sapA sequences in type B Campylobacter fetus cells. J. Biol. Chem. 270:15093-15101. [DOI] [PubMed] [Google Scholar]
  • 13.Dworkin, J., and M. J. Blaser. 1996. Generation of Campylobacter fetus S-layer protein diversity utilizes a single promoter on an invertible DNA segment. Mol. Microbiol. 19:1241-1253. [DOI] [PubMed] [Google Scholar]
  • 14.Dworkin, J., and M. J. Blaser. 1997. Nested DNA inversion as a paradigm of programmed gene rearrangement. Proc. Natl. Acad. Sci. USA 94:985-990. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Dworkin, J., and M. J. Blaser. 1997. Molecular mechanisms of Campylobacter fetus surface layer protein expression. Mol. Microbiol. 26:433-440. [DOI] [PubMed] [Google Scholar]
  • 16.Dworkin, J., O. L. Shedd, and M. J. Blaser. 1997. Nested DNA inversion of Campylobacter fetus S-layer genes is recA dependent. J. Bacteriol. 179:7523-7529. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Fujimoto, S., A. Takade, K. Amako, and M. J. Blaser. 1991. Correlation between size of the surface array protein and morphology and antigenicity of the Campylobacter fetus S layer. Infect. Immun. 59:2017-2022. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Fujita, M., T. Morooka, S. Fujimoto, T. Moriya, and K. Amako. 1995. Southern blotting analyses of strains of Campylobacter fetus using the conserved region of sapA. Arch. Microbiol. 164:444-447. [DOI] [PubMed] [Google Scholar]
  • 19.Garcia, M. M., G. M. Ruckerbauer, M. D. Eaglesome, and W. E. Boisclair. 1983. Detection of Campylobacter fetus in artificial insemination bulls with a transport enrichment medium. Can. J. Comp. Med. 47:336-340. [PMC free article] [PubMed] [Google Scholar]
  • 20.Garcia, M. M., C. L. Lutze-Wallace, A. S. Denes, M. D. Eaglesome, E. Holst, and M. J. Blaser. 1995. Protein shift and antigenic variation in the S-layer of Campylobacter fetus subsp. venerealis during bovine infection accompanied by genomic rearrangement of sapA homologs. J. Bacteriol. 177:1976-1980. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Grogono-Thomas, R., J. Dworkin, M. J. Blaser, and D. G. Newell. 2000. Roles of the surface layer proteins of Campylobacter fetus subsp. fetus in ovine abortion. Infect. Immun. 68:1687-1691. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Grogono-Thomas, R., M. J. Blaser, M. Ahmadi, and D. G. Newell. 2003. Role of S-layer protein antigenic diversity in the immune responses of sheep experimentally challenged with Campylobacter fetus subsp. fetus. Infect. Immun. 71:147-154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Guerrant, R. L., R. G. Lahita, W. C. Winn, Jr., and R. B. Roberts. 1978. Campylobacteriosis in man: pathogenic mechanisms and review of 91 bloodstream infections. Am. J. Med. 65:584-592. [DOI] [PubMed] [Google Scholar]
  • 24.McCoy, E. C., D. Doyle, K. Burda, L. B. Corbeil, and A. J. Winter. 1975. Superficial antigens of Campylobacter (Vibrio) fetus: characterization of an antiphagocytic component. Infect. Immun. 11:517-525. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Moran, A. P., D. T. O'Malley, T. U. Kosunen, and I. M. Helander. 1994. Biochemical characterization of Campylobacter fetus lipopolysaccharides. Infect. Immun. 62:3922-3929. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Pei, Z. R., T. D. Ellison, R. V. Lewis, and M. J. Blaser. 1988. Purification and characterization of a family of high molecular weight surface-array proteins from Campylobacter fetus. J. Biol. Chem. 263:6414-6420. [PubMed] [Google Scholar]
  • 27.Pei, Z., and M. J. Blaser. 1990. Pathogenesis of Campylobacter fetus infections: role of surface array proteins in virulence in a mouse model. J. Clin. Investig. 85:1036-1043. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Pérez-Pérez, G. I., and M. J. Blaser. 1985. Lipopolysaccharide characteristics of pathogenic campylobacters. Infect. Immun. 47:353-359. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Pérez-Pérez, G. I., M. J. Blaser, and J. H. Bryner. 1986. Lipopolysaccharide structures of Campylobacter fetus are related to heat-stable serogroups. Infect. Immun. 51:209-212. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Ray, K. C., Z. C. Tu, R. Grogono-Thomas, D. G. Newell, S. A. Thompson, and M. J. Blaser. 2000. Campylobacter fetus sap inversion occurs in the absence of RecA function. Infect. Immun. 68:5663-5667. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Salama, S. M., M. M. Garcia, and D. E. Taylor. 1992. Differentiation of the subspecies of Campylobacter fetus by genomic sizing. Int. J. Syst. Bacteriol. 42:446-450. [DOI] [PubMed] [Google Scholar]
  • 32.Sambrook, J. E. F., Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
  • 33.Skirrow, M. B. 1990. Campylobacter and Helicobacter infections of man and animals, p. 531-545. In M. T. Parker, and L. H. Collier (ed.), Principles of bacteriology, virology, and immunity, 8th ed., vol. 2. Edward Arnold, London, England. [Google Scholar]
  • 34.Sleytr, U. B., and T. J. Beveridge. 1999. Bacterial S-layers. Trends Microbiol. 7:253-260. [DOI] [PubMed] [Google Scholar]
  • 35.Smibert, R. M. 1978. The genus Campylobacter. Annu. Rev. Microbiol. 32:673-709. [DOI] [PubMed] [Google Scholar]
  • 36.Thompson, S. A., and M. J. Blaser. 2000. Pathogenesis of Campylobacter fetus infections, p. 321-347. In I. Nachamkin and M. J. Blaser (ed.), Campylobacter, 2nd ed. American Society for Microbiology, Washington, D.C.
  • 37.Thompson, S. A., O. L. Shedd, K. C. Ray, M. H. Beings, J. P. Jorgensen, and M. J. Blaser. 1998. Campylobacter fetus surface layer proteins are transported by a type I secretion system. J. Bacteriol. 180:6450-6458. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Tremblay, C., C. Gaudreau, and M. Lorange. 2003. Epidemiology and antimicrobial susceptibilities of 111 Campylobacter fetus subsp. fetus strains isolated in Quebec, Canada, from 1983 to 2000. J. Clin. Microbiol. 41:463-466. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Tu, Z. C., K. C. Ray, S. A. Thompson, and M. J. Blaser. 2001. Campylobacter fetus uses multiple loci for DNA inversion within the 5′ conserved regions of sap homologs. J. Bacteriol. 183:6654-6661. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Tu, Z. C., F. E. Dewhirst, and M. J. Blaser. 2001. Evidence that the Campylobacter fetus sap locus is an ancient genomic constituent with origins before mammals and reptiles diverged. Infect. Immun. 69:2237-2244. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Tu, Z. C., T. M. Wassenaar, S. A. Thompson, and M. J. Blaser. 2003. Structure and genotypic plasticity of the Campylobacter fetus sap locus. Mol. Microbiol. 48:685-698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 42.Tu, Z. C., D. W. Ussery, D. T. Pride, and M. J. Blaser. 2003. Genomic characteristics of the Campylobacter fetus sap island. Genome Lett. 2:40-46. [Google Scholar]
  • 43.Tummuru, M. K., and M. J. Blaser. 1992. Characterization of the Campylobacter fetus sapA promoter: evidence that the sapA promoter is deleted in spontaneous mutant strains. J. Bacteriol. 174:5916-5922. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Tummuru, M. K., and M. J. Blaser. 1993. Rearrangement of sapA homologs with conserved and variable regions in Campylobacter fetus. Proc. Natl. Acad. Sci. USA 90:7265-7269. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Wang, E., M. M. Garcia, M. S. Blake, Z. Pei, and M. J. Blaser. 1993. Shift in S-layer protein expression responsible for antigenic variation in Campylobacter fetus. J. Bacteriol. 175:4979-4984. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Wesley, I. V., and J. H. Bryner. 1989. Antigenic and restriction enzyme analysis of isolates of Campylobacter fetus subsp. venerealis recovered from persistently infected cattle. Am. J. Vet. Res. 50:807-813. [PubMed] [Google Scholar]
  • 47.Wilson, K. 1995. Preparation of genomic DNA from bacteria, p. 2.4.1-2.4.5. In F. M. Ausubel, R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A. Smith, et al. (ed.), Current protocols in molecular biology, vol. 1. John Wiley & Sons, Inc., New York, N.Y. [Google Scholar]
  • 48.Winter, A. J., E. C. McCoy, C. S. Fullmer, K. Burda, and P. J. Bier. 1978. Microcapsule of Campylobacter fetus: chemical and physical characterization. Infect. Immun. 22:963-971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49.Yang, L. Y., Z. H. Pei, S. Fujimoto, and M. J. Blaser. 1992. Reattachment of surface array proteins to Campylobacter fetus cells. J. Bacteriol. 174:1258-1267. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Infection and Immunity are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES