8th. National Conference on Medical Sciences: “Medicine in the Genomic Era”

Malays J Med Sci. 2003 Jul;10(2):105.

New Insights on Genomic and Medicine

Abstract

The role of genetics in medicine has been recognized for many years and further genetic research is to understand the gene functions and the gene interactions with the environment. These were made easier with the launching of the Human Genome Project whose aim is to decipher and decode the entire human genome and to understand their structure and functions. It will be beneficial to the biomedical research and the applications of genomic knowledge in the practice of medicine. The successful completion of the Human Genome Project has shown an impact on medicine. It supports the research to unravel the mysterious of human biology and provide wealth of new information for the clinicians to understand the diseases. These will help to develop new technologies for the diagnosis, prevention, and treatment of single gene disorders, complex disorders with the promise for new therapies. Large scale genotyping and short nucleotide polymorphisms (SNP’s) discoveries have shown why some individuals are susceptible to certain disease like diabetes, cancer, or suffers serious drug reactions. This knowledge of the genetic differences in an individual can change the management and treatment of the disease based on personal genetic make-ups such as drug response, influence and adverse reactions. This approach will lead to a personalized medicine in a near future. As such early identification and detection of pre-symptomatic individual at-risk as in cardiovascular medicine, hematology, oncology, gastroenterology, hepatology, psychiatry and psychology are in highly needed. Thus the challenges for the efficient incorporating of genomic in medicine are entirely on the intelligent use and application of the genetics information in the clinical practice and in creating the new health policy and public education. There are need for encouragement to educate the public and be proactive too in reducing the public anxiety and ignorance of the emerging genetic knowledge. The challenges in this genomic era are an exciting development of exploring the genome and intense research in transcriptomic, metabolomics, proteomics bioinformatics and drug discovery and development. With further technological advancement and genomic research we will expect more exciting progress in the applications of genomic in medicine.

Malays J Med Sci. 2003 Jul;10(2):105.

New Insights on Genomics and Medicine

Poh San LAI ¹

Abstract

The recent completion of several genome sequencing projects has unlocked new and exciting perspectives towards understanding the biological functions and interactions of nucleotide sequences and genes. Indeed the success of the Human Genome Mapping Project has given great impetus to the practice and application of molecular medicine. An appreciation of the importance of genetics, and the applications resulting from genomics research will provide us the knowledge and the tools towards the ultimate goals in medicine, ie. improving healthcare and quality of life. New breakthroughs in different technologies in proteomics, recombinant biology, bioengineering, pharmacogenetics, drug discovery, nanotechnology, functional and structural biology, high-density functional studies, etc. can all be harnessed to provide a multi-dimensional perspective on disease diagnosis, treatment and management. For example, as we progress towards a better understanding of the genetic components of major killers of life such as diabetes, strokes, heart disease, major psychoses or cancers, integrating new technologies can help offer novel forms of treatment whether through gene therapy, stem cell therapy or nuclear reprogramming, or offer insights into the molecular basis or mechanism of genetic diseases, and genes which confer susceptibility to these diseases. Carrying out genetic profiling of a patient’s drug-metabolizing enzymes can eventually offer optimal treatment since a customized drug regiment can be drawn up based on each individual’s metabolic pattern. Our ability to reduce population disease incidence and offer therapy will influence a society’s disease gene burden, and affect the morbidity and mortality risks of patients. The new discoveries in genomics will thus usher in a new era in disease control and management. However, we are only at the beginning of this post-genomics era, and there are still many unresolved questions about the biological roles and complex interactions between genes. We can indeed look forward to another chapter of new and unexpected discoveries as further technological developments and exciting breakthroughs are made in molecular biology and genomics.

Malays J Med Sci. 2003 Jul;10(2):105–106.

Considerable Ethical, Social and Legal Implications in Genomic Medicine

Isa M Nizam ¹

Abstract

The words “gene, genetics, genome and genomics” have become a house hold words which have transformed not only the health of mankind but also the economics of the nations. It is one of the major outcomes of the launching of the Human Genome Projects that aimed to understand the entire human genome at the molecular level. The success of this biggest biomedical project of the late century has an astounding effect on biomedical research and mankind. The project that had successfully sequenced the entire human genome has finally achieved to catalogue the human gene variations. Those variations have unlocked the genetic mysteries of single gene disorders and complex diseases such as diabetes, schizophrenia, hypertension and many common cancers. This genetic information provides opportunities to the prediction of the disease development and the genetic influence as a risk factor. It also allows an approach in identification of susceptibility and in modifying those genes to specifically design targeted gene-based therapies. While recognizing the implications of the Human Genome Projects to the society, interactions of information with philosophical, theological and ethical perspectives were examined thoroughly. It is an integral part of the project the ethical, legal and social issues (ELSI) are given considerable attentions. Studies are focused on the privacy and fairness of the interpretation of the genetic information, clinical integration of new technologies, issues surrounding genetics research and public and professional educations. All these interrelated issues were anticipated, considered and resolved accordingly as to develop guidelines and policies for research advances and medical applications.

HMI is where people and technology meet. This people-technology intercept can be as simple as the grip on a hand tool or as complex as a flight deck of a jumbo jet. Nowadays human interact more with computer-based technology than with hammers and drills. Unlike tools, the visible shape and controls of a computer do not communicate its purpose. The task of an HMI is to make the function of a technology self-evident. HMI effectiveness is measured by a number of components, such as learnability and productivity. These components are sometimes brought together under title of “usability”, and also known as quality of use. Three components of quality of use applicable to design of HMIs are:

# Effectiveness; Does the product do what the users require? Does it do the right thing?
# Efficiency; Can the users learn the HMI quickly? Can they carry out their tasks with minimum expended effort, including a minimum error? Does it improve the productivity/effort ratio? Does it do things right?
# Satisfaction; Do users express satisfaction with the product? Does the new product reduce stress? Do the end users now have a more satisfying job?

Important considerations for input devices (intelligent gloves, joystick, pressure pad), displays (including visual alarm indicators) and device labeling include ambient light levels, viewing angles, and the presence of other devices in the use environment. When certain types of equipment are used in close proximity with other devices, it could be difficult for users to associate visual displays and auditory signals with the corresponding equipment. HMI utilizes an array of intelligent sensors to facilitate the process of acquiring the relevant data from the environment. There is increasing realization that some tasks can be performed significantly better by humans than machines but, due to associated hazards, distance, etc., only a robot or machines can be employed. For example, there is a great need for dexterous, fast, accurate teleoperated robotic systems with the operator’s ability to “feel” the environment at the robot’s field.

This presentation will give an overview of Human-Machine Interfaces for applications in medicine, the extent of its progress and possible application.

Malays J Med Sci. 2003 Jul;10(2):107.

Concept of Disease Burden Measures

Virasakdi Chongsuvivatwong ¹

Abstract

Classical epidemiological measures of disease burden using morbidity has a limitation in comparing different diseases of different nature whereas mortality alone ignores non-fatal burden. Economic loss of health is also an invalid measure because the poor often earn less and thus are implied to lose less. Modern measure of disease burden adds years of life loss (YLL) with years living with disability (YLD) making the burden from different diseases and different risk factors more comparable thus assisting priority setting. The method is, however, not ideal. Apart from assumption made on disease magnitude and natural history, value judgement on discount rate and age weighting are the main limitation. Current data show that regions with high YLL also suffer from high YLD.

Malays J Med Sci. 2003 Jul;10(2):107–108.

Global Burden of Disease: Implications on Health Policy

Syed Mohamed Aljunid ¹

Abstract

Global Burden of Disease Study (GBD) in 1993 introduced a new tool for measuring the fatal and non-fatal impact of diseases through the use of disability adjusted life year (DALY). DALY combines years of life lost from premature deaths with years of life lived with disability to produce a single indicator to quantify the burden of diseases. The GBD project showed that traditional diseases such as communicable diseases, maternal and perinatal conditions and nutritional deficiencies still take a large toll despite efforts and attention given to these conditions in the past decades. However by taking into account both the disability and deaths, it was clearly shown that, in the future, non-communicable diseases such as heart disease and mental illnesses would replace infectious diseases and other traditional diseases in the league table of top diseases.

Theoretically, DALY could be utilised by policy makers in health sector to set priority in allocation of scarce resources. Through cost-effectiveness studies, this new index could be used to re-package essential health services in developing countries by targeting resources to diseases that would reduce significant burden on the society. Nevertheless the use of DALYS in policy making may be limited by a number of factors. Lack of morbidity and mortality data on common diseases in developing countries is a major obstacle. The most difficult part of DALY equation is to compute the years of lost to disability (YLD). Great efforts are required to obtain information on disability incidence, disability duration, age of onset of disability and distribution of disability by severity level for selected diseases. Otherwise DALY derived by using figures adopted from developed nations will lose its appeal to policy makers. Perhaps the most daunting task faced by developing countries is get a critical mass of researchers to work on the project.

In conclusions, DALYS is a very useful tool to assist policy making in health care but lack of basic data and insufficient technical expertise in developing countries are the major issues. Unless these shortcomings are solved, DALY will remain as a tool to be admired by researchers at the ivory towers.

Malays J Med Sci. 2003 Jul;10(2):108.

Recent Trend in the Burden of Occupational Diseases and Injuries in Malaysia

Rusli Bin Nordin ¹

Abstract

WHO has undertaken a project to update its earlier work on the Global Burden of Disease (GBD) due to an array of risk factors ranging from tobacco smoking to contaminated drinking water. This effort is aimed at estimating the GBD associated with most key risk factors, at a global level and within a framework that is common to a wide array of risk factors. The common comparative risk analysis is based on a method for measuring the burden of disease as disability adjusted life years (DALY’s). The method incorporates both mortality and morbidity into one single measure allowing for international comparisons. The risk factors include seven environmental factors (water, sanitation and hygiene, indoor air pollution, ambient air pollution, lead, climate change, unsafe food). Other risk factors relate to addictive substances (nutrition, life-style, unsafe sex, unsafe heath practices, abuse, violence). There are selected occupational risk factors being assessed by WHO, using a common framework to allow a certain level of comparability between risk factors. These factors include 1. occupational lung and bladder carcinogens, leukemogens, and asbestos (mesothelioma), 2. occupational ergonomic stressors, 3. occupational injuries, 4. occupational noise, 5. selected occupational airborne particulates: silica, asbestos, coal dust, 6. occupational sharps injuries in health-care workers, and 7. work-related stress. A collaborative study into the Burden of Disease and Injury (BDI) in Malaysia was launched in 2001 by the Ministry of Health with a view to providing an estimate of disease morbidity and mortality using DALY as an important tool of analysis. This study, to be completed by the end of 2003, is expected to be useful for assessing health care performance, generating informed debates on values and priorities, identifying national control priorities, training of health care workers, research and development priorities, resources for health intervention, and integration of health intelligence. An important area of national concern is the extent and impact of the Burden of Occupational Diseases and Injuries (BODI) on productivity as Malaysia marches towards becoming an industrialised nation by 2020. Despite the paucity of data from existing reporting systems (Ministry of Health, Department of Occupational Safety and Health, and Social Security Organization), recent trend in occupational diseases and injuries in Malaysia suggests the emergence of new occupational safety and health (OSH) challenges in the new millenium: new ICT and automation, new chemical substances and physical energies, health hazards associated with new biotechnologies, transfer of hazardous technologies, aging working populations, special problems of vulnerable and underserved groups (such as the chronically ill, handicapped, and migrant workers), problems related to increased mobility of workers, and diseases of various origins.

Keywords: Global Burden of Disease, Burden of Occupational Diseases and Injuries, DALY, OSH Challenges, Malaysia

Malays J Med Sci. 2003 Jul;10(2):110.

Effect of Albendazole on Cognitive Performance of Rural Primary School Children in Kelantan

AH Anees ¹, A Zulkifli ¹, MH Mohd Hashim ¹, A Azni ², N Kumaraswamy ¹

Abstract

Objective :

To determine the effect of albendazole on cognitive performance of rural primary school children in Kelantan.

Introduction :

Children’s learning ability depends on their socioeconomic background and health status. Children, who are under nutrition, suffering from protein energy malnutrition, parasitic infections and other medical diseases does not have the same potential for learning as healthy and well nourished children. A few studies have shown that helminthiasis affect cognitive function of children.

Methodology :

An intervention study involving 8 primary school children in Bachok aged from 9 to 11 years. The methods of sampling was cluster sampling. Fecal samples were collected and identification of worms egg and worm load was done by modified egg’s counting.

The psychology tests given were Arithmetic test (measures mathematical knowledge, mental computations and concentration), Digit Span Forward and Backward tests (measures attention span and short term memory). These three test were taken from the Wechsler Intelligence Scale for Children. The other test given was the Raven’s Colored Progressive Matrices which measures reasoning ability based on figure materials. Each of the tests was administered individually to the child. The schools were randomly assigned into treatment and control school. Each of the child in the treatment group received 400mg syrup Albendazole regardless of their worms infections status. After 5 months all of the tests were repeated.

Results :

A total of 544 (91.4%) out of 595 completed this study. Control group (n=319) consists of female children 133 (24.4%) and male children 186 (32.2%). Treatment group (n=225) consists of 112(20.6%) female children and 113 (20.8%) male children. Prevalence of total worm infections was 74.6% (n=406). For treatment group, prevalence of Trichuris trichuria, Ascaris lumbricoides and hookworms were 68.4%, 54.2% and 1.8% respectively. For control group, prevalence of Trichuris trichuria, Ascaris lumbricoides and hookworms were 67.4%, 47.6% and 1.9% respectively. On pretest, the infected group performed significantly poorer in the Coding test (t = 2.53, p = 0.012) and the Raven’s Colored Progressive Matrices test (t = 2.61, p = 0.002). After 5 months, univariate analyses showed significant results in all 5 cognitive tests (p < 0.001). Multivariate analysis using GLM repeated measures showed significant different in the Arithmatic test (F_1,472 = 9.19, p= 0.003), the Coding test (F_1,472 = 4.72, p=0.013) and the Raven’s Colored Progressive Matrices test (F_1,472 = 9.257, p=0.002).

Conclusion :

Children who have helminthiasis have poorer cognitive function. Deworming with a single dose of 400mg syrup albendazole can improve their cognitive performance.

Keywords: Albendazole, cognitive function, rural, primary school children, Kelantan

Malays J Med Sci. 2003 Jul;10(2):110.

Characteristic Ocular Findings in Kelantanese Children with Down Syndrome

AT Liza Sharmini ^*, BA Zilfalil ^**

Abstract

Objective :

To identify the characteristic of ocular manifestations of Down syndrome patients attending the ophthalmology clinic at Hospital Universiti Sains Malaysia.

Introduction :

Down syndrome is known to be associated with ocular defects. The types and frequency of these defects a in our local population is not known. The results of this study would therefore serve as a useful baseline data for future research in this area.

Methodology :

A total of 23 children with Down syndrome seen between one month and 17 years of age were examined for ocular findings from January 1995 to March 2003. Ocular examination including visual acuity assessment, slit lamp biomicroscopy, ocular motility, cycloplegic refraction and ophthalmoscopy were performed whenever possible.

Results :

The ocular findings in decreasing prevalence were the following; epicanthic fold 59.1% (13), nystagmus 52.2% (12), strabismus 30.4% (7): all were esotropic, bilateral congenital cataract 21.7% (5), eyelids abnormalities 21.7% (5) (entropion in 6 eyes, chalazion in 2 eyes, style in 1 eye and ptosis in 1 eye), blepharoconjunctivitis 18.2% (4), glaucoma 13.0% (3), nasolacrimal duct obstruction 8.7% (2) and chronic uveitis 4.3% (1). Catford drum (60.9%) is the commonest method used to assess visual acuity with 19 eyes (41.3%) achieved good vision (6/12 to 6/9). Cycloplegic refraction were done in 11 patients (47.8%). Refractive errors in decreasing prevalence were the following; hyperopia 60% (3), myopia 20% (1) and astigmatism 20% (1).

Conclusion :

Kelantanese children with Down syndrome demonstrate unreported, high incidence of nystagmus, congenital cataract and eyelid abnormalities especially chalazion and essentially no notable Brushfield spots or keratoconus, which are in contrast to ocular findings in Caucasian patients with Down syndrome.

Malays J Med Sci. 2003 Jul;10(2):110–111.

A Comparative Study between Smokers and Non-Smokers

Agvina Bernadine Dicom ¹

Abstract

Cigarette smoking is a consequential habit that influences various physiological processes of a smokers body. This study is aimed at observing the short and long term effects of smoking on several physiological parameters of the human body. Subjects involved in the study consist of two groups of men, the first group consists of 15 smokers with an average age 0f 27.73 ± 2.38years and an average BMI of 24.21 ± 1.39 kg/m² while the second group consists of 15 non-smokers with average age of 27.60 ± 2.58 years and an average BMI of 22.03 ± 0.86 kg/m². Each smoker is matched according to weight, height age and BMI with a non-smoker. The study is conducted in two halves. The first half of the study which is a comparison between the smokers and non smokers found that there was a significant decreased (p<0.05) in smoker’s forced vital capacity (FVC) (14.67%), forced expiratory volume in the first second of expiration (FEV1) (15.67%), tidal volume (VT) (46.43%) and maximum voluntary ventilation (MVV) (23.35%) during the lung function test while a significant increase (p<0.05) was noticed in levels of total cholesterol (TC) (33.13%), tryglycerides (TG) (36.43%) and low density lipoproteins (LDL) (37.30%) for blood lipid profiles and in levels of malondealdehyde acids (MDA) (18.63%) and conjugated dienes (CD) (55.53%) for lipid perixidation tests. Smoker’s lipid profiles also indicated a significant decreased (p<0.05) in levels high density lipoproteins (HDL) (32.97%). The second half of the study which compares smoker’s lung function before smoking and 30 minutes after smoking showed a significant decrease (p<0.05) in FVC (7.76%) and FEV1:FVC ration (3.91%) whereas a significant increase (p<0.05) in VT (26.92%) was noticed. In conclusion, the comparative study between smokers and non-smokers produced results supporting previous theories regarding the many health effects of smoking, however the second half of the study did not achieve it’s objective.

Malays J Med Sci. 2003 Jul;10(2):111.

A Study on Risk Factors of Repeated Admission among Schizophrenic Patients in Hospital Kota Bharu

SB Draman ¹, MR Merchant ¹, Tg Arif ¹, M Harmy ¹, SB Ismail ¹, SS Jasmit Singh ¹

Abstract

Introduction :

Abstract

Introduction :

Multiple point mutations alone or combination of different alleles of the CYP2D6 gene have been characterized in order to elucidate the molecular mechanistic basis of this enzymatic variability. The information of mutations causing the decrease or the loss of function of alleles rendered possible usage of simple assay using Alleles Specific Polymerase Chain Reaction (ASPCR). The ASPCR is used to detect each of the alleles in genomic DNA samples and thereby enables us to predict the alteration of the metabolic capacities of patients or volunteers against CYP2D6 substrates. However the efficiency of the CYP2D6 genotyping using these assays is still limited to known mutations and it require tedious optimization process. One of the rapid, easiest and most sensitive technique is Single Strand Conformation Polymorphisms (SSCP) analysis of DNA fragment amplified by the PCR. It relies on the principle that the electrophoretic mobility of a single-stranded DNA molecule in a non denaturing gel is dependent on its structure and size. SSCP has been used to display point mutations for small amplicons (100-300bp) for known and new mutation. We therefore employed SSCP to target for high throughput population screening of both new and existing mutations. In this presentation, we compare the results obtained for SSCP and ASPCR for alleles CYP2D6*10 .

Objectives :

To compare Alleles Specific Polymerase Chain Reaction and Single Strand Conformation Polymorphisms (SSCP) methods for analysis of CYP2D6*10 genotyping in Malaysian population..
To sequence DNA samples to confirm specific CYP2D6*10 mutation site.

Methodology :

Genomic DNA from healthy volunteers was extracted from blood using standard methods. Genotyping was performed using optimized method of ASPCR and SSCP. Both the methods involved amplification of 1^st PCR fragment Exon 1 to Exon 6 of CYP2D6 gene. For ASPCR, 2^nd PCR was performed for parallel identification of wild type and mutant alleles using specific primers. The product was electrophorezed using agarose gel stained with ethidium bromide. For SSCP, 2^nd PCR was performed to amplify Exon 1 which contains CYP2D6*10 mutation. The product were then resolved using the Amersham SSCP Starter Kit on Pharmacia Biotech GenePhor Electrophoresis System and the profile was captured. Results were confirmed by sequencing of the PCR2 product using the ABI 3100 Sequence Analyzer.

Results and discussion :

PCR1 produced 2990bp DNA fragment from Exon 1 to Exon 6. In SSCP, PCR2 produced DNA fragment 221bp of Exon 1 while in ASPCR, a product size of 330bp were observed.. The SSCP fragment analysis of the product that have CYP2D6*10 mutation site showed the alterations in the separation pattern compared to the pattern that was observed in wild type sample.

Conclusion :

SSCP as well as ASPCR are useful for the determination and genotyping of CYP2D6*10. SSCP would be used for screening of larger population and be optimized for use for mutations in other exons of CYP2D6 gene and other CYP’s genes.

Malays J Med Sci. 2003 Jul;10(2):112–113.

Identification of RET/PTC & P53 in Multinodular Goitre

Othman Nor Hayati ¹, M Madhavan ¹, BM M Hamdi ¹

Abstract

Introduction :

The enlargement of thyroid gland (Multinodular goitre) is not conventionally thought to be a precursor of malignancy. This concept has now been challenged ⁽¹⁾. RET/PTC gene is a gene located in chromosome 10. Mutation of this gene is seen in many thyroid cancers. p53 is a tumour suppressor gene located on chromosome 17. Mutation of p53 is seen in many human cancers including thyroid, however its expression in thyroid cancer is not ascertained.

Objectives :

To determine and correlate the RET/PTC and p53 expression with the development of neoplastic transformation of thyroid lesion.

Methodology :

The expression of RET/PTC and p53 antigen in 63 surgically resected thyroid, which comprises of neoplastic, nodular hyperplasia and normal tissue were analyzed using Strep ABC method ⁽²⁾. This was followed by statistical analyses to determine the risk of malignancy transformation and cumulative risk of distant metastases.

Results :

The results showed that, RET/PTC expression was significantly different among neoplastic (36.5%), nodular hyperplasia (28.6%) and normal tissue (4.7%) (p<0.01), and carry a significant risk of being a carcinoma (OR=0.131; 95% Confidence Interval 0.027–0.645; p<0.05; p=0.008). p53 expression was not significantly different among neoplastic (7.9%), nodular hyperplasia (6.3%) and normal tissue (0.0%) (p>0.05), and did not carry a significant risk of being neoplastic (OR=0.412; 95% Confidence Interval 0.098–1.738; p>0.05; p=0.272). However the cumulative risk of distant metastases was not significant in either RET/PTC (p>0.05; p=0.228) or p53 (p>0.05; p=0.989) expressing thyroid carcinomas.

Discussion :

Our findings suggested that RET/PTC is expressed in most thyroid cancer and its presence in thyroid lesion could indicate malignancy transformation. However, p53 expression does not seem to have this role.

Acknowledgments

This research was made possible by cooperation from the Department of Surgery, School of Medical Sciences and USM Short term grant: 304/PPSP/6131189.

References :

1.Madhavan, Nor Hayati Spectrum of thyroid diseases in hospital Universiti Sains Malaysia : a study of 300 consecutive cases. In Abstracts second national conference on medical sciences. Mal J Med Sci. 1996;3(2):58. [Google Scholar]
2.Miller K. Immunocytochemical techniques. In: Bancroft JD, Stevans A, editors. Theory and practice of histological techniques. 4th edn. Sydney: Churchill Livingstone; 1996. pp. 435–470. [Google Scholar]

Malays J Med Sci. 2003 Jul;10(2):113.

Mutation of GJB2 Gene Among Cochlear Implantees in Hospital UKM.

MD Norazlinda ^1,³, I Farah Wahida ^1,³, BS Lokman ², BS Aminuddin ⁴, BHI Ruszymah ^1,³

Abstract

Objective :

To identify mutation of the GJB2 gene among cochlear implantees in HUKM.

Introduction :

Over the past decade, cochlear implantation has become widely established as the treatment of choice for profoundly deaf children who benefit little or none at all from conventional hearing aids. Cochlear implant is a small electronic device that provides a sense of sound to children and adults who have severe to profound hearing loss. The prevalence of profound congenital hearing loss is estimated at 1 in 1000 birth. Congenital deafness refers to deafness present at birth, though the cause of such hearing loss may be hereditary or acquired. Approximately two-third of hereditary deafness is non-syndromic that is no other clinical features besides hearing loss. DFNB1 was the first gene implicated in non-syndromic hereditary hearing loss to be cloned. The causative gene is GJB2 (gap junction protein, beta 2), encodes the protein called connexin 26. The loss or dysfunctional of connexin 26 can cause deafness. In Japanese cochlear implantees, 4 out of 15 (26.7%) carried the 233delC mutation in their GJB2 gene (Matsushiro et al. 2002). Study from our laboratory among deaf students in Kuala Lumpur and Selangor, demonstrated that 18% (12/68) subjects have mutations in their GJB2 gene. From this 12 subjects with GJB2 mutations, 6 of them have V37I mutation. This makes V37I the commonest form of GJB2 gene mutations with the incidence of 50% (Ruszymah et al. 2002). It is an interesting question whether GJB2 mutations are also an important cause of non-syndromic hearing loss among our cochlear implantees in HUKM.

Methodology :

This study involved 15 cochlear implanted patients in Hospital UKM. Each was given a questionnaire and a consent form. Once consented, 10 ml of blood samples were drawn and later being processed in the lab. The target sequence of GJB2 was amplified from genomic DNA via polymerase chain reactions technique using two sets of primers. These two fragments overlapping each other to cover the entire coding region of GJB2. The PCR products were then electrophoresed on a 1.5% agarose gel for purification and later were directly sequenced. The resulting sequences were analyzed for mutations in connexin 26 gene by comparing with 25 hearing normal controls.

Result :

No mutations in the GJB2 gene were found in all the 15 cochlear implantees.

Conclusion :

A similar study in Japan showed that 4 out of 15 cochlear implantees have mutation in their GJB2 gene. Our study does not demonstrate any mutation, this showed that the trend of mutations in GJB2 gene among cochlear implantees is ethnic specific.

References :

1.Matsushiro, et al. Successful cochlear implantation in prelingual profound deafness resulting from the common 233delC mutation of the GJB2 gene in the Japanese. Laryngoscope. 2002;112(2):255–261. doi: 10.1097/00005537-200202000-00011. [DOI] [PubMed] [Google Scholar]
2.Ruszymah, et al. Connexin26 mutation screening among deaf school children in Wilayah Persekutuan and Selangor, Malaysia. 4th HUGO Pacific Meeting & 5th ASIA-Pacific Conference on Human Genetics; 2002. DY-06. [Google Scholar]

Malays J Med Sci. 2003 Jul;10(2):113–114.

Angiotensin II Type I Receptor Gene A¹¹⁶⁶C Polymorphism; Role in Etiology of Essential Hypertension and Aortic Stiffness

A Rehman ¹, A R A Rahman ², S B Ismail ³, L Naing ¹

Abstract

Objectives :

A¹¹⁶⁶C polymorphism of angiotensin II type I receptor (AT1R) gene has been reported in many studies, being associated with essential hypertension (HT) and aortic stiffness, an independent marker of cardiovascular morbidity. Among Asian populations, data on association of A¹¹⁶⁶C polymorphism with HT is controversial while none is available on association of this polymorphism with aortic stiffness measured as pulse wave velocity (PWV). Our aim was to study whether A ¹¹⁶⁶C polymorphism of AT1R gene was associated with HT & PWV among Malays, a distinct ethnic group in Asia.

Design & Methods :

A hundred and sixty HT subjects without evidence of cardiovascular complications and 133 age & sex matched normotensive (NT) subjects without family history of hypertension gave informed verbal consent for genetic analysis. A¹¹⁶⁶C polymorphism of AT1R gene was detected by polymerase chain reaction & DdeI restriction endonuclease digestion (1). Other measurement included body mass index (BMI), blood pressure (BP) & carotid femoral PWV using the Complior^® (Colson, France). Data was analyzed using ANCOVA and multiple linear regression analysis.

Results :

The prevalence of C¹¹⁶⁶ allele was not significantly different between HT (9%) & NT (7%) subjects. A ¹¹⁶⁶C polymorphism had no association with BP and PWV. However when the possible confounders such as cholesterol, triglycerides, BMI, age & sex were included in the model, C¹¹⁶⁶ allele showed a borderline significant association with PWV (p = 0.049). Subjects with C¹¹⁶⁶ allele (AC/CC) had a higher mean PWV than those with AA alleles (10.49 versus 9.8). Influence of C¹¹⁶⁶ allele on relationship between BP & PWV, checked by interaction between BP & gene was not significant (p = 0.659). In the HT group alone, C¹¹⁶⁶ allele had no significant association with PWV (p = 0.111).

Conclusions :

Our data suggests that A¹¹⁶⁶C polymorphism of AT1R gene is not associated with BP but may have a small influence on aortic stiffness measured as PWV. Also C¹¹⁶⁶ allele has no influence on the relationship between BP & PWV in our study population.

To our knowledge this is the first study to report the frequency of C¹¹⁶⁶ allele and its association with BP & PWV among Malays.

Reference :

1.Paillard F, Chansel D, et al. Genotype-phemotype relationship for the renin-angiotensin-aldosterone system in a normal population. Hypertension. 1999;34:423–429. doi: 10.1161/01.hyp.34.3.423. [DOI] [PubMed] [Google Scholar]

Malays J Med Sci. 2003 Jul;10(2):114.

Second-Hand Smoke Exposure and the Effect on Transforming Growth Factor Alpha(TGF A) Gene in Non-Syndromic Oral Clefts Patients.

A Ayu ¹, AR Samsudin ¹, IM Khairani ¹, A Azlina ¹, NL Nik Ahmad Shah ¹, MN Isa ²

Abstract

Objective :

To assess the association between exposure of pregnant women to second-hand smoke during first trimester of pregnancy and allele polymorphism at K-primer and Taq-1 regions of Transforming Growth Factor Alpha(TGFa) gene among sporadic non-syndromic oral clefts patients.

Introduction :

Non-syndromic cleft lip with or without cleft palate (CL/P) is the most common craniofacial congenital anomaly with a significant lifelong morbidity affecting one in every 500 live births in South East Asia and Asia region. The extensive psychological, surgical, speech and dental involvement in oral clefts present a major public health problem in terms of medical costs and emotional burden to patients, their families, communities and countries. Non-syndromic clefts are a complex trait with both genetic and environmental etiology. One of the most common environmental risk factor for congenital defects is exposure of pregnant women to second-hand smoke during the first trimester of pregnancy. Transforming Growth Factor Alpha (TGFa) was selected as a candidate gene in CL/P because of its presence at high levels in epithelial tissue of the palatal shelves at the time of shelf fusion. Variations in Transforming Growth Factor Alpha (TGFa) expression may alter sensitivity to environmental factors such as exposure to cigarette smoking, thereby leading to development of sporadic nonsyndromic oral clefts.

Methodology :

A cross-sectional comparative study was carried out among Malays in Kelantan state. The inclusion criteria were:-Non-syndromic oral clefts, no history of oral clefts in the family, age of the patients less than 10 years to minimize recall bias, contactable mothers and history of exposure to second-hand smoke during first trimester of pregnancy for cases. A total of 46 infants and children were selected. Their ages were 43.5% below 2 years, 32.6% between 3–5 years and 23.9% between 6–10 years. Cases: 22 patients met the above criteria.

Controls :

24 cleft patients but no history of maternal exposure to second-hand smoke. The patients’ mothers were interviewed using a craniofacial registration form to reveal detail information on smoking exposure. Blood samples from the patients were obtained on signed informed consent. DNA was extracted from whole blood using a DNA preparation kit. The primer pairs for TGFa gene was synthesized to amplify regions of the corresponding genes. The restriction fragment length polymorphisms of the 3′- non-coding region of the TGFa gene at K primer region were observed after digestion with Hinf1 which cut allele 4 at the CGAG/A CTCTC sequence. Taq 1 enzyme was used to screen polymorphism at the Taq 1 region. The sequences either contain a restriction site for Taq 1 (allele 2) due to insertion of TAAT, or allele 1 which lack of this site.

Results :

Descriptive data on the duration of maternal exposure to second-hand smoke among cases revealed 59.1% were exposed within 30 minutes to 1 hour and 40.9% were exposed more than one hour per day. Allele polymorphism were analyzed by using Chi Square(X²) test. A significant difference was found at allele 4 of K primer region of TGFa[X² = 5.576; p= 0.018; OR= 4.286; CI (1.246,14.735)]. No significant differences in variants of Taq 1 between cases and controls (X² = 3.942; p= 0.067).

Conclusion :

Maternal exposure to second-hand smoke during first trimester of pregnancy was significantly associated with polymorphism of allele 4 of K- primer region of TGFa gene in sporadic non-syndromic oral clefts patients.

Malays J Med Sci. 2003 Jul;10(2):115.

A Study on Chlamydia Trachomatis Infection in Pregnancy in Hospital Kota Bharu

K Seman ¹, SRJ Noor ¹, NAA Ghaffar ¹, WZW Yusuff ², ZA Hanafiah ², N Maning ³

Abstract

Objectives :

To determine the prevalence of genital Chlamydia trachomatis infection in pregnancy among the attendees of Antenatal Clinic of Hospital Kota Bharu, Kelantan.
To determine the clearance rate of chlamydial infection with one week course of Erythromycin Stearate 500mg qid.

Introduction :

Chlamydia trachomatis infection is the most common sexually transmitted disease worldwide. In pregnancy, it has been associated with morbidity for both the mother and the newborn.

Methodology :

Prospective cross sectional study. 440 pregnant women (age range 17 to 48 years old), in the first to third trimester, attending the antenatal clinic of Hospital Kota Bharu, Kelantan were tested for Chlamydia trachomatis. Endocervical swabs were collected for Chlamydia trachomatis diagnosis by Direct Fluorescence antibody (DFA) technique. The women were then followed up as routine and were advised to deliver in Hospital Kota Bharu.

Results :

Out of 440 pregnant women tested, 96% were Malays and four were tested positive for Chlamydia trachomatis, giving the prevalence rate of 0.9%. There were no statistically differences in the gravidity, parity, socioeconomic status, educational level, history of prematurity or stillbirth or abortion, between the positive and negative group. All of the four women with positive results had no symptoms and they were retested after treatment and all of them were cleared. However, small number of patients precludes further statistical analysis.

Conclusion :

As the prevalence of genital Chlamydia trachomatis infection in antenatal population of Hospital Kota Bharu is very low, the universal screening to detect this infection is not needed. However, it would be helpful to screen those with history of recurrent abortion or other adverse pregnancy outcomes.

Malays J Med Sci. 2003 Jul;10(2):115.

A Study on Common Sexually Transmitted Disease (STD) Infection in Infertile Female in Hospital Universiti Sains Malaysia, Kubang Kerian Kelantan.

NA Zuky Nik Lah ^*, NH Nik Hussain ^*, MD Radzi Johari ^**, Senik Nordin ^**

Abstract

Objective :

To determine local prevalence of common organism in STD infection (Chlamydia, Gonorrhoea and Syphilis) in infertile females in HUSM
To determine the clearance rate of Chlamydial and Gonorrhoea infection after a course of Azithromycin 1 gram
To determine the clearance rate of Syphilis infection after a course of Benzathine Penicillin 2.4 mega units IM weekly for 3 doses or Erythromycin ES 800 mg orally BD for 15 days in a Penicillin allergic patient.

Study Method :

A prospective study involving 150 infertile females under follow up at infertility clinic HUSM between 1^st of August 2001 till 28^th of February 2003. Endocervical samples were obtained to detect Chlamydia trachomatis by direct immunofluorescence, Neisseria gonorrhoea by Gram smear and culture&sensitivity. Blood samples were also obtained for VDRL testing and for Ig M antibody (recent infection) toward Chlamydia. For VDRL testing positive patient another blood sample for Treponema pallidum haemagglutination assay (TPHA) will be taken. In a patient with a positive Chlamydial or Gonorrhoea or both infections, she and her partner will be treated with a single dose of Azithromycin 1 gram orally. After 2 weeks of Azithromycin the respective investigation(s) will be repeated to determine the clearance of such infection(s). The same steps were also applied for a TPHA positive patient with Benzathine Penicillin as an antibiotic of choice or Erythromycin ES in a Penicillin allergic patient.

Result :

Chlamydia infection was present in 6 (4.0%) patients. There was no incidence of gonorrhoea or syphilis infection in the studied population. Out of 6 positive patients with Chlamydia, 3 were detected by Immunoflurescence method and the other 3 by Ig M antibody detection. All repeated investigations after Azithromycin for Chlamydial infection showed a negative testing. The clearance rate of Gonorrhoea or Syphilis is unable to determine as there is no incidence of the infection in the studied group.

Conclusion :

The prevalence of Sexually Transmitted Disease (Chlamydia, Gonorrhoea and Syphilis) infection in infertile female is low in our studied group. The clearance rate of Chlamydia infection by Azithromycin is 100%. This is not a true representation of Malaysian populations as it is a hospital-based study. A larger scale study involving a few centers is needed in order to obtain a better representation of Malaysian populations.

Malays J Med Sci. 2003 Jul;10(2):115–116.

Mission Impossible a Rare Case of Habitual Abortion Due to Isochromosome 21

hakim G Bilal ¹, Nik Hazlina Hik Hussain ¹, M Ros Sidek* ¹, S fatimah Ramli* ¹

Abstract

We describe a case of a 37^th year old women on her 9^th pregnancy at thirteen-week period of amenorrhea. She presented with missed abortion, having lost the first 6 pregnancies during the 1^st trimester, an Intra Uterine Death on her 7^th pregnancy and a full term live baby who happened to be a Down Syndrome and the only living child. Following a series of investigations, her karyotype showed an isochromosome 21. although her physical and mental status are normal but will present a high risk of transmitting this isochromosome which could lead to either Monosomy 21 or Trisomy 21 conceptus and this explains the habitual abortion she had been experiencing. Because of the impossibility of conceiving a normal baby, the patient was advised for bilateral tubal ligation. This is because “the mission is impossible”

Malays J Med Sci. 2003 Jul;10(2):116.

Development of a Multiepitope Tuberculosis Vaccine

Mohammed AA Sarhan ^*, Zainul F Zainuddin ^**, Mustaffa Musa ^*

Abstract

Objectives :

To develop a surface display vector based on the gene for ice nucleation protein from Pseudomonas syringae.
To use the surface display vector to develop synthetic vaccines for induction of protective immunity against tuberculosis.

Introduction :

Tuberculosis in human being is one of the most prevalent causes of death from infectious diseases in the world. BCG vaccine has been widely used in developing countries with high efficiency in reducing incidence rates. However, a worldwide resurgence of TB has been witnessed since the 1980s due to a number of factors, including the introduction of TB by immigrants from endemic areas of the world, the emergence of multi-drug resistant (MDR) strains, in addition to the enhancing effects of the HIV/AIDS epidemics. Consequently, the demands for new vaccination strategies to combat the spread of TB have emerged.

Methodology :

Assembly PCR technique was used to synthesize the gene coding for the Inak-N terminus. Cloning, transformation, and ligation were performed according to the conventional methods to construct the surface display vector which was designated as pMSInak.
A previously constructed synthetic gene of MTB, called VacII was cloned into pMSInak to construct pMSInaK-VacII.
The Inak-VacII fragment was digested by EcoRI/HindIII and cloned into pKK223-3 to construct pKMSInak-VacII

Results :

The synthesis of a gene coding for Inak-N terminus (653bp) was synthesized in a single step by PCR. Inak gene was cloned into pCR“2.1Topo” vector and designated as pMSInak. Inak gene, then was verified by sequencing the complete insert. The VacII gene was 0.82 Kb and contained the four coding sequences for selected mycobacterium T-cell epitopes, namely, ESAT6, MTP40, 38KD, and MPT64. The VacII gene was amplified from a previously constructed plasmid pJWVacII by PCR. It was tagged by a sequence encoding six consecutive histidine residues at the C-terminal sequence allowing a one-step affinity purification of the complex in active form. Fusion of Inak gene to the tagged VacII gene yielded a new construct which was designated pMSInk-VacII. This vector was digested by EcoRI/HindIII to obtain Inak-VacII DNA fragment (1.5Kb), which was then used to construct the expression vector, pKMSInak-VacII, downstream region of the tac promoter of the expression vector pKK223-3. This was then transformed into the expression hosts, E. coli XL-1 blue and S. typhi Ty21a. The target protein with a subunit molecular mass of 52 KDa was expressed and purified from expression hosts by affinity chromatography and confirmed by immunoblotting using anti-histidine antibodies.

Conclusion :

A new display multiepitope vaccine was successfully constructed and expressed in S. typhi Ty21a.

Malays J Med Sci. 2003 Jul;10(2):116–117.

Developing an Effective Fixed Learning Module in Pathology for Phase II Medical Students in Universiti Sains Malaysia

Manoharan Madhavan ¹, Gurjeet Kaur ¹

Abstract

Introduction :

Fixed Learning Module (FLM) is one of the important teaching methods for undergraduate medical students within the integrated system. The resource material of pathology is conventionally exhibited as potted specimens and charts. In this conventional FLM (conFLM), the students find difficulty in understanding pathology due to various reasons.

Aim :

To create an alternate FLM- computerized FLM (comFLM)-material using a web based, interactive computer technology and to compare its effectiveness with the conFLM.

Materials & Methods :

The conFLM materials were selected from the pathology museum. The comFLM (an HTML program) was prepared on female reproductive block (FRB) and musculoskeletal block (MSB) using digital photographs of potted specimens and java script and uploaded in the USM intranet. The phase II MD students were divided into two groups. Each group was exposed to only one type of FLM for each block with a cross over. At the end of each block, the students were given a questionnaire and also assessed by MCQ, computerized objective structured clinical examination (OSCE) and conventional OSCE examination. The data were collected and analyzed by Mann Whitney test.

Result :

Significant difference was observed only in MCQ marks in MSB and computerized OSCE marks in FRB. More than 60% of the students felt comFLM was more interesting, user friendly and they could attend more than once and could learn in their own pace. In contrast, majority (61%) of the students faced problem in conFLM and were unable to appreciate the pathological features seen in the specimen.

Conclusion :

The computerized FLM has many advantages. However it cannot replace the conventional FLM and indeed, both are complementary to each other in effective learning of pathology FLM.

Malays J Med Sci. 2003 Jul;10(2):117.

Problems with Problems in Problem-Based Curriculum: A Little Goes a Long Way!

Anwarul Azim Majumder ¹, Ahmed Fuad Ab Rahim ¹

Abstract

Objectives :

General Objective :

To analyze the ‘problems’ of problem-based curriculum, School of Medical Sciences, University Sains Malaysia.

Specific objectives :

# To examine the demographic characteristics of the people who featured in the problems.
# To determine the extent to which PBL problems and examination questions deal with young people rather than elderly
# To determine the level of acuity of the PBL problems and examination questions i.e. balance between acute and chronic medical conditions in the problems
# To compile “evidence-based” recommendations for policymakers for curriculum review and development.

Introduction :

The School of Medical Sciences, Universiti Sains Malaysia (USM), is the pioneer school in Malaysia to adopt problem-based (PBL) curriculum. Although PBL problems have been used for two decades, there are hardly any analytical studies conducted to provide feedback on the nature of problems developed for PBL.

Methods :

By analyzing the PBL problems and examinations questions of Phase II (Year 2 and 3).

Results :

PBL problems and examination questions emphasize acute and rapidly resolving illnesses in young people whereas elderly people with chronic and irremediable diseases are underemphasized.

Conclusion :

This imbalance may contribute to the development of negative attitudes towards elderly patients and people with chronic diseases as students pass through their undergraduate training. Such attitudes may deter students from careers that focus on the elderly and chronically sick, at the very time when demographers are predicting a rapid increase of elderly populations in Malaysia and worldwide. This has also an important implication as health care is evolving away from the diagnosis and management of acute diseases towards caring for increasingly elderly people with chronic, irremediable illnesses.

Malays J Med Sci. 2003 Jul;10(2):117.

Perception of New Faculty Members about Problem-Based Learning: A Pretest Finding

HAQUE ATM Emdadul ¹, Rogayah Ja’afar ¹, Ahmed Fuad Abdul Rahim ¹

Abstract

Objective :

To present the perceptions of new faculty members of USM about problem-based learning (PBL)

Introduction :

The School of Medical Sciences, USM adopted an innovative curriculum featuring integration, student centered problem-based learning and community orientation. The school has a rapid turn over of academic staff so that new faculty members are regularly being employed from home and abroad to maintain standard teacher-student ratio and to ensure that it’s educational philosophy is achieved. Every year, the Department of Medical Education organises a brief orientation on PBL for newly recruited faculty members.

Methodology :

A questionnaire containing both open and close ended questions were distributed to 40 new faculty members of the School of Medical Sciences, USM just before their participation in a workshop on PBL tutor skills development held in April’ 2002.

Results :

The response rate was 87.5% (35 out of 40). Before joining USM, 20.69% participants never heard about PBL and 10.34% said that they do not have an understanding of PBL. Only 11.43% of the new faculty was involved in a revision of to adopt PBL in the curriculum of their previous institutions. After joining USM, 42.86% didn’t yet go through the PBL curriculum of their own disciplines, but 60% participated in PBL tutorials where 66.66% found PBL working excellent. 80% of the respondents commented that the learning objectives were achieved through the PBL sessions, the triggers relevant and the learning materials helpful. About 20.68% were found unsatisfied with the assessment procedures here but nobody put any suggestions. Most of the respondents’ felt that they were needed more exposure, guidance and orientation on PBL process to be an effective PBL tutors.

Conclusions :

Perceptions of the faculty varied with their level of training and degrees of participation in the PBL curriculum. The viewpoints about PBL in this pre-test were found to be similar to those in other studies. In fact the new faculty members surveyed accepted the PBL curriculum practiced in the School of Medical Sciences, but they expected to be prepared through extensive training and orientation before taking the role of a PBL tutor.

Malays J Med Sci. 2003 Jul;10(2):117–118.

Reasons for Copying in Written Examinations Stated by Medical Students and Teachers of Bangladesh

Arunodaya Barman ¹

Abstract

Introduction :

A tiny book, discovered recently in Nanjing, in east China, may have been used to cheat during national examinations. Unfair means in the examination is not altogether a new phenomenon in countries. It was not so widespread in the past as it is now in the form of mass copying in written examinations. No doubt, it is a consequence of other degenerating conditions prevalent in the society. This study was intended to find out the reasons of copying in examination stated by the medical students and teachers.

Objectives :

Exploring the reasons of copying in written examination to formulate appropriate strategy by curriculum planners, teachers and examiners to prevent this unfair means.

Methods :

This cross sectional qualitative study was carried out within the teachers and students of six government medical colleges of Bangladesh. Questionnaires were distributed among the 399 students and 65 teachers to seek their response in terms of reasons for copying in written examinations.

Results :

The respondents stated thirty five reasons of copying in examination. Some of these are related to curriculum, some are related to assessment, course administration, peer effect, general administration, politics and social situation.

Conclusion :

Reasons for copying are interrelated. To prevent this dreaded ulcer within the manpower development process multiple actions need to be taken.

References :

1.Indian Express newspapers (Bombay) Ltd World Vignettes – The great Chinese cheat trick. 1997.
2.Indian Express newspapers (Bombay) Ltd Controller of exams suspended. 1999. Mar, p. 16.
3.Unfair practice. University of Wales; Swansea: 200-. Jan 6, [Google Scholar]

Malays J Med Sci. 2003 Jul;10(2):118.

Community and Family Case Studies: An Approach to Community-Based Education that Develops Communication Skills in Future Doctors

Abdus Salam ¹

Abstract

Objectives :

To explore the Community and Family Case Studies (CFCS) as an approach to Community-based education (CBE) whether develops the communication skills in future doctors.

Introduction :

The education of doctors has been the subject of a number of enquiries throughout this century. The traditional hospitals are no longer the only or best places to train doctors for the 21st century. Our medical education system has been criticized for hospital-based which have failed in some key areas of teaching. Communication skill is one of them. Competencies like skills in adequate communication with patient and public even with colleagues is due more to poor communication than to any other professional deficiency. Medical schools should identify how to improve communication skills in future doctors. Community and family case studies (CFCS) is an approach to Community-based education (CBE) in the School of Medical Sciences, Universiti Sains Malaysia (USM), which helps to develop communication skills in future doctors. Community based education is a form of teaching learning program that are sets or based at out side the boundary wall of tertiary care hospital where main bulk of population resides. Under this strategy undergraduate medical students have to reside with rural communities for certain periods. During the periods they have the advantages of offering real life exposure; work in groups; participate in community diagnosis and community treatment. The paper is aimed at to identify whether the Community and Family Case Studies (CFCS) as an approach to Community based education (CBE) helps to develop the communication skills in future doctors or not.

Methodology :

A descriptive study was designed to explore the CFCS as an approach to CBE, whether helps to develop the communication skills among participating students. The study was conducted among the CFCS phase-III (academic year-2002/ 2003) 4^th year students of School of Medical Sciences, Universiti Sains Malaysia in February 2003. To collect the data a mixed type of instrument were used based on different aspect CFCS. Working as an academic staff of School of Medical Sciences, USM the author has to supervise a group of CFCS phase III students and administered the instruments to the group and through them to their friends. Sample size was 85. Regarding communication skills respondents were asked to comment on a statement -“CFCS helps to improve my communication skills” as strongly agree, agree, undecided, disagree or strongly disagree. The results then compiled analyzed.

Results :

Among 85 respondents a total of 72.94% (62) agreed and 12.94% (11) were not agreed on CFCS as an approach to develop their communication skills. 14.12% (12) respondents may be in doubtful position and remained in undecided position.

Conclusion :

According to General Medical Council’s (GMC) recommendations “on graduation a medical student should be competent to communicate effectively and sensitively with patients and their relatives”. As the study reveals majority of the respondents opined that CFCS helps to develop their communication skills, so to communicate effectively and sensitively with patient and relatives, CFCS is the approach where students have to deal with patients, their families and the communities as a whole. The educational managers needs to give due importance on CFCS as an approach to Community-based education during their educational management.

Malays J Med Sci. 2003 Jul;10(2):118–119.

Medication Calculation Skills of Registered Nurses in a Pediatric Unit, Hospital University Science Malaysia.

Mohd Rosidah ¹, Mohd Suhaimi Ab Wahab ¹, Noor Aini Hussain ¹

Abstract

Objective :

To survey medication calculation skill of registered nurses in Pediatric Unit, Hospital University Science Malaysia.

Introduction :

Drug management is a part of nursing practice and responsibility towards their patients recovery. Medication administration is a very complex procedure, needing time, attention and error-prone (Anderson and Webster 2000; Pepper 1995). Among the five right principles of drug administration, the right dose is the most difficult to acchieve as it requires knowledge and skills in mathematics (Nora 2001; Williams 1996). This responsibility is more crucial when dealing with pediatric patient as pediatric drug administration requires more calculation than adult. Error in calculation may result in mortality and morbidity.

Methodology :

A cross sectional study was conducted in the Pediatric Unit, Hospital University Science Malaysia. Skill was tested on their ability to calculate dose of ten medications routinely used in the unit. The nurses demographic data was also obtained. All the registered nurses in the unit participated. 20 minute were given to them to complete the questionaire calculation. Calculator was allowed. Results were analyzed descriptively and using Chi-Square test.

Results :

82 respondens 35.4% have some form of error in the calculation. 31% of the error was due to misplacement of decimal point. 24% due to using wrong formula. 41.9% of respondens aged less than 30 years committed error in the calculation but only 31.4% in age of more than 30 years old. 32.6% from 49 respondens credit in mathematic during SPM committed error in the calculation compared to 39.3% from 33 responden which just passed or failed in mathematic. However there were no significant differences among the demographic parameter and the rate of committing error in the calculation.

Conclusion :

The rate is high of error in drug calculation among registered nurses in Pediatric Unit and this is comparable with other study. Although the demographic parameters of the nurses do significantly influence the rate of committing error in the calculation. However further study with bigger sample is needed to look at the factors influencing calculation error.

Keywords: skill, medication calculation, peadiatric, nursing

Malays J Med Sci. 2003 Jul;10(2):119.

Hearing Screening of Infants in Neonatal Unit, Hospital Universiti Sains Malaysia Using Transient Evoked Otoacoustic Emissions.

Mohd Khairi ¹, S Din Suhaimi ¹, H Shahid ¹

Abstract

Introduction :

Significant hearing loss is one of the most common major abnormalities present at birth. Even mild hearing impairment seriously affects language, speech and cognitive development. Early identification and intervention lead to improved communication skills, which positively impact psychosocial, educational and vocational development.

Objective :

This prospective study reports on the prevalence of hearing impairment in neonatal unit population (NICU graduates and less severe ill infants).

The role of surgery in management of metastases in musculoskeletal sarcoma is still controversial. Proper surgical evaluation and subsequent salvage chemotherapy can still improve the final survival outcome of the patient. We present illustration of cases and compilations of five cases of malignant bone and soft tissue sarcomas which has been removed thoracoscopically, followed by salvage chemotherapy

Malays J Med Sci. 2003 Jul;10(2):121.

Ultrasound Application in Differentiating Benign and Malignant Thyroid Nodules: Comparison with Pathological Findings.

NY Nik Rizal ^*, AA Nurul Azman ^*, Z Ahmad Zahari ^{^}, M Madhavan ^∼

Abstract

Abstract

Introduction :

Vocal cord palsy although not common after thyroid surgery may have an increased incidence in cases with advance malignancy, completion thyroidectomy and post irradiated revision surgery. Recurrent nerve damage in these cases may result in excessive breathy and weak voice, inability to xough and fixed vocal cord. Diagnosis is confirmed by 70 rigid endoscopy and Video Stroboscopy. Treatment with variable result include Teffon injection, Laryngeal frame work surgery and reinervation technique. Gor-tex Thyroplasty is anthics and procedure based the concept of medialisation.

Patent & Method :

A. K. a 35 years old female from USM staff developed unilateral. Vocal cord palsy immediate post thyroidectomy rulling in sense hoarsness of voice and fixed @ vocal cord of more than 5 months duration. Patient worked up for diagnosis and documentation utilizing fibreoptic rigid endoscopy and video stroboscopy and voice recording. She was then subjected to Gor-tex thyroplasty under local anaesthesia for restaratim of voice.

Result :

Medialisa

Malays J Med Sci. 2003 Jul;10(2):124.

Anterior Knee Dislocation with Popliteal Artery Injury. An Experience at the Emergency Department Hospital Universiti Sains Malaysia.

Z Mohd Idzwan ¹, MA Mohd Iskandar ¹, A Rashidi ¹, WA Wan Aasim ¹, M Nasir ¹, AB Kamarul ¹, NM Nik Ariff ¹

Abstract

The incidence of knee dislocation is rare. It has a very high association with popliteal artery injury. In dealing with such case, emergency physician has to be prompt in reducing the dislocation and thoroughly look for any vascular complication to prevent amputation or morbidity. This case report illustrates the importance of early reduction and discuss the various method of vascular assessment in emergency department. The issue of whether to reduce or radiography first depends on the vascular patency of the knee dislocation. Vascular assessment in emergency department is done using digital palpation of dorsalis pedis artery or posterior tibial artery, clinical signs of distal ischaemia and duplex doppler ultrasonography. The gold standard is angiography. Not all hospitals in Malaysia have angiography facility. This case report discuss the indication for angiography in knee dislocation which depends on hard and soft signs of distal ischaemia and ankle brachial index using duplex doppler ultrasonography.

Malays J Med Sci. 2003 Jul;10(2):124–125.

An Evaluation of Six Cases Cases of Carotico-Cavernous Fistula (CCF)

AR Ariff ¹, MS Abdullah ¹, A Pany ¹, J Salmah ¹, JM Abdullah ¹, I Zamzuri ¹

Abstract

Purpose :

To highlight the complications that occurred after embolisation of CCF in five of our patients.
To highlight our pioneer experience in dealing with patients with CCF.

Materials and Methods :

HUSM started the vascular interventional procedures in June 2001 under the supervision and guidance from the expert in endovascular procedure. Since then 28 cases have undergone the treatment. The cases were CCF(n=6), AVM(n=7), ICA aneurysm(n=1), renal artery aneurysm(n=1), paraspinal AVF(n=1), uterine fibroid(n=1), AVM(n=5) and Juvenile angiofibroma(n=6). The patients’ age ranged from 15–60 years. We present 6 cases of CCF which had undergone embolisation. The modes of treatment were balloon embolisation(n=4), balloon and fibered coil(n=1) and combination of GDC and n.butyl cyanoacrylate(Histoacryl)(n=1).

Results :

Case 1 :

a 15 – year old boy who had a Rt. carotid artery clamping done to treat CCF. He developed a recurrence of CCF via collateral circulations. An attempt to cannulate the superior ophthalmic vein failed. The carotid artery was directly punctured to insert the micro catheter. 2 detachable silicon balloons were deployed in the cavernous sinus. GDC was used to occlude the adjacent carotid artery.

Case 2 :

an 18 – year old girl developed a transient third nerve palsy immediately after the embolisation of CCF. Two balloons were placed in her cavernous sinus. However her condition improved after a week. Later, one of the balloons was noticed to have ruptured during a follow-upassessment. We assume this caused less compression on the third nerve. Her condition remains stable.

Case 3 :

a 17 – year old boy who developed a recurrence of proptosis due to a rupture of the balloon which occurred 1 week after embolisation. He underwent a second embolisation to occlude the fistula. Now he is completely cured.

Case 4 :

a 32 – year old lady who had a type ‘D’ CCF. GDC was deployed into the cavernous sinus via trans-petrosal cannulation. Feeders were embolised by using histoacryl. She developed a Rt. Side weakness due to the retrograde flow of histoacryl into the untargeted vessel, which accidentally occurred while pulling out the catheter.

Case 5 :

an 18 – year old lady who had a type ‘A’ CCF. She developed a recurrence of proptosis which occurred immediately after embolisation due to a displacement of balloon following an excessive cough and head movement. The fistula was completely occluded after a second embolisation.

Case 6 :

an 18 – year old boy who had a type ‘A’ CCF. A balloon was deployed into the cavernous sinus. Now he is completely cured.

Conclusion :

Management of CCF requires skill and patience.
Patients must be aware of any complications that might arise, for they are unpredictable.

Malays J Med Sci. 2003 Jul;10(2):125.

Intracranial Subdural Empyema in Children, Burr Hole Evacuation and Outcome in Relation to the Initial and Post Treatment CT Scan of the Brain Parameters.

Ahmad Razali bin Md Ralib ¹

Abstract

Introduction :

Subdural empyema is a life threatening suppurative intracranial disease. It has a high mortality and morbidity if not treated promptly. CT scan is an important diagnostic tool due to its easy availability. Burr hole evacuation coupled with appropriate antibiotics treatment gives excellent results in the CT scan era. Many factors such as encephalopathy or coma at diagnosis, elderly or younger age group, delay in starting antibiotics, sterile culture, diffuse extension of empyema, cerebral infarction and ventriculitis had been associated with a poor prognosis.

Objective :

The purpose of this study is to predict the outcome of children with subdural empyema treated with burr hole evacuation using the initial and post-treatment CT scan of the brain parameters and also several clinical parameters.

Materials and Methods :

This is a mixed prospective and retrospective study, performed on 24 patients admitted to Hospital Universiti Sains Malaysia from March 2000 till February 2002 with diagnosis of subdural empyema. They subsequently underwent burrhole evacuation. All patients had an initial pre-operative CT scan of the brain. They were treated with intravenous antibiotics for 6 weeks. The CT scan of the brain was repeated after completion of antibiotics. Patient’s final outcome was reassessed before discharged. The patients’ outcome were correlated with the initial and post-treatment CT scan of the brain parameters and several selected clinical parameters.

Results :

There were 23 cases (95.8%) of subdural empyema secondary to meningitis. All of the patients were younger than 1 year. 14 (79.2%) patients had a good outcome, with 2 (8.3%) mortalities. The presence of hypodense areas in the initial CT scan of brain and low level of consciousness at presentation were indicative of a poor outcome. Diffuse extension of the empyema was also associated with low level of consciousness. However diffuse extension of empyema were not indicative of poor outcome if the patients were treated urgently and aggressively.

Conclusions :

Intracranial subdural empyema is rapidly fatal if not recognised early and managed promptly. Early burr hole evacuation with intravenous administration of high doses of appropriate antibiotics represents the mainstay of treatment.

Supervisors

1. Dr. Abdul Rahman bin Mohd. Ariff

2. Prof. Madya Dr. Jafri Malin Abdullah

Malays J Med Sci. 2003 Jul;10(2):125.

Reconstructive Treatment Following Resection of Lower Limb High Grade Soft Tissue Sarcomas.

AS Halim ¹, AM Leow ¹, Zulmi Wan ¹

Abstract

Introduction :

The lower limb is the most common site for soft tissue sarcomas. These neoplasms often attain considerable size before being detected. Radical surgical excision which has been the main stay of therapy, often resulted in large soft tissue defect which requires soft tissue reconstruction.

Objective :

To review the role of reconstruction in the treatment of soft tissue sarcomas.

Methodology :

All consecutive patients with high grade soft tissue sarcomas of the lower limbs between 1997 to 2002 were reviewed.

Results :

There were 8 patients (5 females & 3 males) with age ranging from 17 to 59 years. The diagnoses were malignant fibrous histiocytoma (n=3), malignant peripheral nerve sheath tumor (n=1), dermatofibrosarcoma protruberance (n=1), fibrosarcoma (n=1), synovial sarcoma (n=1), liposarcoma (n=1). The tumor sizes ranged from 132cm² to 540cm². The soft tissue defects ranged from 153cm² to 600cm². There were 5 free latissimus dorsi flaps, 2 free osteoseptocutaneous fibula flaps (1 vascularized fibula graft and 1 double barreled fibula graft), 1 free rectus abdominis flap and 1 pedicled rectus abdominis flap. Five patients were free of local recurrence & systemic metastases.

Conclusion :

Tissue transfer following oncological resection of lower limb soft tissue sarcomas enhance the efficacy of limb salvage despite of large tumor size.

References :

1.Hidalgo DA, Carrasquillo IM. The treatment of lower extremity sarcomas with wide excision, radiotherapy & free flap reconstruction. Plast Reconstr Surg. 1992;89:96. [PubMed] [Google Scholar]
2.Pisters PW. Combined modality treatment of extremity soft tissue sarcomas. Ann Surg Oncol. 1998;5:464. doi: 10.1007/BF02303867. [DOI] [PubMed] [Google Scholar]
3.Cordeiro PG, Neves RI, Hidalgo DA. The role of free tissue transfer following oncological resection in the lower extremity. Ann Plast Surg. 1994;33:9. doi: 10.1097/00000637-199407000-00003. [DOI] [PubMed] [Google Scholar]

Malays J Med Sci. 2003 Jul;10(2):125–126.

Double Flap Reconstruction After Oncological Resection of Extremity Tumours.

Faizal Ali ¹, AS Halim ¹, Zulmi Wan ¹

Abstract

Introduction :

Currently the standard treatment for management of extremity tumours is limb sparing surgery with immediate reconstruction. Extensive tissue defect will sometimes require more than one flap for adequate coverage. mmediate coverage will allow optimum wound healing for resumption of any adjuvant treatment and decrease the number of days in hospital. This is an analysis of our local experience.

Objective :

To review our experience in double flap reconstruction after extensive resection for extremity tumours.

Methodology :

A retrospective study of all patients who underwent double flap reconstruction whether immediate or delayed after oncological resection for extremity tumours between September 1997 and February 2003.

Result :

There were 3 females and 1 male patient. Average age was 28 years (range 12 to 44 years). Pathological abnormalities include squamous cell carcinoma, giant cell tumour, chondrosarcoma and telangiectatic osteosarcoma. One patient had reconstruction with 2 free flaps while the other 3 patients had reconstruction with 1 free flap and 1 pedicle flap. There were 2 partial flap necrosis requiring skin grafting and 2 re exploration for venous congestion. There were no complete flap failures.

Conclusion :

Double flap reconstruction offers an expeditious treatment option after extensive oncological resection of the extremity. It permits preservation of function, optimal healing time and decrease number of hospital stay.

References :

1.Cordeiro P, Neves R, Hidalgo D. The Role of Free Tissue Transfer Following Oncologic Resection in the Lower Extremity. Ann Plast Surg. 1994;33:9–16. doi: 10.1097/00000637-199407000-00003. [DOI] [PubMed] [Google Scholar]
2.Abudu A, Carter SR, Grimer RJ. The Outcome and Functional Results of Diaphyseal Endoprosthesis After Tumour Excision. J Bone Joint Surg (Br) 1996;78-B:652–7. [PubMed] [Google Scholar]
3.Wei FC, Demirkan F, Chen HC, et al. Double Free Flap in Reconstruction of Extensive Composite Mandibular Defects in Head And Neck Cancer. Plast Reconstr Surg. 1999;103(1):39–47. doi: 10.1097/00006534-199901000-00008. [DOI] [PubMed] [Google Scholar]

Malays J Med Sci. 2003 Jul;10(2):128–129.

The Effect of Low Dose Ephedrine on the Onset Time of Rocuronium

S Ananda ¹, N M Nik Abdullah ¹, O Mahamarowi ¹, P Gnandev ¹, A R Noor Asilah ¹, J Kamarudin ¹

Abstract

Objectives :

To evaluate the effect of low dose ephedrine administration on the onset time of rocuronium.

Introduction :

The time of loss of consciousness to tracheal intubation is a period during which the patient is at risk of hypoxia and pulmonory aspiration. The length of this period is determined by the establishment of neuromascular blockade. Depolarising and non depolarizing neuro-muscular blocking agents have been used for endotracheal intubation. The most rapid onset muscle relaxant for tracheal intubation is still Succinylcholine with an onset time of 45 seconds.

However, this drug has many side effects that have to be weighed prior to its usage which include hyperkalemia, increase in intraocular pressure, intragastric pressure and intracranial pressure. The onset time of rocuronium is partly determined by the speed in which these drugs reach the neuromuscular junction, a factor that appears to be proportional to the cardiac output and muscle blood flow as described by Simhi and Brandon et al., May 1998. Ephedrine is an indirect acting synthetic noncatecholamine that stimulate a and b-adrenergic receptors and may promote increase blood flow to the neuro-muscular junction and therefore may fasten the onset of rocuronium.

Methodology :

Methodology :

A randomized single blinded prospective study was conducted to compare the quality and ease of laryngeal mask (LMA) insertion after induction of anaesthesia either with inhaled sevoflurane or intravenous propofol. A total of 60 ASA I or II unpremedicated adult patients were allocated into 2 equally numbered groups. Each group (n=30) received either inhaled sevoflurane 8% or intravenous propofol 2mg/kg for induction of anaesthesia. Degree of attenuation of laryngeal reflex during LMA insertion, time to LMA insertion, successful first attempts, incidence of apnea and haemodynamic changes before and after inductions were assessed. Complications of LMA insertion and removal were also noted.

Result :

We found that although both groups produced almost equal loss of consciousness, the LMA was inserted more rapidly in patients in the propofol group (mean 73.5 ± 14.9s) than the sevoflurane group (mean 151.8 ± 22.8s). However, the degree of attenuation of laryngeal reflexes was similar as shown from successful first attempts (p>0.05). The overall incidence of complications related to LMA insertion was not significant between the two groups (p>0.05). However, the percentage incidence of apnoea was more in the propofol group (26.7%) than the sevoflurane group (0%). Both groups had no significant haemodynamic changes (p>0.05).

Conclusion :

Inhaled sevoflurane compares favourably with intravenous propofol as induction agent for LMA insertion and can be considered as a good alternative.

Malays J Med Sci. 2003 Jul;10(2):130–131.

Relationship between Pain Intensity, Pain Interference and Prescribed Analgesic of Cancer Patients Hospitalized in Hospital Universiti Sains Malaysia (HUSM)

A Aisyaturridha ¹, WA Wan Aasim ², AR Rogayah ³

Abstract

A cross sectional study was conducted to determine the relationship between pain intensity, pain interference and prescribed analgesic of cancer patients hospitalized in HUSM. This study involved 50 respondents (aged 18 to 60 years) with 54.0% males and 46.0% females. A set of questionnaire (Brief Pain Inventory-Short Form) was used to assess the pain intensity, pain interference and reported pain relief which was validated earlier in pilot study. Pain Management Index (PMI) was performed to measure the adequate prescribed analgesic according to WHO ladder. Sosiodemographic data, clinical data and prescribed analgesic were recorded from patient’s medical record. More than half of respondents were Malays (72.0%) and 28.0% were minority ethnic, respectively. Majority of them were diagnosed bone cancer (20.0%), followed by breast (18.0%), lung (10.0%), gastrointestinal (8.0%), genitourinary (6.0%), head and neck (6.0%), leukemia (4.0%) and others (26.0%). Mean score within 24 hours according to numeric rating scale 11-points, particularly for worst pain intensity was 5.70±2.69, average pain (3.38±1.79), least pain (2.24±1.94) and pain during the interview were 2.80±2.45. Pain interference consisted 4 items; mood, sleep, ability to walk, relationship with others and enjoyment of life measured by numeric rating scale 11-points through BPI-SF. Mean score for following activities within 24 hours were; enjoyment of life (6.08±3.20), followed by sleep (5.24±3.39), ability to walk (5.06±3.73), mood (4.54±2.96) and relationship with others (2.82±2.83). Total mean score for pain interference was 4.74. Based on PMI, more than half of respondents (54.0%) had an adequate prescribed analgesic and 46.0% inversely had inadequate prescribed analgesic. Mean score for reported pain relief was 47.80%. The Pearson correlation indicated positive significant relationship between pain intensity and pain interference (r=0.475, p<0.01). Besides, positive significant correlation was observed between pain interference and reported pain relief (r=0.338, p<0.05). Significant positively correlation also was observed between pain interference and prescribed analgesic (r=0.408, p<0.01). However, there was no significant relationship between pain interference and prescribed analgesic. Chi-square analysis showed there was no significant association between adequate prescribed analgesic with ethnic and gender. In conclusion, this study revealed that the significantly decreased in pain intensity will reduce the pain interference. The finding also shows the importance of adequate prescribed analgesic toward higher pain relief among hospitalized cancer patients, where by there is significant correlation between reported pain relief and prescribed analgesic.

Malays J Med Sci. 2003 Jul;10(2):131.

Reported Oral Health Impacts of Patients Attending HUSM Dental Clinic

AR Ismail ¹, NM Ismail ¹

Abstract

Introduction :

Dentistry has moved from the unidimentional concept of oral diseases to the multidimensional approach of oral health. Dental professionals are more interested in measuring health rather than disease and deformity. With increased fascination in measuring health, numerous studies have appeared in the literature offering an insight into indicator for measuring oral health. There is no single indicator that can be used across all population globally.

Objective :

To investigate self reported impacts of oral health among patients attending HUSM dental clinic.

Methodology :

This is a cross sectional study involving patients attending HUSM dental clinic. Consents are obtained prior to interviews. Questionnaires were developed based on the UKQOL indicator and validated prior to the study. An interviewer was appointed to record the responses. Data was collated using SPSS.

Result :

73.0% of the patients with anterior teeth pain prefer their teeth to be restored as compared to 61.2% in those with posterior teeth pain. A high percentage (59.6%) will only attend dental clinic if they have pains. 55.8% reported of having dental pain within the last one year. 29.2% reported effecting ability to eat, 19/2% aesthetically not good and 17.6% as affecting their speech.

Conclusion :

From the study it was found that dental patients only attend dental clinic if they experienced pain and discomfort and prefer filling to extraction. More effort should be make to improve the dental attendance for regular dental check up. Dental patients perceived impacts of oral health positively.

Malays J Med Sci. 2003 Jul;10(2):131–132.

Oral Hygiene Care of Patients in HUSM Intensive Care Unit.

Shareen a/p Purran Singh @ Nui ¹, Rogayah Abdul Rahim ¹, Farid Bin Che Ghazali ¹

Abstract

Introduction :

Oral hygiene care is a scientific and professional approach that maintains the fungsional capabilities of speech, appetite, social interaction and breathing [Gotay & Moore; 1992, Hassan & Weymuller; 1993, Thomas; 1997]. It is an integrated important procedure in nursing care especially in intensive care units to avoid buildup of bacteremia both locally and systemic, thus maintaining the hydrated state of the oral mucosa. Literature reviews have indicated that the present trends in oral hygiene care protocols practiced is based as a ritual procedure (Miller & Kearney, 2001) and do not actually formed part of the holistic care component in nursing and do not exactly caters for the specific health needs of the patients. Viejo et al(2002) reported that during the first 24 hours of ventilation 78% patients was reported to be positive with gram-positive microorganisms, and 44% gram negative that was associated to Ventilator associated Pneumonia (VAP) with 20– 70% mortality.

Objective :

To assess oral hygiene and oral status in intensive care patients by using a modified oral assessment chart from Beck and Yasko (1993) so as to improve and provide a holistic nursing care especially in intensive care wads.
To recognize the microorganism related to oral ventilated patients by taken a swab from right and left retromolar of buccal area for culture. It is hoped that this study will provides insights update knowledge of possible route of bacteremia especially from oral flora biology in relation to the usage of oral ventilation as such giving insights to the incidence of ventilated associated pneumonia.

Methodology :

25 intubated dentate patients admitted in HUSM intensive care unit was selected (using convenience sampling) during a 2-month period. Oral hygiene status of the selected patients was assessed using the modified oral assessment chart based on the first, third and fifth days of wad admission. Oral swab of the right and left retromolar buccal was taken for microorganism culture. The finding was tabulated using SPSS version 10.0 and analyzed descriptively using non-parametric test –‘Wilcoxon signed rank test’.

Results and conclusions :

64% patients had dry lips, 20% ulceration and bleeding lips, 16% had ulceration at the right corner of the mouth, 24% with dry and coated tongue, 32% tooth with debris and 16% had halitosis. Bacterial colonization shown 80% of patients had gram negative (Acinectobacter, Enterobacter, Proteus, Pseudomonas, Klebsiella and Escherichia coli) and 16% had gram positive (Staphylococcus aeurus, Staphylococcus epidermidis and streptococcus), 4% of patients was infected by candida.

Keywords: Oral hygiene care, oral assessment chart, nursing, intensive care unit

References :

1.Beck S, Yasko J. Guideline s for oral care. 2 ed. Saga products incorporation; Crystal lake IL: 1993. [Google Scholar]
2.Gotay CC, Moore TD. Assessing quality of life in head and neck cancer. Quality of Life Research. 1992;1:5–17. doi: 10.1007/BF00435431. [DOI] [PubMed] [Google Scholar]
3.Hassan SJ, Weymuller EA. Assessment of quality of life in head and neck cancer patients. Head and Neck. 1993:485–495. doi: 10.1002/hed.2880150603. [DOI] [PubMed] [Google Scholar]
4.Miller M, Kearny N. Oral care for patients with cancer: A Review Literature. Cancer Nursing. 2001;24(4):241–253. doi: 10.1097/00002820-200108000-00001. [DOI] [PubMed] [Google Scholar]
5.Thomas CL. Oral care Taber’s cyclopedia medical dictionary. FA Davis; Philadelphia: 1997. p. p24. [Google Scholar]
6.Viejo A, Sole ML, Poalillo FE, Byers JF, Ludy JE. Bacterial growth in secretion and suctioning equipment of orally intubated patients: A pilot study. American J of Critical Care. 2002;11(2):141–149. [PubMed] [Google Scholar]

Malays J Med Sci. 2003 Jul;10(2):132.

Assessment of Growth and Feeding Practices in Children with Cleft Lip and Palate

VK Gopinath ¹, Wan Abdul Manan Wan Muda ²

Abstract

Introduction :

Cleft lip and palate(CLP) are one of the commonest congenital abnormalities, which occur in early pregnancy. Patients with cleft lip and palate present with a number of problems. Among them feeding difficulties is commonly observed and is the most traumatic experience the family has to face. These infants are undernourished and have compromised growth in the early months after birth. Hence assessment of growth in children with orofacial cleft is crucial because it may be treatable in the early stages.

Objectives :

To assess general health and growth parameters in children with CLP and those of normal children.
To investigate the feeding methods of CLP infants and normal infants.

Methodology :

A total of 221 children from birth to six years belonging to both sex with cleft lip/palate(60 children) and normal (161 children) were selected. The CLP and normal children were divided into three subgroups as per the age. They are subgroup I : birth to 2 years, subgroup II : 2 to 4 years and sub group III : 4 to 6 years. Demographic information was obtained through interviews. The attitude and practice of feeding the infants in subgroup I was assessed by using standard piloted questionnaires. The assessment of growth was done at baseline and after six months interval in all the subgroups. General well being of the children was assessed by noting their susceptability to common infections.

Results :

The results of the study showed that in terms of income 27.6% of the respondents had family income of less than RM 1000.00. Parents of CLP children had a significantly lower education than parents of normal children (p < .01). Among CLP children, 31.7 % of them came from family size of 9 – 12 people. Mothers of the normal babies had a positive attitude (p < .01) towards breast feeding. CLP children were more susceptable to infection like fever (p < .05), diarrhoea (p < .05) when compared to normal children. Increment of height was significantly lower (p < .05) in CLP children when compared to normal children.

Conclusions :

Mothers of normal infants had a positive attitude towards breast feed compared to CLP mothers.
CLP children were more susceptable to common infections.

CLP children had a lower height increment when compared to normal children.

Malays J Med Sci. 2003 Jul;10(2):132–133.

Oral Health Status of Operated Cleft Lip and Palate Patients in Kelantan.

NM Ismail ¹, AR Ismail ¹, A Abdullah ¹, N Abd Rahman ¹

Abstract

Introduction :

Oral health is an essential component of health. Poor oral health, untreated oral diseases and conditions significantly impact the quality of life. Oral health status studies carried out globally have shown varying results in several age groups of individuals. Cleft lip and palate (CLP) is a congenital deformity occurring 1 in every 941 children examined in Malaysia (NOHSS’87). The oral health status of CLP patients has not been studied widely. Many countries realize that oral health assessment and subsequent oral health care of these patients are lacking. Therefore oral health status evaluation is essential for all interested in improving the multidisciplinary management CLP patients.

Objective :

To evaluate the oral health status of operated CLP children in Kelantan.

Methodology :

This cross-sectional study involves clinical examination of subjects and direct interviews. The sampling frame in the cleft lip and late register of Cleft Lip and Palate Association of Kelantan (CLAPAK).

Results :

The study showed that 50.9% of the subjects are caries free. 49.1% caries experience with mean DMFT of 6.13 (SD 6.01). 58.7% of the subjects are found to have one more sites of gingival inflammation.

Conclusion :

The percentage of caries free subjects among CLP patients is higher than the national data for 12 and 16 year-old group. Among CLP patients with caries experience, the mean number of teeth affected by caries is still high (6 teeth). Gingival inflammation among CLP patients is higher than the national figure for the 12 year-old age groups (6%). Therefore particular attention should be focused on the gingival health of CLP patients and special emphasis must be given on oral health education.

Minimal Intervention Dentistry is a relatively new concept, which is in contrast to the traditional surgical approach of ‘extension for prevention’ in the treatment of dental caries. The traditional methods involved excess removal of tooth structure while attempting to ideally restore a tooth. The newer concept comes from an increased understanding of the dynamic demineralization-remineralization carious process and the development of adhesion in restorative materials. Early noncavitated lesions can be healed avoiding traditional cavity cutting. Different concepts included as minimal intervention dentistry range from remineralisation of early lesions, reduction in cariogenic bacteria to eliminate the risk of caries, minimum surgical intervention of cavitated lesions to repair rather than replacement of defective restorations. In this paper, emphasis will be laid on minimum surgical intervention of cavitated lesions, the techniques involved, review of the literature and depiction of different cases.

Malays J Med Sci. 2003 Jul;10(2):134.

Maxillary Arch Growth Changes of Cleft Lip and Palate Infants – A Study Based on Dental Models. A Preliminary Result.

Azman Ibrahim ^*, Ab Rani Samsudin ^*, Ibrahim Lutfi Shuaib ^**, AS Halim ^***

Abstract

Introduction :

Cleft lip and palate are birth abnormalities of the mouth and lip. These abnormalities affect about one in every 700 live birth and are more common among Asians and certain group of American Indians than among Caucasians. They occur less frequently among Africans-Americans. Cleft lip and palate occur early in pregnancy when the side of the lip and the roof of the mouth do not fuse together as they should. A child can have cleft lip, cleft palate or both either unilateral or bilateral.

Objectives :

To determine whether the child is progressing at the appropriate rate and direction at the desired growth rate and growth direction.
To study maxillary growth pattern during infancy
To investigate the changes of the deformities
To enable a comparison of the maxillary growth process between normal and malformed subject

Methodology :

Maxillary arch growth changes of cleft lip and palate infants were analyzed in a sample of 20 Malaysian children using dental models.

Non Syndromic patients with no other abnormalities except CLCP was selected from Plastic Surgery Clinic and Oral Maxillofacial Clinic, HUSM, Plastic Surgery Clinic, HKB and also from Combine Clinic at Klinik Pergigian Jalan Mahmud, Kota Bharu. Maxillary arch impressions are taken under general anesthesia before patient undergoes surgical procedure at 3 month old (prior to lip repair), 9 month old (prior to palate repair) and 18 month (post surgically).

Results :

Anatomical landmarks position was determined on the dental models

A series of measurements are selected on landmarks such as premaxilla width, premaxilla length, intercanine width, intertuberosity width, anterior arch length and total arch length. Smaller total arch length and anterior arch length noted. Measurements for premaxilla width, premaxilla length, intercanine width and intertuberosity width are noted larger preoperatively compared to postoperatively

Conclusions :

Operated cleft patients are undergoes several changes of their maxillary arch dimensions compared to non operated cleft patients.

Malays J Med Sci. 2003 Jul;10(2):134–135.

Immunohistochemical Study of the Proliferative and Apoptotic Activity at the Tumour Invasive Front in Oral Squamous Cell Carcinoma.

CN Lee ¹, RB Zain ¹, N Zainal Abidin ¹, SP Khoo ¹

Abstract

Objectives and Introduction :

The tumour invasive front of oral squamous cell carcinoma (OSCC) has long been recognized as an important area which harbour prognostic information. The study of tumour markers at the tumour invasive front has yet to be conclusive. In Malaysia, though there was a recent study of tumour markers at the tumour invasive front, it only involved p53 and PCNA. The aim of the present study were to see the expression of Ki-67, MDM2 and Bcl-2 at the tumour invasive front in the buccal mucosa and also to see if there is any association between the expression of Ki-67, MDM2 and Bcl-2 with the sociodemographic characteristics (age, gender, ethnic group, habits) and clinical histopathological parameters (tumour size, nodal status, TNM staging, Broders’ tumour grading and the pattern of invasion).

Methodology :

The sample of this study consisted of 31 biopsy cases of OSCC from the buccal mucosa which has been histopathologically diagnosed earlier. Immunohistochemical method was employed to stain the samples which involved the use of microwave oven for antigen retrieval and the application of specific antibodies to Ki-67, MDM2 and Bcl-2. Evaluation of the nuclear immunoreactivity of all Ki-67, MDM2 and Bcl-2 was done at the tumour invasive front (3–6 cell layers at the tumour advancing front) with the aid of an image analyser. Significance test was carried out using chi square and Fisher’s exact test for categorical data whereas Mann-Whitney U test and Kruskal-Wallis test were used for continuous data.

Results :

The expression of Ki-67, MDM2 and Bcl-2 were detected in 90.3% (28), 64.5% (20) and 16.1% (5) of the cases in the present study respectively. The distribution Ki-67 and Bcl-2 immunoreactivity was observed to be quite similar where immunoreactivity was mainly at peripheral invading margin of tumour cell islands with decreasing immunoreactivity towards the centre. The distribution of MDM2 immunoreactivity appeared to be the opposite from Ki-67 and Bcl-2 where the immunoreactivity was observed mainly at the suprabasal and the upper regions. The present study found significance association between MDM2 expression with gender and Broder’s tumour grading. Significance association was also observed between combined Ki-67/MDM2 expression with both gender and Broders’ tumour grading.

Conclusions :

The present study appeared to suggest no prognostic significance of Ki-67, MDM2 and Bcl-2 at the tumour invasive front. No association was found between Ki-67 expression as a proliferative marker and both MDM2/Bcl-2 as an apoptotic markers. However, it appeared to support the previous observation that an increase in carcinoma proliferation rate would also be accompanied by an increase in apoptosis.

Malays J Med Sci. 2003 Jul;10(2):135.

A Comparative Evaluation of Strength Properties of Heat Cured Poly Methylmethacrylate (PMMA) Denture Base Resins in Conventional and Fibre-Reinforced Form

Jacob John ¹, SA Gangadhar ¹, Ila Shah ¹

Abstract

Introduction :

Despite the favourable properties of conventional PMMA used as a denture base material, its fracture resistance needs further improvement for better clinical function.

Objective :

This in-vitro study was performed to determine whether the impact and flexural strength of a commercially available heat polymerized acrylic denture base material could be improved through reinforcement with 3 different types of fibres.

Methodology :

Ten specimens of similar dimensions were prepared for each of the 4 experimental groups, i.e., conventional acrylic resin and the same resin reinforced with glass, aramid and nylon fibres. Impact strength was evaluated with a Zwick pendulum impact tester while flexural strength was evaluated using a 3-point Instron bending tester.

Results :

All reinforced specimens showed better impact and flexural strengths than the conventional acrylic resin. Specimens reinforced with aramid fibres showed the highest impact resistance while those reinforced with glass fibres demonstrated the highest flexural strength.

Conclusion :

Within the limitations of this study, the impact and flexural strength of heat polymerized PMMA denture resin showed appreciable improvement after reinforcement with glass or aramid fibres. It may be possible to apply these results within the dental laboratory in the fabrication of complete denture bases, distal extension partial denture bases and provisional fixed partial dentures.

Malays J Med Sci. 2003 Jul;10(2):135.

In Vitro Cytotoxicity of Antifungal Drugs Itraconazole and Fluconazole in Rat Hepatocytes

AR Norshahida ^a, MN Somchit ^a, O Fauziah ^a, A Salam Abdullah ^a

Abstract

Itraconazole and fluconazole are triazole antifungal drugs, which are multiringed synthetic compounds containing three nitrogen atoms in the azole ring differs from imidazole (ketoconazole and miconazole) contain only two nitrogen atoms. Both of the triazole drugs are broad-spectrum antifungal agents and exhibit many similarities in their pharmacological attributes. This current study was to investigate the in vitro cytotoxicity of rat hepatocytes by comparing with these two antifungal drugs, itraconazole and fluconazole. Rats (n=3) were given 75mg/kg/ip phenobarbital for 4 days. The rats were then anaesthetized and median laporatomy were performed on these rats and control rats (without pretreatment). The liver was perfused via hepatic portal vein and then hepatocytes were harvested and processed. Aliquots were collected at each time point (0.25, 0.5, 0.75, 1, 2, 3, 4, 5 and 6 hours) after incubation with 0, 0.0001, 0.001, 0.01, 0.1, 1.0 mM of itraconazole and fluconazole. Trypan blue test were done for cells viability. In vitro incubation of hepatocytes with fluconazole revealed significantly higher in cells viability when compared to itraconazole for both control and phenobarbital induced hepatocytes. Interestingly, itraconazole is more cytotoxic than fluconazole. This study revealed the role of P-450 in the cytoprotective mechanism against itraconazole but not fluconazole induced cytotoxicity in vitro. Therefore, P-450 may be involved in the metabolism of itraconazole in the liver to form toxic metabolites, whereas the cytotoxicity of fluconazole may be induced by other mechanisms.

Introduction :

The role of schools in the promotion of health-related physical fitness programs in conjunction with physical education lessons has gained major prominence due to concerns about the current fitness of children and the youth. It is suggested that health-related physical fitness programs as an integral part of physical education can achieve positive outcomes in the physiological, behavioral, cognitive and affective domains of secondary school boys. Thus, attention has been focused on integrating health-related physical fitness with physical education programs in order to enhance the cardiorespiratory endurance status of children and the youth.

Methodology :

As part of the Children’s Health and Fitness Study (CHEF Study), three hundred and fifteen secondary school boys aged 13 participated in this study over a period of two years. Schools involved in the study were randomly assigned to three groups. Group 1 underwent a one-year intervention with no intervention in the second year. Group 2 was subjected to a two-year intervention while Group 3 served as a control for two-years. The health-related physical fitness intervention program that was based on a classroom approach consisted of twelve lessons focused on circuit, fartlek, interval and rhythmic exercise training modes. In the intervention program, that was held twice a week, students participated in a brief warm-up of ^a 5–10 minutes, followed by 20–25 minutes of fitness activities and a cool-down session of 5 minutes. Evaluation of the impact of the intervention program on cardiorespiratory fitness was assessed seven times (i.e. Time 1 to Time 7) over the two-year period using the 20-meter progressive shuttle run test (20m-PST) to obtain VO₂ peak. All raw data were log-transformed and analyzed using a 2-way (Group*Time) mixed ANOVA with repeated measures. All VO₂ peak data are expressed in ml/kg/min.

Results :

There was a significant Group*Time interaction (F_12,1866=8.949, p<0.001) and main effect for Time (F_6,1866=232.184, p<0.001). Simple effects analysis indicated significant differences between groups over time. The probability matrix for the Spjotvoll-Stoline test for VO₂ peak showed, that at Time 1, there were no significant differences between the groups. However, at Time 5, VO₂ peak for Group 2 (55.94±9.46) was significantly higher than that of Group 1 (51.64±8.88) [p=0.004]. At Time 7, VO₂ peak for Group 2 (57.39±11.31) was significantly higher when compared to that of Group 1(52.35±9.06) [p=0.001] and Group 3 (51.47±10.23) [p<0.001] respectively.

Conclusions :

Conclusions :

These findings suggested that TGFαTaq1 polymorphism present in the Kelantan Malay population. The types of polymorphisms observed in this study were homozygous for common allele (C1C1) and heterozygous for common and rare allele (C1C2). However, no homozygous rare allele was found. Further investigation to include larger number of samples and other locus of TGFa gene would be of interest as such study will provide more information in the pattern of TGFa gene polymorphism in the aetiology of nonsyndromic cleft lip with or without palate in Kelantan Malay population.

Malays J Med Sci. 2003 Jul;10(2):143.

Detection of G71R Mutation in UGT1A1 Gene in Malay Neonates with Neonatal Jaundice using DHPLC

A T Norlelawati ¹, R Sutomo ², MY Narazah ³, H Von Rostenberghe ⁴, S Ahmad Hamim ², G Selamah ¹, M Masuto ⁵, H Nishio ²

Abstract

Introduction :

Neonatal jaundice is prevalent in South east Asia including Malaysia and it accounts for the majority of patient’s admission into neonatal wards. Previous study showed Gilbert Syndrome (GS) contributes to neonatal hyperbilirubinaemia. The molecular basis for GS is heterogenous. A G71R mutation is found in Japanese, Korean and Chinese population whereas a F83L mutation had been reported in Thai. These mutations have been detected by PCR or by direct sequencing. A new technique, Denatured High Performance Liquid Chromatography (DHPLC), is applied in this study.

Objective :

To screen for the G71R and F83L mutation using DHPLC
To demonstrate the association of G71R or F83L mutation in Malay hyperbilirubinaemia neonates in HUSM.

Methodology :

The formalin-fixed, paraffin-embedded tissues of 22 OSCC cases were obtained from the archives of the Department of Oral Pathology, Oral Medicine and Periodontology, Faculty of Dentistry, University of Malaya and Institute for Medical Research (IMR), Kuala Lumpur from the years 1984 to 2003. These cases were representative specimens of the free resection margins, are were selected after reviewing the original Haematoxylin and Eosin (H&E)-stained sections. All tissue previously been fixed in 10% buffered formalin and processed with standard histological embedding techniques. For all cases, 4 um thick paraffinized sections were prepared for detailed histological examination. p53 immunohistochemistry based on ABC technique using antibody DO-7 which recognized epitopes that are expressed by the wild and mutant p53 forms was performed.

Histological differentiation of tumors was defined according to the classification of the World Health Organization.

Results :

Test samples consisted of 15(68.2%) cases of well-differentiated (WD)OSCC, 6(27.3%) cases of moderately-differentiated(MD)OSCC and 1(4.5%) cases of poorly-differentiated(PD) OSCC> Ninety five percentage of OSCC in this study demonstrates p53 immunoreactivity at the tumor microinvasive front p53 staining was weak in 22.7% for MDOSCC and 4.5% for PDOSCC. On the other hand, 13.6% of WDOSCC and 9.1% for MDOSCC showed moderate p53 staining. Strong intense staining of p53 was found in 3.2% WDOSCC and 9.1% MDOSCC. One of the cases studied was non reactive for the p53 staining.

Conclusion :

The study shows that tumor suppressor gene, p53, is a useful diagnostic tool for evaluating neoplastic activity at the microinvasive front of OSCC.

(This project is collobration to find a suitable cancer vaccine produced by UPM under the MAKNA-USM-UPM grant)

Recently, we have detected mutation of the p53 gene in our Malay patients with gliomas. As the tumorigenesis is a multigene defect, we believe that other oncogenes may also be involved in the intiation or progression of gliomas. We chose the ras family genes as the second target in this screening procedure because there is no current research support involving this gene in Malaysian gliomas. We screened the 27 Malaysian patients with gliomas using the same methodology (PCR-SSCP) in the previous project of the mutational in codons 12 and 61 of the H-, K-, N-ras gene. The results of this study indicate to detectable mutations in the H-, K-, N-ras gene by using PCR-SSCP analysis. The frequency of Ras mutation in gliomas is also significantly lower in other populations. These data indicate that the ras gene may not important in the oncogenesis of gliomas among patients in Malaysia. Ras gene may not used as a prognostic marker for this cancer vaccine.

Acknowledgments

This work has been supported in part by Majlis Kanser National (MAKNA) Malaysia Grant. This project would not have bloomed to a success without the co-operative collaborative tasks undertaken between USM, UPM and MAKNA

Malays J Med Sci. 2003 Jul;10(2):145.

Genotoxicity Study of the Osseous Substitutes: Ames Test

A Azlina ¹, O Shamsuria ¹, S H Suzina ², A R Samsudin ¹

Abstract

Objective :

To evaluate the genotoxicity status of osseous substitutes which were coral and hydroxyapatite using Ames test.

Introduction :

History has shown that some implants used in human which wee initially biocompatible and safe prove to be mutagenic and caused cancer development after many years post operative. Thus, implants with mutagenic potential should be screened as early as possible. This study looked at the genocompatibility of two locally produced biomaterial coral and hydroxyapatite to ensure their long term safety as bioimplants in human, using specific genotoxic test. Genotoxicity tests can be defined as tests designed to detect chemical substances that induce genetic damage (mutagen) by various mechanisms. One of the tests is Ames test or also known as bacterial reverse mutation assay. This assay uses bacteria, S. typhimurium and E. coli, which have the ability to reverse some of the mutations with the gene regaining their original genocompatible functions.

Methodology :

The test was carried out for S. typhimurium strains TA1535, TA1537, TA98, TA100 and E. coli WP2uvrA using the pre-incubation method both with and without metabolic activation system.

Results :

For both samples of coral and hydroxyapatite, test plates of TA1535, TA1537, TA98, TA100 and WP2uvrA with and without metabolic activation solution (S9 mix) showed no increase of revertant colonies for all the doses tested.

Conclusions :

Based on the results, both coral and hydroxyapatite were considered to have no mutagenic potential under the present test conditions.

Objective :

Capsid gene is one of the three genes that encode the structural protein on dengue virus. The purpose of this work was to clone and express the capsid gene in E. coli expression system. The expressed capsid protein would be used in subsequent experiments to study the packaging process involves in dengue virus life cycle. INTRODUCTION. Dengue virus causes febrile disease in human with at least twenty millions infections per year (Marks et. al., 2001). Dengue infection causes dengue fever that is not life threatening. However, a severe form of this disease, called dengue hemorrhagic fever (DHF)/dengue shock syndrome (DSS), has been proven to be fatal. DHF is a leading cause of hospitalization and death among children in many southeast-asia countries (Gubler, 1998; Monath, 1994). The virus genome is a positive single-stranded RNA virus, of approximately 11,000 bases. The genome encodes for a single polyprotein precursor (approximately 3,391 amino acids) arranged in the order of NH₂-C-prM-E-NS1-NS2A-NS2B-NS3-NS4A-NS4B-NS5-COOH. The polyprotein precursor will undergo serine protease cleavage to yielding three structural proteins, C (capsid/core), prM (pre-membrane), and E (envelope), which are the components of the virion, and seven nonstructural (NS) proteins (NS1-NS5) (Leyssen et. al., 2000). One of steps in dengue virus life cycle is the formation of nucleocapsid. In this step, the genomic RNA will be packaged inside the capsid protein. The formation of nucleocapsid would involve the interaction between the capsid protein and the nucleic acid (RNA). In order to study this interaction, our laboratory has to assimilate the nucleocapsid formation in vitro. Thus, cloning and expression of the capsid protein of dengue virus is the beginning for future experiments. METHODS AND MATERIALS. Dengue virus type 2 (New Guinea-C Strain) and aedes albopictus cell line C6/36 was used in this study. Extraction of virus RNA was done using QIAamp^® Viral RNA Mini Kit (Qiagen, Inc.). Two primers were designed to amplified the capsid gene:

GCAGATCTCATATGAATAAC,

GTGTGGATCCATGTTACGCCATC

NdeI

BamHI stop codon

The purified RT-PCR product was ligated to pGEM^®-T vector system (Promega, Inc.) and transformed into E. coli JM109. The plasmid DNA was subjected to digestion with BamHI and NdeI, PCR, and DNA sequencing using SP6 and T7 primers. The capsid gene was sub-cloned into pET-3C T7 expression plasmid (Novagen, Inc.) and transformed into E. coli BL21(DE3)pLysS (Promega, Inc.). The clone was induced with 0.5mM IPTG, loaded onto SDS-PAGE, and stained with coomassie blue.

RESULTS.

A band of 396 bp was amplified and successfully ligated into PCR vector. DNA sequencing result confirmed that the insert was capsid gene that encodes 113 amino acids. A band of 12.5 kDa was detected on SDS-PAGE.

CONCLUSIONS.

The capsid gene of dengue virus type 2 (New Guinea-C Strain) was amplified and the protein was expressed in bacteria.

REFERENCES

1.Gubler DJ. Clin Microbiol Rev. 1998;11:480–496. doi: 10.1128/cmr.11.3.480. [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Leyssen P, De Clerco E, Neyts J. Clin Microbiol Rev. 2000;13:67–82. doi: 10.1128/cmr.13.1.67-82.2000. [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Marks RM, Lu H, Sundaresan R, Toida T, Suzuki A, Imanari T, Hernaiz MJ, Linhardt RJ. J Med Chem. 2001;44:2178–2187. doi: 10.1021/jm000412i. [DOI] [PubMed] [Google Scholar]
4.Monath TP. Proc Natl Acad Sci USA. 1994;91:2395–2400. doi: 10.1073/pnas.91.7.2395. [DOI] [PMC free article] [PubMed] [Google Scholar]

Malays J Med Sci. 2003 Jul;10(2):147–148.

Immunohistochemical Characteristics of Thymus of the Growing Body Under Stress Conditions

MYu Kapitonova ¹, Othman Mansor ¹, Muzammil Ullah ¹, M Asnizam Asari ¹

Abstract

Introduction :

Stress, both physical and psychological, can activate the hypothalamic-pituitary-adrenal axis, leading to a wide range of physiological responses including increased corticosteroid release and suppression of immune function. Very limited research has been performed to elucidate the effect of chronic physical and psychological stress on immature immune system of the growing body (N. Tarcic et.al., 1995; L. Domingues-Gerpe et al., 1997, 1998; A. Wakikawa et al., 1999; H. Takeuchi et al., 2001; J. Lehmann et al., 2002).

Objectives :

To compare the degree of immune suppression in the body of pre-weaning and early post-weaning rats exposed to the chronic restraint stress by immunohistochemical evaluation thymus.

Methodology :

Two and three week old Sprague Dawley rats (6 animals in each group) were exposed to the daily 5-hours sessions of restraint stress for seven days continuously with another two groups of intact animals (6 in each group) serving as an age-matched control. The animals were euthanized immediately after the last stress exposure. Thymus, spleen and pituitary gland were removed from each animal, fixed in formalin, embedded in paraffin and processed for routine histology and immunohistochemistry using antibodies against CD3 and CD8a T-cell markers.

Results and Conclusion :

Thymic atrophy was shown by reduction of thymic weight and cortex/medulla ratio in pre- and post-weaning experimental groups with both the lymphoid cells and epithelial stroma affected. In the pre-weaning and post-weaning control groups apoptosis of the cortical thymocytes and tingible body macrophages were rare while in both experimental groups they were common. The proportion of the tingible body macrophages was much higher in the pre-weaning animals than in the post-weaning ones. CD3-immunoreactive cells in both control groups were more frequent in the medulla compared to the cortex. In the post-weaning experimental group animals the amount of CD3+ thymocytes in the cortex was reduced and mainly confined to the subcapsular regions while in pre-weaning experimental group only accidental CD3+ cells could be discovered in the cortex. CD8a+ thymocytes were widely spread in the cortex of the control animals, especially in the subcapsular region and in the inner cortex. In post-weaning experimental animals the number of immunoreactive cells was considerably reduced. In pre-weaning animals the reduction of the CD8a+ cells in the cortex against control was much more prominent with many apoptotic cells being immunoreactive. These results suggest that under stress conditions pre-weaning rats are more vulnerable than early post-weaning animals in terms of immunosuppression and provide a better understanding of stress-induced alteration of the immune response in the growing body.

Malays J Med Sci. 2003 Jul;10(2):148.

A Common Metabolic Pathway Mediating the Embryotoxic Effects of Endometriosis and Interleukin-8

Gregory J S Tan, Liza Noordin ^*, Mohd Shukri Othman ^**

Abstract

Objectives :

To examine whether or not excess pyruvate can provide the metabolic substrate to support the growth of early embryos in the presence of peritoneal fluid with endometriosis or interleukin-8.

Introduction :

The adverse effect of peritoneal fluid with endometriosis on early embryo growth has previously been described (1). Recent studies suggest that interleukins may be the embryotoxic factor mediating the effect of endometriosis. This hypothesis is supported by the presence of interleukins in the peritoneal fluid obtained from women with endometriosis (unpublished observation). A common metabolic pathway mediating the effects of endometriosis and interleukin could provide further support to the hypothesis.

Methodology :

Two-cell mouse embryos were cultured in 1 ml Whitten’s medium as previously described (1). The effects of excess pyruvate (1 mmol) on early embryo growth in the presence of peritoneal fluid with endometriosis or interleukin-8 were examined. The embryos were cultured for 3 days.

Results :

Both peritoneal fluid with endometriosis and interleukin-8 were found to significantly inhibit the development of early mouse embryos. The in vitro development from 2 cells to blastocysts was suppressed in the presence of peritoneal fluid with mild, moderate or severe endometriosis (p<0.001 Fisher’s exact test). Interleukin-8 (16 and 1000 pg/ml) however inhibited mainly the development of the later stage embryo, from morulae to blastocysts (p<0.001 Fisher’s exact test). Interestingly, pyruvate was effective in reversing the embryotoxic effects of both the peritoneal fluid with endometriosis and interleukin-8.

Conclusion :

The ability of pyruvate to reverse the embryotoxic effects of both peritoneal fluid with endometriosis and interleukin-8 suggests that a common pathway may be involved in their actions. This provides further support to the hypothesis that interleukins mediate the embryotoxic effect of peritoneal fluid in endometriosis.

Reference :

1.Gregory JS Tan, Noordin Liza, Hafizah Wan, Othman Mohd Shukri, Rajikin MH. Embryotoxicity of peritoneal fluid with endometriosis:effects of pyruvate. Proc. 5th Scientific Congress of the Federation of Asian & Oceanian Physiological Society; Kuala Lumpur. 23–26 September 2002; 2002. p. 302. [Google Scholar]

Malays J Med Sci. 2003 Jul;10(2):148–149.

Interleukins in the Human Peritoneal Fluid

Liza Noordin ^*, Gregory J S Tan ^*, Mohd Shukri Othman ^**

Abstract

Objectives :

To measure the levels of interleukins in the peritoneal fluid obtained from women with endometriosis.
To study the effects of interleukins on early mouse embryo growth

Introduction :

Although infertility may occur in endometriosis, the mechanism is still not clear. A direct embryotoxic effect of peritoneal fluid has been suggested to be one of the underlying causes of infertility. The adverse effect of peritoneal fluid may be associated with cytokines as endometriosis is an inflammatory condition.

Methodology :

The levels of interleukin-6 and interleukin-8 in peritoneal fluid obtained from women with mild, moderate and severe endometriosis were measured using the ELISA method.
Two-cell mouse embryos were cultured in 1 ml Whitten’s medium as previously described (1) in the presence or absence of interleukin-6 and interleukin-8 (100 and 1000 pg/ml respectively).

Results :

The levels of interleukin-6 were found to increase with increased severity of endometriosis (p<0.05, Mann Whitney U-test) but not of interleukin-8. The development of two-cell mouse embryos to blastocysts was suppressed by interleukin-6 (p<0.001 Fisher’s exact test). Interleukin-8 however inhibited the development of the morula to blastocysts (p<0.001 Fisher’s exact test) but not the early development of the 2-cell mouse embryos.

Conclusion :

The increased levels of interleukin-6 together with the embryotoxic effects of interleukin-6 and interleukin-8, suggests that interleukins (specifically interleukin-6) may be involved in the pathogenesis of infertility in endometriosis.

Reference:

1.Gregory JS Tan, Noordin Liza, Hafizah Wan, Othman Mohd Shukri, Rajikin MH. Embryotoxicity of peritoneal fluid with endometriosis:effects of pyruvate. Proc. 5th Scientific Congress of the Federation of Asian & Oceanian Physiological Society; Kuala Lumpur. 23–26 September 2002; 2002. p. 302. [Google Scholar]

Malays J Med Sci. 2003 Jul;10(2):149.

Expression of Ubiquinonecytochrome C Reductase Complex in Peptic Ulcer Disease

WR Wan Taib ¹, MR Sidek ¹, S Sulong ¹, AH Mat Sain ², MNI Isa ³

Abstract

Objective :

To correlate the expression of ubiquinone-cytochrome c reductase complex with peptic ulcer disease

Institution :

Peptic ulcer disease is a chronic inflammatory illness. The hallmark of this disease is mucosal inflammation. An ulcer is generally thought to occur when there is an imbalance between the aggressiveness forces of acid and pepsin and the less well-defined defensive forces of mucosal resistance and regeneration. Mitochondrial genome is particularly susceptible to mutations owing to the high level of reactive oxygen species generated in the organelle, coupled with a low level of DNA repair. It has been postulated that alterations of oxidative phosphorylation in cancer cells are causally related to cancerous growth. Ubiquinol-cytochrome c reductase complex (complex III) is an 11-subunit enzyme complex that acts as an electron transferring protein in the mitochondrial respiratory chain in producing energy which is essential for maintaining cellular metabolism (Murray RK et al., 1993). It is believed that an expression of the complex III contributes in increased oxidative phosphorylation process.

Methodology :

A biopsied tissue was taken from Malay male, 33 years of age patient who was undergoing the endoscopic procedures. The tissue was stored in RNALater solution (Ambion, USA) at −80∞C. Tissue was homogenized and isolated according to the manufacturer’s instructions (RNAEasy Mini Kit, Qiagen, Germany). The integrity and concentration of total RNA was determined. Differential display which involves reverse transcription and polymerase chain reaction was performed according to the protocol of the supplier (GenHunter Corp., USA). Then, cDNA fragments were separated on a 6% denaturing polyacrylamide gel. Band of interest was excised out from the gel and purified. The eluted cDNA was reamplified and sequenced by Genetic Analyzer. Sequence was searched for identification with GenBank database using the Basic Local Alignment Search Tool (BLAST) program provided by the National Center for Biotechnology Information (NCBI).

Result :

We discovered an oxidative phosphorylation-related gene, ubiquinol-cytochrome C reductase complex (complex III) which was expressed in the ulcerated tissue of the patient

Discussion/Conclusion :

Expression of an oxidative-cytochrome c reductase complex gene can be analyzed to determine its involvement in the pathogenesis of peptic diathesis. The expression might be overexpressed in peptic ulcer disease or the gene is suppressed in normal tissue. A study on more sample sizes and linkage analysis should be carried out in order to learn more about the interaction of the gene with disease. The discovery of some genetic changes at the vicinity of the benign gastric inflammatory lesions is important in relation to the elucidation of the carcinogenesis of gastric cancers.

Malays J Med Sci. 2003 Jul;10(2):149–150.

Cytogenetic Analysis in HUSM (8 Years Review): Incidence of Down’s Syndrome Associated with Paternal and Maternal Ages

R S Fatimah ¹, MA Suhaida ¹, K Aqsoriah ¹, I S Mariam ¹, M Ros Sidek ¹, KI Mokhtar ¹, MY Narazah ¹, Z Zubaidah ², MN Isa ³

Abstract

Objective :

To review the numbers of Down’s syndrome cases found in HUSM.
To determine the pattern of Down’s syndrome cases associated with paternal and maternal ages in HUSM.

Introduction :

Down’s syndrome is associated with trisomy 21, with overall incidence of is about 1 per 700 live births, with slightly higher ratio of males to females (3:2). In 92.5% of the cases, this additional chromosome arises as a result of nondisjunction in meiosis, and about 25% of the nondisjunction cases can be traced to paternal origin. The other 75% of these cases are maternal in origin half of these cases are linked to advanced maternal age. Paternal age has not been shown to have any relevance.

Methodology :

Objectives :

To determine the relevance of angiotensin converting enzyme (ACE) gene polymorphism for diastolic dysfunction in patients with primary hypertension.

Methodology :

The study was conducted on 32 hypertensive patients, 10 of whom had diastolic dysfunction, diagnosed on echocardiography. Polymorphism of the ACE gene based on deletion or insertion of 287 base pairs was determined by the polymerase chain reaction (PCR) assay. The bands were then analysed using agarose gel electrophoresis method.

Results :

Approximately 16% of the study population was found to have DD allele; 56.3% with II allele; 28.1% with ID allele. Results showed that the ACE gene polymorphism is associated with the occurrence of diastolic dysfunction (p < 0.001).

Conclusion :

ACE gene polymorphism may play a role in the aetiology of diastolic dysfunction in Malaysian patients with essential hypertension.

Malays J Med Sci. 2003 Jul;10(2):151.

Absence of Gene P16 Mutation on Non-Hodgkin Lymphoma Patients in Malaysian Population.

MS Mohd Zan ², N M Yusof ³, R Hassan ², AA Yusoff ⁴, AA Baba ¹

Abstract

Objective :

The Aims of the studies was to detect p16 gene mutations in the Non Hodgkin’s Lymphoma (NHL) among patients in HUSM.

Introduction :

The p16 gene plays an important role as a negative regulator of cellular proliferation by interacting with CDK4 and inhibiting its kinase activity. p16 genes abnormalities with lymphomagenesis have been identified in 10–30 % of NHL patients in studies conducted in the west.

Methodology :

The p16 genes consisting of region between exons 1, 2 and 3 were examined in 43 NHL samples. Samples were taken from biopsies of lymph nodes or other involved tissues and were analyzed by multiplex polymerase chain reaction followed by single polymerase chain reaction-single stranded conformation polymorphism (PCR-SSCP). Direct sequencing was performed in samples showing abnormal mobility shift on SSCP.

Result :

The result of this study indicates no detectable mutations in p16 gene by PCR-SSCP analysis. No shift bands were observed in all of three exons of p16 genes in all samples examined.

Conclusion :

Our results suggest that p16 genes does not play a significant role in lymphomagenesis in Malaysian patients. However further study involving a larger number of patients would have to be performed before a definitive conclusion could be made regarding the involvement of p16 gene in NHL in our patients.

Malays J Med Sci. 2003 Jul;10(2):151–152.

Trisomy 3 Does Not Play an Important Role in the Lymphomagenesis of Malt Lymphomas

YC Tai ¹, SC Peh ¹

Hj M Abdul Kareem ¹

Abstract

Discussion :

The two patients discuss above were the first two patient at USM to receive rt-PA for thrombolysis in acute stroke. The time of injection was within 6 hrs and not 3 hrs as recommended by US FDA. Both patients had no immediate complication. One patient improved fully while the other patient remain status-quo at end one week. She is being followed up. Both our patients did not have clinical / radiological evidence of Intracerebral bleeding.

Conclusion :

In our experience rt-PA is an effective and safe therapy for acute Ischemic stroke.

Malays J Med Sci. 2003 Jul;10(2):155.

Amiodarone Induced Alterations in Rat Intestinal Phospholipids

KNS Sirajudeen ¹, H Devaraj ², S Niranjali Devaraj ³

Abstract

Amiodarone (AD), a cationic amphiphile is a potent antiarrhythmic agent but is often associated with adverse side effects. Phospholipid accumulation (phospholipidosis) in tissues such as lung and liver on AD administration has been found to be associated with its toxic side effect in those tissues. Since gastrointestinal disturbances has also been reported, the present study is done to estimate the intestinal phospholipids level and its possible association with intestinal side effects on AD administration in rats. Male Wistar rats weighing 100–125g were administered with AD at a dosage of 175mg Kg body weight⁻¹day⁻¹ for 3,7,14,21 and 28 days. On AD administration, the levels of total intestinal phospholipid showed i) a highly significant (p<0.001) increase after 21 and 28 days ii) a moderate increase (p<0.01) after 14 days and iii) no significant change after 3 and 7 days of administration. A highly significant increase (p<001) in the levels of all fractions of intestinal phospholipid were observed after 21 and 28 days of AD administration. On 14 days of AD administration, there was a significant increase (p<0.001) in the levels of Lysophatidyl choline, Phosphatidyl choline and phosphatidyl ethanolamine with a moderate increase (p<0.05) in the levels of sphingomyelin and phosphatidyl serine and inositol. Administration of AD for 3 and 7 days did not exhibit any marked changes in the intestinal individual phospholipid levels. The results indicate that in addition to lung and liver, there is also accumulation of phospholipids in the intestine on AD administration and is possibly related to AD-induced intestinal side effects.

Malays J Med Sci. 2003 Jul;10(2):155–156.

Larvicidal Properties of Some Malaysian Plants to the Vector of Dengue, Aedes Aegypti

A Wan Omar ¹, MH Kong ¹, Z Ngah ¹, AM Roslaini ¹, A Noor Rain ², S Yusof ³

Abstract

Introduction :

Aedes aegypti is one of the major vectors in transmitting dengue virus that cause dengue fever (DF) and dengue haemorrhagic fever (DHF). Global emergence of DF and DHF highlights the urgent need to control this mosquito vector. The usage of synthetic chemical insecticides in vector control programmes pose substantial hazards to the environment and also it is becoming evidence that Aedes mosquitoes do also develop resistance to these insecticides.

Objectives :

To select some local Malaysian plants based upon the documentation of their use in traditional medicine
To prepare extracts from these plant materials using common solvents
Larvicidal testing of these extracts on Aedes aegypti var Selangor strain.

Methodology :

Plant extracts were evaluated for larvicidal properties against late third and early fourth instars Aedes aegypti var Selangor strains using WHO (1980) standard proceedure with slight modifications. Abate (temephos) as 10g of pure temephos in 1000g of sand granules was used as positive control. Analaysia of potency for each extract was presented as lethal concentration needed to observe 50 % and 90 % mortality in the population (LC 50 and LC 90).

Results :

The hexane and ethnolic extracts of Mentha averensis were most efficacious with LC₅₀ value of 1.24 ug/ml (LC90 =23.36 ug/ml) and LC 50 of 2.24 ug/ml (LC90 = 36.08 ug/ml). Dead lavae were microscopically examined. The most severe destruction was the detachment of the larva’s head.

Conclusions :

Extracts from some of these plants may have vast potential as effective alternative insecticieds. Since these are plant extracts they are less toxic and environmentally friendly.

Objectives :

To evaluate inhibitory activity of alkaloid fractionates of D. trifoliata (USM Herbarium /10611) against HP clinical isolates and determine their cytotoxicity on Artemia salina.

Introduction :

Plant-derived medicines have been part of our traditional healthcare for years and amongst the numerous plant species, D. trifoliata has been traditionally used as a remedy for abdominal complaints (which may be caused by HP) by the indigenous Aborigines. In our earlier study, chloroform extract (CE) of D.trifoliata was found to contain alkaloids, a class of compound known to have members specifically inhibitory against HP. This paper reports on the inhibitory activity of alkaloid fractionates of D. trifoliata against HP clinical isolates and their cytotoxicity on A. salina.

Methodology :

CE of D. trifoliata was fractionated by chromatography on silica gel 60 and eluted using toluene:ethyl acetate: diethylamine. Sensitivity of 13 other bacterial isolates (E.coli ATCC 25922, V.parahaemolyticus, Salmonella sp., Staph.aureus, E.coli, V.cholerae, S. paratyphi A, S.boydii, S.dysenteriae, Pseudomonas sp., P.vulgaris, Ps. stutzeri and Enterobacter E114) and an HP clinical isolate against CE or fractionates were evaluated by disc diffusion assay. Cytotoxicity (LC₅₀) of CE or fractionates was performed on A. salina at final concentration ranging from 1 μg/ml to 1024 μg/ml in artificial sea water. MIC of CE or fractionates was determined using agar dilution method at final concentrations ranging from 1 μg/ml to 1024 μg/ml against 57 HP clinical isolates. In all assays, appropriate controls were included.

Results :

Three alkaloid fractionates (F2,F3 and F5) were easily identified based on green or blue-green fluorescence under uv light. F1 and F4 did not fluoresce and were not alkaloids. F4 and F5 were ignored based on poor yield and lower anti-HP activity. CE, F1, F2 or F3 gave comparable HP inhibition zone ranging from 35±1 mm to 42±1 mm. F1 and F2 appear selective against HP and not inhibitory against all the other bacteria tested. On the contrary, F3 and CE were less selective against HP as they were inhibitory against 7 other bacteria but inhibitory activity based on inhibition zone diameter was much smaller compared to against HP. CE was more cytotoxic (LC₅₀ at 1.1 μg/ml) than F1(LC₅₀ at 8.8 μg/ml), F3(LC50: 60.4 μg/ml) and F2(LC₅₀:966.5 μg/ml). Using 57 HP clinical isolates, MIC₅₀(2 to 4 μg/ml) and MIC₉₀(8 to 16 μg/ml) of F2 was found to be higher than that of CE (MIC₅₀:1 to 2μg/ml and MIC₉₀:2 to 4μg/ml).

Conclusions :

F2 fractionate offers great therapeutic potential, appears selective against HP and is less cytotoxic at MIC values compared to CE. High CE toxicity is possibly due to synergistic effects of the various compounds in the extract. The therapeutic potential of F2 merits further studies on the characterization of the active compound(s) and assessment of their specificity, safety and toxicity.

Malays J Med Sci. 2003 Jul;10(2):157.

Tocotrienol-Rich Fraction Palm Oil Vitamin E Increased Testicular 11b-Hydroxysteroid Dehydrogenase Enzyme Activity and Plasma Testosterone but Lowered Plasma Corticosterone Level in Male Rats

FH Hamzah ¹, AR Hamid ², KHH New ², BAK Khalid ²

Abstract

Objective :

The objective of this investigation was to identify the effect of vitamin E deficiency and supplementation of TRFVE on the plasma levels of T, B and testicular 11b-HSD activity.

Introduction :

In the testis, the enzyme 11b-Hydroxysteroid dehydrogenase (11b-HSD) protects the leutinizing hormone (LH) stimulated steroidogenesis of testosterone (T) from the deleterious effect of high level of corticosterone (B). The effects of vitamin E deficiency and supplementation on this enzyme and its associated hormones were unclear. Similarly, the effects of tocotrienol-rich fraction palm oil vitamin E (TRFVE) on these testicular factors has not been tested.

Methodology :

Adult male Wistar rats were randomly divided into 4 groups, fed with vitamin E-free basal diet and given 0 (vitamin E deficient group), 0.4, 1.6 and 4.0 mg TRFVE E/day. Plasma vitamin E, testosterone and corticosterone levels were measured every 4 weeks for 24 weeks. At 24 weeks, testis were collected and assayed for 11b-HSD activity.

Results :

In the vitamin E deficient group, plasma vitamin E level decreased to below detectable level from week 16, while 11b-HSD activity and T levels decreased significantly. Supplementation with TRFVE increased the level of T, while the activity of 11b-HSD enzyme increased significantly. On the other hand, supplementation reduced the levels of B to below basal values, with the highest supplementation dose (4.0 mg TRFVE/day) showing the lowest value.

Conclusion :

vitamin E deficiency seems to be associated with an increase in stress hormone B, lower T level and 11b-HSD activity, while supplementation with TRF of palm oil vitamin E seems to counter the deleterious effect of B.

Malays J Med Sci. 2003 Jul;10(2):157–158.

Healing Activity of Acalypha Indica on Surgical Wounds in Mice

I Reezal ^a, MN Somchit ^a,^c, AR Mutalib ^b, WM Wan Nordin ^b, AM Mat Jais ^a,^c, A Salam Abdullah ^b

Abstract

Acalypha indica is an annual erect plant that can grow up to 30–75 cm high. It is also known as rumput lis-lis or kucing galak in Malaysia. This plant has a lot of branches and flowers on their soft barks. It is a useful wild medicinal plant that can be found in open area. The whole plant can be used as a medicine, traditionally; the root and leaves are commonly used in Malaysia for treatment of skin infections, ulcer, stomach-ache and bronchitis. The plant is boiled and the extract is drunk to clean the stomach. It is also believed to be good as energy booster and reducing asthma (Abd. Rahman, 1998). Acalypha indica mostly found in warm tropic areas such as Peninsular Malaysia, Siam in Thailand and Java, Indonesia. This plant has been used as traditional medication for quite sometimes but not widely used due to little information known about it. Usually, the leaves of this plant are used to treat several skin infections such as scabies and ringworm (Mohd. Said, 2000). For the experiment, 30 Balb-C mice were divided equally into 3 groups prior to the experiment with 10 mice in each group. The first group of mice represents the control group, the second group of mice is treated with acriflavine (standard medication commonly used in wound treatment) and the mice in the third group are treated with the crude aqueous extracts of the leaves of Acalypha indica. The dorsal surface was inflicted with single surgical incision of about 2 cm using a sharp sterile scalpel and the mice were sacrifice on 3^rd, 6^th and 9^th day of experiment. The treatment was given by applying the extracts directly on the wounds and the mice were monitored everyday during the period of study. The skin reactions evaluated on the basis of the designated values by Speroni et al. (2002) on the anti-inflammatory and wound healing activities showed, after 3 day of experiment, the A. indica treated mice demonstrated more progressive wound healing activity than the mice treated with acriflavine and the control group. The epithelial regeneration presented better proliferation of the epithelium cells under the scabs of A. indica treated wound. On the 6^th day, the re-epithelialisation was more proliferate on acriflavine treated mice than the control group, as the mice treated with A. indica extracts showed almost constant rate of epithelial regeneration. After 9 day, well-advanced organisation of granulation tissue and new lining of epidermis layer were formed on the A. indica treated wound with the scab has already shed off the skin. The epithelial regeneration of the wound treated with acriflavine demonstrated new lining of epithelium cells forming the epidermis of the skin as the scabs almost fell off. The mice in the control group also exhibit new epithelium layer formation but the scab appeared still intact to the wound. Extracts from the leaves of A. indica exhibit significant healing activity when topically applied thus, offers pharmacological evidence on the use of A. indica for healing wounds.

Reference :

1.Abd. Rahman Md. Derus. Pengenalan dan penggunaan herba ubatan. 19981998:3, 21, 44. [Google Scholar]
2.Said Saad Mohd. Pengenalan kepada pokok herba: Kucing galak. 2000. Mingguan Malaysia, Ahad 9 Julai 2000.
3.Speroni E, Govoni P, Guizzardi S, Renzulli C, Guerra MC. Anti-inflammatory and cicatrizing activity of Echinacea pallida Nutt. Root extract. Journal of Ethnopharmacology. 2002;2002;79:265–272. doi: 10.1016/s0378-8741(01)00391-9. [DOI] [PubMed] [Google Scholar]

Malays J Med Sci. 2003 Jul;10(2):158.

In Vitro Effect of Nonsteroidal Anti-Inflammatory Drugs (NSAIDS) Piroxicam and Mefenamic Acid on Cancer Cells

S Faizah ^a, MN Somchit ^a, DA Israf ^a, J Stanlas ^a, O Fauziah ^a, I Maznah ^a

Abstract

Nonsteridal anti-inflammatory drugs (NSAIDs) are a heterogenous group of compounds used to cure and prevent inflammation. They are among the most prescribed medications and frequently consumed drugs worldwide. They have anti-inflammatory, analgesic and antipyretic activity, which are widely used in the treatment of chronic inflammatory diseases. Interestingly, several lines of evidence suggest that NSAIDs may be effective in preventing colorectal cancer. They exert an antiproliferative effect against human colon cancer cells with a wide range of potencies¹. Thus, a study was designed to determine the cytotoxicity effects of piroxicam and mefenamic acid on HCT 116 and Caco-2 cells (colon cancer cells), MCF-7 (breast cancer cells) and Hep G2 (liver cancer cells). MTT assay was performed to determine the effects of piroxicam and mefenamic acid on the viability of HCT 116, Caco-2, MCF-7 and Hep G2 cell lines. One-way ANOVA test was performed. Interestingly, piroxicam and mefenamic acid showed significant reduction in the viability colon cancer cell lines (HCT 116 and Caco-2). HCT 116 cells showed more cells regression compared to Caco-2 cells after treatment with both drugs. Both affected the cell viability by reducing it up to almost 50%. Although the difference was not significant, piroxicam was still the most potent in decreasing the cell viability compared to mefenamic acid for both colon cancer cell lines. They, however, only exerted a mild cytotoxic effect on both MCF-7 and Hep G2 cancer cells. They revealed reduction in cell viability for both cancer cells only at high concentrations, 50 and 100 μM. In conclusions, both piroxicam and mefenamic acid are able to exert a pronouncedly dose-dependent cytotoxic effect on colon cancer cell lines (HCT 116 and Caco-2) but not on the MCF-7 and Hep G2 cells. Thus, concluded the potential of both in the treatment of colon cancer patients.

Reference :

1.Hixson LJ, Alberts DS, Krutzsch M, Einsphar J, Brendel K, Gross PH, Paranka NS, Baies M, Emerson S, Pamukcu K, et al. Cancer Epidemiol Biomarkers Prev. 1994;1994(5):433–8. [PubMed] [Google Scholar]

Malays J Med Sci. 2003 Jul;10(2):158–159.

Aqueous extracts of Ortosiphon stamineus (MISAI KUCING) Improve Lipid Profiles of Rats Fed with High Cholesterol Diet.

A Zuraini ¹, MR Ros Aziah ¹, AK Arifah ¹, MR Sulaiman ¹, MN Somchit ¹

Abstract

In this study, we examined the anti-hyperlipidemic potential of aqueous extract of Ortosiphon stamineus using cholesterol-fed Sprague-Dawley rats. The rats were divided into two extract-supplemented [100 mg/kg (n = 6) and 200 mg/kg (n = 6)] groups, a positive control group (n = 6) and a negative control group (n = 6). All groups, except for the negative control group, had 3% cholesterol added to their otherwise standard diets. Extracts were administered once daily via oral gavage. Blood samples were collected at day 0, day 9, day 18 and day 27 to test for plasma total cholesterol (TC), low density lipoproteins (LDL), high density lipoproteins (HDL) and triglycerides (TG). The kidney and liver functions of these rats were also determined by kidney function tests, i.e. Blood Urea Nitrogen (BUN), total creatinine and Lactate Dehydrogenase (LDH), and liver function tests, i.e. Alkaline Phospatase (ALP), Aspartate Amino transferase (AST) and Alanine Aminotransferase (ALT). All data were statistically analysed using two-way ANOVA and Duncan multiple comparison for post-hoc test. TC, LDL and TG had increased progressively in positive control group and their values were significantly higher than the other 3 groups at week 4 (p<0.05). Both concentrations of O. stamineus extracts had kept TC, LDL and TG values within the normal range even after 4 weeks of cholesterol feeding. HDL had remained unchanged for all groups throughout the study duration. After 4 weeks of feeding high cholesterol diet, kidney functions of the rats had remained unaffected whereas slight increased in the liver enzymes observed in the positive control group indicated a slight impairment in their liver functions. O. stamineus extract had successfully prevented this, indicated by the normal values of the liver enzymes in both the extract-supplemented groups. As a conclusion, aqueous extract of O. stamineus (100 mg/kg and 200 mg/kg) not only showed great potentials as anti-hyperlipidemic agent.

Malays J Med Sci. 2003 Jul;10(2):159.

Antimalarial Activity of Some Malaysian Plants against Plasmodium Berghei

A Wan Omar ¹, A Noor Rain ², Z Ngah ¹, Roslaini AM ¹, S Yusof ³

Abstract

Introduction :

Malaria is still one of the major health problems in the world. The situation worsened with the emergence of chloroquin-resistant Plasmodium falciparum and their spread has stimulated the development of new effective treatment against malaria. As the results of trials with malaria vaccines have been disappointing, the malaria control still depend on the use of the antimalarial drugs.

Objectives :

To determine whether local Malaysian plants based on their documented use in complementary medicine has any antimalarial properties;
To prepare extracts of these plants using common solvents;
To test these extracts in vivo, in mice infected with Plasmodium berghei

Methodology :

Ten local plant extracts were screened for antimalarial properties in 4 day suppressive in vivo test in mice inoculated with rodent malaria, Plasmodium berghei. (ANKA clone). Their activities were compared with the standard antimalarial drug, chloroquine (5 mg/kg b.wt) and 2.5 % Tween 20 as controls.

Results :

The highest percentage of parasitemia suppression were achieved at the maximum dose of 400 mg/kg b. wt which were 69.87%(13.63 ±0.17), 69.53%(13.73±0.51), 69.22%(13.87±0.46) and 66.94(14.9±1.58) respectively for Andrograhis paniculata, Anarcardium occidentale, Punica granatum and Tinospora crispa.

Conclusion :

Logical extention of this rsearch is in the isolation of bioactive compounds from these plant extracts that may lead to a new drug discovery toward the development of chemotheraphy and chemoprophylaxis.

Malays J Med Sci. 2003 Jul;10(2):159.

Gastroprotective Properties of Centella Asiatica in Acetic Acid and Ethanol Induced Ulcers in Rats.

MN Somchit ^a,^b, Z Ahmad ^a,^b, ENH Idris ^a, L Shamsudin ^c, N Somchit ^c, MR Sulaiman ^a,^b

Abstract

Centella asiatica or Pegaga is a traditional herb, which was widely used for various ailments including ulcers. The gastroprotective properties of Centella asiatica (CA) extract was investigated in acetic acid and ethanol-induced ulcers in rats. The rats were given two doses of each extracts (2 and 4mg/kg) respectively everyday orally for 7 days prior to treatment with 6% acetic acid or 80% ethanol. Another 2 groups of rats (n=6/group) were given only CA extracts (2 and 4mg/kg) respectively everyday orally for 7 days. The positive control rats were given either 6% acetic acid or 80% ethanol after 12 hrs of fasting. The rats were sacrificed 24 hrs after the treatments. Negative controls were given normal saline only. The gastrointestinal tract was removed and the stomach and duodenum were cut open. The protective effects were compared through evaluation of gastric mucosal layer grossly and histologically. The gross lesions were scored as 1=normal, 2=mild, 3=moderate and 4=severe ulcers. Rats given CA only (2 and 4 mg/kg) and the negative controls (saline only) had normal stomach and duodenum (Mean score of 1.0 to 1.5). However, rats received acetic acid and ethanol only showed the presence of peticchial hemorrhages and several ulcers of approximately 2 mm in length. The mean lesion score were 3.5 and 2.33 respectively. Interestingly, rats pretreated with CA (2 and 4 mg/kg/day) prior to acetic acid administration had mean score of 1.5 to 2.0 respectively. Rats pretreated with CA (2 and 4 mg/kg/day) prior to ethanol administration had score of 1.0 to 1.5 respectively. These results suggested that CA extracts have ulcer protective activities on gastric mucosa induced by either acetic acid and ethanol in rats.

Malays J Med Sci. 2003 Jul;10(2):159–160.

Wound Healing Activity of Cassia Fistula

I Elysha Nur ^a, MN Somchit ^a, AR Mutalib ^b, WM Wan Nordin ^b, AM Mat Jais ^a,^c, A Salam Abdullah ^b

Abstract

Cutaneous injury is characterized by fibroplasias, angiogenesis and re-epithelisation and involves the migration and proliferation of cells such as fibroblasts, endothelial cells and epithelial cells, deposition of connective tissue and contraction of the wound (Clark, 1991). Efforts have been made all over the world to discover agents that can promote healing and thereby reduce the cost of hospitalization and agents that can save the patient from amputation or other severe complications. The aim of this study is to observe the ethanol leaves extracts of Cassia fistula in promoting wound healing in vivo. A midline incision through the whole skin thickness with a sharp scalpel was done on anaesthetized white albino mice’s. Animals were divided into 6 groups each having ten mice. Medication with local application of each extracts was made 24 hour after wound creation and was applied on a daily basis. Mice were fed with regular feed and free access of water. The mice were sacrificed at 0, 3, 6 and 9 days after wound creation and the entire wound was cut out and fixed in 10 % buffered formalin. Scoring was attributed as inflammation and cicatrisation. The score was adapted from Speroni et al., 2002; Marzulli et al., 1987. Topical application of ethanol leaf extracts of both plants was applied on wounds. Complete wound closure was observed within 9 days in Cassia fistula treated mice’s. The effect produced by the extracts, in terms of wound contracting, wound closure time, tissue regeneration, cicatrisation and histopathological characteristic were significant in Cassia fistula treated mice’s. The present study provides scientific foundation for the traditional use of this plant in the management of wounds.

Reference :

1.Clark RAF. Cutaneous Wound Repair. Oxford University; New York: 1991. p. 576. [Google Scholar]
2.Marzulli FN, Miabach HL. Dermatotoxicology. third ed. Hemisphere Publishign Corporation; New York: 1987. pp. 153–159. [Google Scholar]
3.Speroni E, Govoni P, Guizzardi S, Renzulli C, Guerra MC. Anti-inflammatroy and cicatrising activity of Echinacea pallida Nutt. Root extract. Journal of Ethanopharmacology. 2002;79:265–272. doi: 10.1016/s0378-8741(01)00391-9. [DOI] [PubMed] [Google Scholar]

Malays J Med Sci. 2003 Jul;10(2):160.

Nerve Conduction Study of the Upper Limb and Lower Limb in Healthy Subjects. A Comparison between Sexes. A Preliminary Results.

A Saufi ¹, J Abdullah ¹, P George Jain ¹, A Tahir ¹, MR Abdullah ², J Tharakan, A Prasad, H Munawwir, R Salmi

Abstract

Introduction :

Nerve conduction velocities can be easily measured on peripheral nerve. Sufficient stimuli from electrical stimulator can trigger nerve impulses. Once the action potential threshold of nerve fiber is reached, its electrical impulses will propagate at a rate of hundred metres per second. The velocity is directly dependent on the diameter of fiber and temperature.

Objectives :

To perform nerve conduction test (motor), on median nerve for upper limb (UL) and common peroneal for lower limb (LL).
To perform nerve conduction (sensory), on median nerve for upper limb and sural nerve for lower limb.

Methods :

Hundred normal subjects were recruited in this study. The age, sex, height and weight of the subjects were recorded. The recording electrode is fixed to the subject’s using adhesive tape. Later the targeted nerve is stimulated using a stimulator and the action potential is picked up the recording electrodes. The length of each nerve is estimated with a flexible measuring tape. For safety, a ground electrode is placed between the stimulating and recording electrodes. The room temperatures are measured using normal room thermometer. Statistical analysis (T Test) was done to see the difference of these value between male and female.

Results :

Of 100 subjects, 51 were male and 49 were female. Then mean age of the subjects was 34.48(±9.51), height 158.38cm(±9.22), Weight 62.05kg(±12.23). The mean velocity for median nerve (motor) for right UL56.143m/s (±6.284), left UL 55.276m/s (±6.85) and (sensory) for right UL 52.125 m/s (± 7.77) left UL 51.625 m/s (±7.423). For common peroneal nerve, the mean velocity for right LL 50.617 m/s (±4.75), left LL 48.947 m/s (±4.488) and for sural nerve, the mean velocity for right LL 45.68 m/s (±5.964), left LL 47.903 m/s (±5.369).

Discussion/Conclusion :

It was observed that, there is no significant difference in nerve velocities between male and female. However, further statistical analysis should be tested on other variables (age, height and Weight) in a bigger sample.

Malays J Med Sci. 2003 Jul;10(2):160.

Postprandial Lipaemia in a Paired Control Group

BSH Shahrul ¹, M Mafauzy ¹, MWB Wan ¹, H Ruhani ², AR Faridah ¹

Abstract

Lipid analysis is performed only using fasting samples but an individual is frequently in the postprandial state throughout the day. Therefore chylomicron remnants are contantly present are constantly present in circulation throughout the day. Differences in dietary intake and along with postprandial lipaemia could predispose individuals to an increased risk of atherosclerosis. The purpose of the current study was to identify a suitable fat load to be given during an oral fat tolerance test (OFTT). Palm olein was chosen as the fat source as it is the major edible oil in Malaysian diet. Ten volunteers were given 3 test meals at separate times. Three milkshakes differing in palm olein content was studied in this paired group study. Blood was drawn at baseline, 2, 4, 6, 8, and 9 hours respectively. The differences within the test meals was tested and it was noted that only test meal A (p=0.035) showed significant differences in triglycerides contents during postprandial state. In conclusion, more than 48.9% fat calories consumption alters the normal metabolism of dietary fat within 4 hour postprandial. Current protocol for milkshake B preparation could be used as a standard fat tolerance test for the purpose of screening postprandial lipaemia.

Keywords: Palm olein, postprandial lipaemia, fatty acids, oral fat tolerance test

Malays J Med Sci. 2003 Jul;10(2):161.

Age Related Changes in Renal Function in Spontaneously Hypertensive Rats (SHR).

YC Cheng ^a, Nor Akmal Wahab ^a, Harbindar Jeet Singh ^a, Samarendra S Mutum ^b

Abstract

Prolonged uncontrolled hypertension is known to cause renal impairment [1]. The precise mechanism by which raised systemic blood pressure leads to renal impairment is unclear. Compared to normotensive individuals, hypertensives have been shown to have higher levels of malondialdehyde (MDA) [2] and lower levels of antioxidant activity [3] in plasma. The exact significance or consequence of the raised levels of MDA and lowered antioxidant activity in end organ damage in hypertension is unclear although free radicals have been implicated in cell damage [4]. This study attempts to ascertain the age at which changes in the levels of MDA and renal impairment begin to occur in SHR. Sixty-six male SHR, aged 8 weeks, were divided into eleven groups. A similar number of male WKY rats were also similarly divided to act as parallel controls. All animals were exposed to similar day-light pattern and had access to food and water ad libitum. Body weight and systemic blood pressure, monitored by the tail-cuff method (Life Science, IITC), were recorded every four weeks. Every four weeks, six rats per group were anaesthetised for measurement of glomerular filter rate (GFR), using standard clearance procedures, and then exsanguated for plasma collection. Plasma MDA was measured using High Performance Liquid Chromatography (HPLC) (5). Mean body weight of SHR was consistently lower than that of WKY rats from the age of 12 weeks onwards (p < 0.05). Blood pressure, on the other hand, was significantly higher in the SHR when compared to that in age – matched WKY rats from the age of 8 weeks onwards (p < 0.05). Interestingly, plasma MDA concentration was higher in the SHR than in the controls only from the age of 12 weeks, reaching statistical significance by the age of 24, 44 and 48 weeks. GFR was lower in SHR from the age of 24 weeks (p < 0.05). From the results, it appears that there is an age-related decline in GFR in SHR particularly from the age of 24 weeks onwards when compared to WKY rats. Serum MDA levels begin to show a rise at the age of 12 weeks. It is unclear if the decrease in GFR is a result of the raised levels of MDA, but it appears that renal impairment occurs subsequent to changes in serum MDA levels. Clearly, more studies are need to ascertain the relationship between the changes in GFR and MDA in hypertension.

References :

1.Jerome G, Porush MD. Hypertension and chronic renal failure: The use of ACE inhibitors. Am J Kidney Dis. 1998;31:177–184. doi: 10.1053/ajkd.1998.v31.pm9428471. [DOI] [PubMed] [Google Scholar]
2.Russo C, Olivieri O, Girelli D, Faccini G, Zenari ML, Lombardi S, Corrocher R. Anti-oxidant status and lipid peroxidation in patients with essential hypertension. J Hypertens. 1998;16:1267–1271. doi: 10.1097/00004872-199816090-00007. [DOI] [PubMed] [Google Scholar]
3.Sagar S, Kallo IJ, Kaul N, Ganguly NK, Sharma BK. Oxygen free radicals in essential hypertension. Mol Cell Biochem. 1992;111:103–108. doi: 10.1007/BF00229580. [DOI] [PubMed] [Google Scholar]
4.Pryor WA. Free radical and lipd peroxidation: What are they and how they got that way. Academic Press; 1994. [Google Scholar]
5.Nielsen F, Mikkelsen BB, Nielsen JB, Anderson HR, Grandjean P. Plasma malondialdehyde as biomarker for oxidative stress: reference interval and effects of life – style factors. 1997;43(7):1209–1214. [PubMed] [Google Scholar]

Malays J Med Sci. 2003 Jul;10(2):161.

Bilateral Persistent Sciatic Arteries: Normal Variant of the Lower Limb Artery.

NY Nik Rizal ^*, AR Ariff ^*, IL Shuaib ^*, AA Ezane ^*, I Abu Bakar ^*, M Khoiri ^*, Y Rohaizan ^*, AH Yusoff ^*, I Yusoff ^*

Abstract

Introduction :

Persistent sciatic artery is a very rare anomaly of the lower limb artery with risk of aneurysm, atherosclerotic changes and thromboembolic phenomenon to the distal arteries. Presents usually as pulsatile gluteal mass, ischaemic changes of the affected lower limb or incidental finding during angiography for pre-renal transplantation. US Doppler, angiography and CT angiography are the radiological modalities to demonstrate this anomaly.

Objectives :

To highlight the first reported case of aneurysm of right persistent sciatic artery in South East Asia and to demonstrate advantages of CT angiography in diagnosis of this anomaly.

Patient and Method :

A 41-year old Malay army personnel developed ischaemia of the right lower limb. Lower limb angiography mistakenly diagnosed aneurysm from common femoral artery. Surgical exploration failed to identify the aneurysm. Orthopaedic team found the pulsatile right gluteal mass and this was found to be aneurysm of right sciatic artery.

Conclusion :

CT Angiography is helpful to diagnose persistent sciatic artery.

Malays J Med Sci. 2003 Jul;10(2):161–162.

Percent Loss of Acclimatization During Exercise in and Exposure to Cold Environment

Mohamed Saat Ismail ^1,³, RG Sirisinghe ¹, Rabindarjeet Singh ²

Abstract

Percentage loss of acclimatization during a period of exercise in cold environment and reacclimatization after returning to exercise in hot environment was investigated. Eight healthy male volunteers (mean age and VO_2max are 17.25±0.25 years and 51.53±1.56 ml.kg.⁻¹.min.⁻¹ respectively) underwent heat acclimatization by exercising on a bicycle ergometer for 60 min each day at 60% of VO_2max in a hot environment (31.04±0.02°C, 68.79± 4.53% rh) for 14 days. Subsequently they were divided into 2 groups with matching VO_2max. One group continued exercising in a cold environment (18.04±0.02°C, 58.79±2.53% rh) for 60 min each day in the morning and exposed to the cold environment for another hour in the afternoon for a period of 14 days. The other group was only exposed to the cold environment (18.04±0.02°C, 58.79±2.53% rh) for one hour each in the morning and afternoon. Following this all subjects returned to exercise for reacclimatization in the hot environment for 10 days. Subjects were tested at the start (day1) and at the end of heat acclimatization (day 16). They were tested for decay of heat acclimatization (decay) after 4 days (day 21) and 14 days (day 32) of exercise in or exposure to cold environment. Reacclimatization was tested 3 days (day 36) and 10 days (day 44) after returning to exercise in hot environment. During testing heart rate (HR) and rectal temperature (T_re) were measured on a bicycle ergometer for 60 min at 60% of VO_2max in the heat. During initial acclimitazation the mean T_re at 40 min of exercise decreased from 38.99±0.16°C (day1 n=8) to 38.28±0.11°C (p<0.01) (day 16 n=8) and HR decreased from 182±2 beats min⁻¹ to 156±3 beats min⁻¹ (p<0.01). The exercise group in cold environment (n=4) showed greater decay in T_re of 31% (p<0.05) and 42% and HR of 25% (p<0.05) and 38% (p<0.05) after 4 and 14 days respectively, whereas the cold exposure (n=4) group showed decay in T_re of 4% and 14% and in HR of 14% and 11%. Reacclimatization was faster for the group exposed to cold with mean gain in T_re of 12% and 26% and HR of 7% and 36% (p<0.05) after the 3^rd and 10th day respectively. The cold environment exercise group showed slower reacclimatization and still had mean losses in T_re of 33% and 6% and in HR of 29% and 13% for the two tests respectively. In conclusion, the decay in acclimatization is greater and reacclimatization slower in those who exercised in the cold compared to those who were merely exposed to it.

This study was supported by a USM short term grant

Malays J Med Sci. 2003 Jul;10(2):162.

Physical Activity Monitor Facilitates Body Composition Changes in Adult Females: Preliminary Result

Wong Sook Kwan ¹, Rabindarjeet Singh ¹, Roland G Sirisinghe ¹, Willy Pieter ¹, Mohd Nawawi Yasin ¹

Abstract

Objective :

To determine the effectiveness of PAM in facilitating body composition changes in adult females.

Methodology :

A total of 35 females participated in this study. The females were randomly assigned to the PAM + Advice on exercise Intervention (PAM) (n=20, aged 40.3±7.8 yr) or Advice on exercise only condition (Control) (n=15, aged 37.6±7.3 yr). Both groups underwent anthropometric and body composition assessments before and after a 3-months’ intervention. Height was measured without shoes using a Seca‚ bodymeter 208, body weight (BW) with minimal clothing was measured using Tanita‚ TBF-410 (Japan) after ingestion of 500ml water 2 hr prior to the measurement. Percent body fat (%BF), Body Mass Index (BMI), and waist-hip ratio (WHR) were derived from the anthropometric data obtained.

Statistical Analysis :

A 2-way (Group*Time) mixed ANOVA with repeated measures on the second factor was used to determine the differences between groups over time. Due to the heteroscedasticity of some of the data, log transforms were used for statistical analysis.

Results :

Data obtained indicated that there were no 2-way interaction and time main effects for all the variables (p> 0.05). However, there were significant group main effects for all the variables. The PAM group was found to be lower in: weight (52.81±6.95kg vs 60.62±10.72kg, p=0.013), BMI (21.36±2.78 vs 25.49±4.93, p=0.003), %BF (33.52±3.06% vs 37.80±5.63%, p=0.011) and WHR (0.75±0.05 vs 0.80±0.08, p=0.021).

Conclusion :

Those who used PAM showed lower reading in all the body composition parameters compared to those who did not (Control), but there were no significant differences over time. It is suggested that a bigger sample size is needed to find a time effect for body composition.

Objectives :

This is a part II of our study, which aims to determine prevalence of Streptococcal and Staphylococcal groups in CLP patients before and after surgery

Introduction :

Dental caries is prevalent in Cleft Lip and Palate (CLP) patients and oral Streptococci play a significant role in the initiation of its development.

Methodology :

This is a prospective prevalence study. Saliva samples were collected from 20 CLP patients immediately before operation (0 week) and at 12 weeks after operation (12 weeks). Twenty-two normal children were examined as a control group. The samples were cultured and identified to the species level while the colony counting was done according to plate method.

Results :

We found that, Staphylococcal count in CLP at 0 week was (mean 5.39, SE 1.87) 10³ CFU/ml and it has reduced to (mean 0.50, SE 0.21) 10³ CFU/ml at 12 weeks (p<0.01). Staphylococcus aureus was the commonest Staphylococcal species (52.4%) found in CLP patients at 0 week. For Streptococcal identification, Streptococcus mitis biovar 1, Streptococcus salivarius and Streptococcus oralis were the most common Streptococcal species found in normal children as well as in CLP patients and. However, the differences in the types of Streptococcal and Staphylococcal species were not statistically significant. All were tested by parametric test

Conclusion :

Hence we conclude that operation helped reduce Staphylococcal count because it can close the cleft and the commonest Staphylococcal species found in CLP before surgery is Staphylococcus aureus.

A USM short-term IRPA grant (A/C: 304/PPSG/6131144).

Malays J Med Sci. 2003 Jul;10(2):167.

Three Methods of Vertical Dimension of Occlusion

MD Haryo ¹

Abstract

The vertical dimension (VD) can be defined prosthodontically as the vertical measurement of the face between two arbitrary points, one above and one below the mouth, in the midline. The establishment of vertical maxillomandibular relations is a phase of prosthodontic treatment for edentulous patients for which several different methods have been suggested and it is critrical for the function of the stomatognathic complex. The objectives of the research were to compare and evaluate three methods of determining VD: (i) the Simplified Method of Hayakawa; (ii) the indicator Procedure of Hayakawa and (iii) the Dipoyono and Sugiatno Method. The number of subjects used to test each method was 30.In Addition to the measurements that were used to determine VD, additional information was obtained from the subjects about facial form and the palm of the hand. Mean deformation (in mm) were 57.327(The Simplified Method of Hayakawa) ; 56.980 (The Indicator Procedure of Hayakawa) and 61.217 (The Dipoyono and Sugiatno Method).This difference was significant (p< 0.01) as tested by Analyzed of Variance. It was found that the methods of Hayakawa were very complicated to use but the Dipoyono and Sugiatno is simple and quick to use. It is concluded that each of the three methods tested is useful for measuring VD but the method of Dipoyono and Sugiatno is simple and recommended for full denture clinical use.

Malays J Med Sci. 2003 Jul;10(2):167.

Experiences and Perception of Fathers’ During Childbirth in HUSM

Nurhidayah Jeet Abdullah ¹, Nik Hazlina Nik Hussain ¹

Abstract

Objectives :

To describe how fathers who are present during childbirth experience the event, what they feel during childbirth, what are their perception toward support from healthcare professionals and to identify the needs of the fathers during labour and delivery.

Methods :

Survey using structured close-ended questionnaires was carried out over one month period. This study was conducted in the labour suite of Hospital Universiti Sains Malaysia, Kubang Kerian, Kelantan. A convenient sample of 40 fathers, 15 primid and 25 non-primid fathers who were present at the birth of their baby were selected for the study.

Results :

Almost all out 40 fathers said that they become fearful of the outcome (95%), and most of the (75%) found that as labour progresses the level of stress experienced increased. Most of them, regardless of parity (72.5%) reported feeling helpless during labour. However, all of them were pleased at being present and giving support to their partner during labour and delivery and share the experience of childbirth. Regarding the perception towards healthcare professionals, most of the fathers reported as not being received any guidance or methods in helping their partner during the event from doctors and nurses. Most of them also believed that they received inadequate information concerning care of their wives. However, most of them agreed, being given information regarding progresses of the labour. Almost all of them, reported need an antenatal classes as preparation in becoming a supporter to their partner during childbirth.

Conclusion :

fathers should be included in labour management plans and need support for their role as labour partners.

Malays J Med Sci. 2003 Jul;10(2):167.

The Age of Diagnosis of Hearing Impairment in Children in Hospital Universiti Sains Malaysia

Che Ismail Che Lah ¹, DinSuhaimi Sidek ¹

Abstract

Objectives :

To identify possible factors causing delay in diagnosis and rehabilitation of pediatric hearing impairment and to assess the relationship between the age of identification and other related parameters.

Introduction :

World Health Organisation(WHO) indicates that there are at least 42 million people over the age of 3 years in advanced countries suffered a profound, severe or moderate hearing loss. In West Malaysia, it is estimated that 500 children are born deaf per year. In recognition of the importance of early identification and intervention in children with congenital hearing impairment, numerous hearing screening programs have been introduced throughout the world.

Methodology :

A restrospective analysis of 75 children attending Otorhinolaryngology-HNS Clinic, Hospital Universiti Sains Malaysia for hearing assessment between January 1999 to December 2002. The children were evaluated for the degree and type of hearing loss and positive family history. The data was statistically analysed by SPSS v.11 using univariate simple logistic test for the possible association between age of identification and gender, districts, type of hearing loss and level of income.

Results :

The age at diagnosis of hearing impairment ranged from 4 month to 10 years old with median age of 4.6 years. Most of the patients were referred by medical officers at outpatient clinic, HUSM and health centres throughout Kelantan. There is no significant association between the age of identification and gender, districts, type of hearing loss and level of income. For the etiology of hearing loss, there was a significant association between the age of diagnosis and patients with positive family history of hearing loss (CI 95%, p<0.05, O.R=0.263).

Conclusions :

The age of diagnosis of early hearing impairment in HUSM is considerably late (4.6 years median age) while the critical age for learning speech and language is 0–3 years. This justify further efforts of implementing a universal hearinf screening in the ealy days or months of life and increase awareness among the health workers and public.

Malays J Med Sci. 2003 Jul;10(2):168.

A Preliminary Study of Phonological Development in Kelantanese Children Aged 2 To 5 Years Old

Wan Zaharah Bt Ab Wahid ¹

Abstract

Estimated ages of phonemes acquisition is vital as a baseline in making accurate diagnosis for children with phonological disorders and also useful for the speech remediation program. This preliminary study of phonological development aimed to determine the ages of acquisition of 17 phonemes in the Kelantanese dialect and comparison was made between these acquisition ages among English, Arabic and Cantonese children. Samples were obtained from a hundred normal developing Kelantanese children between the ages of 2 to 5. A structured and formal picture-naming test, consist of 35 single word that representing phonemes at all possible initial, medial and final positions in Malay Kelantanese Dialect was used. Speech sample was recorded on a portable cassette recorder and were transcribed using the International Phonetic Analysis system (IPA). Subject was considered to master target phoneme when she or he produced it at least 85% correct at initial, medial or final position. It was noted that by the age of 3, subjects have acquired at least 8 phonemes. Among the earliest phoneme to be mastered is the unvoiced stop /p/ and the last phoneme to be acquired is the fricative /s/. These findings also support Jakobson’s universal theory. The ages of acquisition of phonemes among Kelantanese children was quite similar to those for English and Arabic but was relatively delayed from Cantonese.

Malays J Med Sci. 2003 Jul;10(2):168.

Gender Difference in Stroke Risk Factors at Besut Hospital 2001

Norsaádah Bachok ¹

Abstract

Stroke is one of the leading causes of morbidity in Malaysia. A retrospective cross-sectional study was conducted among stroke patients who were admitted into Besut Hospital during year 2001. The objectives of the study were to determine the incidence rate of stroke in Besut District, to identify prevalence of concurrent diabetes, hypertension, hyperlipidaemia and heart diseases among stroke patients, and to identify gender difference of the above risk factors. There were 62 stroke cases admitted into Besut Hospital with the incidence of 0.046%. Majority presented at age of 50 years or above. 52% were males and they were affected at younger ages than females. 53.2% had hypertension, 35.5% had heart diseases, 27.4% had diabetes mellitus and 4.8% had hyperlipidaemia. Males tended to have multiple risk factors than females. 26.7% females had no risk factors compared to only 12.4% among males. Males had higher percentages than females in all risk factors, especially heart diseases followed by hypertension. 25% of males had more than two risk factors compared to females 13.3%. The incidence of stroke in Besut district was low. Stroke was strongly associated with risk factors such as hypertension, diabetes mellitus and heart diseases. There was gender difference in the risk factors of stroke. Control and prevention of hypertension, diabetes and heart diseases are crucial in order to control and prevent the occurrence of stroke.

Malays J Med Sci. 2003 Jul;10(2):168.

Prevalence of Menopausal Symptoms in Malaysian Kelantanese Women

Hardip Kaur Dhillon ¹, Nik Mohamed Zaki Nik Mahmood ¹

Abstract

Menopause is a universal biological phenomenon that is reportedly associated with numerous transient typical and atypical symptoms. It has been suggested that asian women suffer more of the atypical symptoms and fewer, and with lesser severity, the typical psychological and vasomotor symptoms then the western women ^1,2. This study therefore reports the incidence and the nature of menopausal symptoms in Kelantanese women. A semi-structured self administered questionnaire in Malay and English language was administered to 326 postmenopausal women (mean age of 57.01 ± 6.58(SD) years) residing in Kelantan. The subjects comprised of naturally menopaused, healthy women. Women with uncontrolled diabetes and hypertension were not included. Mean age of menopause was 49.4 ± 3.4 (SD) while the mode and median were 50 years. The postmenopausal period varied from 1 to 20 years with 56.4% of the respondents being within 1 to 5 years postmenopause, 18.1% within 6 to 10 years postmenopause, 12.9% within the 11 to 15 years postmenopause, 12.6% within 16 to more then 20 years postmenopause. The break-up of the menopausal symptoms included complaints of tiredness (79.1%), decreased level of concentration (77.5%), backache (67.7%), joint and muscle pain (70.6%), night sweat (53%), mood swing (51.5%), headache (49.4%), sleep problems (45.1%), vaginal discomfort (45.7%), hot flushes (44.7%), crying spells (33.4%), loneliness (41.1%) and anxiousness (39.8%).

Tiredness, reduced level of concentration, night sweat, mood swing, headache, occasional vaginal discomfort, hot flushes, were complained to a mild degree whereas sleep problems, crying spells, loneliness and anxiousness were in the mild to moderate category. Interestingly, backache, joint and muscle aches were complained to a moderate degree by majority of the women It appears that the majority of the Kelantanese women had more of the atypical symptoms of tiredness, decreased level of concentration, backache and joint and muscle pain. The classical symptoms such as hot flushes, vaginal discomfort were reported by less then 50% of the women with the exception of night sweats and mood swings.

Reference

1.Boulet MJ, Oddens BJ, Lehert P, Vemer HM, Visser A. Climacteric and menopause in seven South-east Asian countries. Maturitas. 1994 1994 Oct;19(3):157–76. doi: 10.1016/0378-5122(94)90068-x. [DOI] [PubMed] [Google Scholar]
2.Chim Harvey, et al. The prevalence of menopausal symptoms in a community in Singapore. Maturitas. 2002;2002;41:275–282. doi: 10.1016/s0378-5122(01)00299-7. [DOI] [PubMed] [Google Scholar]

Malays J Med Sci. 2003 Jul;10(2):169.

Prevalence of Oral Candidal Carriage in the Adult Malaysian Population

S Rasool ¹, CH Siar ¹, KP Ng ¹

Abstract

Objectives :

To determine the various oral Candidal biotypes among healthy Malaysian adults in order to establish a database for local future references.

Introduction :

Candida is a normal commensal of oral mucosa. It is prevalent in diabetics, denture wearers, smokers and those with xerostomia.

Methodology :

Sixty adults (30 smokers and 30 nonsmokers), aged 40–70 years were studied. Swabs and Carbohydrate assimilation (SDA, Corn Meal Agar, API20C AUX System) were performed. Specimens were collected from dorsum of tongue, buccal mucosa and commissures (right and left each). Colony forms were established by positive colony forming units, on SDA Medium (24–48 hours). Germ tube for (true/pseudohyphae) growth, was done on Corn Meal Agar Medium. Candida biotype, is evaluated by API20C AUX System, which has a numerical 7 digit profile, added to evaluate a definite Candida biotype

Results :

28.3% of Malaysian adults harbored Candida. Candida biotypes identified were as follows: C. albicans 59%, C. glabrata 17%, 6% each of C. famata, C. tropicalis, C. guilliermondii and C. lusitaniae. Seventeen positive cases, of these 53% were smokers and 47% non smokers. These consisted of Malays 40%, Chinese 33% and Indians 27%.

Conclusion :

Findings demonstrate that C. albicans is the most common biotype found in the oral cavity of Malaysian adults. It is equally prevalent in smokers and non-smokers, but showed a predilection for the ethnic Chinese group.

Malays J Med Sci. 2003 Jul;10(2):169.

A Survey on Acanthamoeba Contamination in Household Water Sources in Terengganu

Nakisah Mat Amin ¹, Noriza Hussain ¹

Abstract

Free-living amoebae including Acanthamoeba spp can be found everywhere such as in fresh water reservoirs, swimming pools, hot tubs, bottled water and even in eyewash stations (Seal et al., 1992; Alizadeth et al., 1996). These organisms become increasingly important due to some of the species of Acanthamoeba such as A. castellanii, A. polyphaga, A. culbertsoni, A. rhysodes. A.healyi and A divionenses have been reported to be associated with human diseases (Martinez, 1985; Murakawa et al., 1995; Bowmen et al., 1996). Cases of Acanthamoeba keratitis diagnosed at Hospital Kuala Lumpur in 1995 and 1997 (Mohamad Kamel, UKM, Kuala Lumpur, personal communication) are proof of their importance as facultative pathogens. In one of the case reported at Hospital Kuala Lumpur, a patient contracted keratitis from washing his face with amoeba-contaminated water at a construction site. Therefore, in this study, various water sources such as pipes of water sinks and toilets in several houses at Mengabang Telipot, Wakaf Tengah, and Tok Jembal, Kuala Terengganu were examined for the presence of the amoebae. The amoebae were isolated from the pipes using sterile cotton swab technique as described by Devonshire et al. (1993). The tip of the cotton probably containing amoebae were cultivated at 30°C on non-nutrient agar and fed with heat-killed Escherichia coli. The subpassaging of the amoebae was done several times until single species of amoebae were obtained. Identification of the amoebae was done by observing the locomotion and morphology of trophozoites and cysts under light microscopy following Page’s descriptions (1988). The results obtained from this study indicated that 12 out of 70 houses (17.1%) were found positive to contain amoebae in their household water sources. Among the positive samples (12 samples), four of them (33.3%) contained Acanthamoeba. Most of the amoebae were found in pipes from water sinks in kitchens than from pipes in the toilets. Water supplied to the kitchen normally comes direct from the main pipes whereas water supplied to the toilets comes from the water reservoir/tanks in the house. The presence of Acanthamoeba in pipes from water sinks in the kitchen perhaps due to the occurrence of low water pressure in the main pipes which supply the water to the households in the areas where the study was conducted. The low water pressure in the main pipes will result reduced in water flows in the pipes (in the kitchens), thus this will encourage mucus and dirt to accumulate in the inner sides of the pipes. This condition provides a suitable microenvironment for the bacteria to grow. Since in natural environment, the presence of free-living amoebae are always associated with bacteria, the presence of bacteria in the pipes, thus attracts the amoebae. If on the other hand, the water in the pipes is fast flowing, the chances of the dirt and mucus to accumulate in the pipes are less and this prevents both the bacteria and amoebae to be present in the water pipes. Furthermore, the seventy houses examined in this study were located in low and medium cost budget residential areas which perhaps correlate with their hygienic status. So far, there is no report on diseases associated with Acanthamoeba in Terengganu. The species of Acanthamoeba obtained in this study perhaps is not pathogenic or their number is too low, so their presence in pipes either from water sinks or toilets is not that alarming or health-threatening to the individuals in the households.

Malays J Med Sci. 2003 Jul;10(2):169–170.

Evaluate of Risk Factors Questionare among Subjects Exposed to Road Traffic Noise in Kota Bharu

Shahid Hassan ¹, Haslinda Mohd Taha ¹, Che Ismail Che Lah ¹

Abstract

Introduction :

Road traffic noise has been reported to be perpetual cause of a6nnoyance among community at large. Kota Bharu due to its increasing population, urbanization, road planning and ever rising volume of road traffic is likely to face this problem. The land is not well integrated. Residential developments are in close proximity to transport corridors. These facts have persuaded as to quantity the problem by a field survey leading to a data collection with regard to prevalence of road traffic noise and its possible effects on population exposed.

Objective :

To determine average traffic noise level at varies sites in Kota Bharu and its effects on subjects residing along the edges of traffic lane.

Methodology :

A five minutes continues regarding for 16 hours per day. The average of 32 regarding indicated prevalence of noise always specified site. An average highest and lowest noise level was also documented using a Amplaid sound level meter. Subjects were randomized to undergo cross sectional audiometric survey carried in acoustically treated booths for pure tone audiometry.

Result :

Environmental nose level was found under critical level of 85dBA at most of the place surveyed. N. IH.L pattern determined in 6 subjects exposed to high level of noise along give the main traffic lane.

Conclusion :

At few sites the noise level has reached very close to hazard’s figure and N.I.H.L pattern in some subject’s are alarming in a comparative quite environment of Kota Bharu.

Keywords: Road traffic noise, Noise induced hearing loss, risk factors

Malays J Med Sci. 2003 Jul;10(2):170.

Groups of acanthamoeba SP. Isolated from Saltwater in the West Coast of Peninsular Malaysia

N Anisah ¹, S Yusof ¹, A Wan Norliana ¹, AR Noraina ¹, M Norhayati ¹

Abstract

A study was conducted for the isolation of Acanthamoeba sp and identification of the groups isolated from seven location in the West Coast of Peninsular Malaysia. Seventy samples were cultured onto non-nutrient agar (NN-A), incubated at 300C and examined daily for 14 days. Acanthamoeba sp. was isolated from 37 samples (52.8%). Isolation rate was high in samples from Tanjung Tuan (90.0%), Tanjung Gemuk (80.0%), Port Dickson (70.0%), Morib (60.0%) and bagan Lalang (46.7%) compared to Pulau Pangkor (30.0%) and Lumut (10.0%). Group II (polyphagisd) is the most frequently isolated group (64.9%), followed by group III (culbertsonids). This finding signify the needs for further investigation especially on species differentiation, pathogenicity and factors that influnce the survival of Acanthamoeba sp. in this environment.

Malays J Med Sci. 2003 Jul;10(2):170.

Hand Washing and Monitoring among Staff of NICU, HUSM, Kubang Kerian, Kelantan.

AR Zaihan ¹, H Van Rostenberghe ¹, WI Wan Pauzi ¹, M Zeehaida ¹, Kasmah Wati Pardi ¹

Abstract

Objective :

To monitor hand washing practice in NICU, HUSM and comparing it with result of previous monitoring.

Methodology :

Hand washing practice before 455 staff baby contacts was monitored in NICU, HUSM. Results were classified as appropriate (following hand washing policy of the unit completely), not appropriate (hand washing but not following the policy of the unit or contamination between hand washing and baby contact) or not hand washing. The results were compared with those of a similar campaign 1 year earlier, which had significantly improved hand washing practice in the unit.

Results :

Hand washing was appropriate in 71% of cases, inappropriate in 24% of cases and there was no hand washing in 5% of cases. These results were comparable and not statistically significantly different from results obtained immediately after a hand washing campaign 1 year earlier.

Discussion and conclusion :

Those results show that hand washing is still not satisfactory among the NICU staff of HUSM but results were not significantly different and even slightly campaigned 1 year earlier. This may be due to continuous efforts from the infection control nurse and her team.

Malays J Med Sci. 2003 Jul;10(2):170–171.

Universal Hearing Screening Program in Hospital USM: A Preliminary Report.

MD Mohd Khairi ¹, M Suzana ¹

Abstract

Introduction :

Significant hearing loss in one of the most common major abnormalities present at birth. Even mild hearing impairment seriously affects language, speech and cognitive development. Early identification and intervention lead to improved communication skills, which positively impact psychosocial, educational and vocational development.

Objective :

This prospective study reports on the prevalence of hearing impairment in neonatal unit population (NICU graduates and less severe ill infants).

Methodology :

A cross sectional study was conducted on 401 baby who had been admitted into the Neonatal Unit of the Hospital Universiti Sains Malaysia during the period 15^th February, 2000 to 15^th March, 2000 and 15th February, 2001 to 15^th May, 2001. The hearing assessment was done by using otoacoustic emission screener. Data entry and analysis were done through SPSS Version 10.0 software.

Results :

370(92.27%) infants passed the primary screen for both ears. Eight (2%) infants failed on ear and twenty three (5.74%) infants failed both ear, adding up to 7.74% planned for second stage screening. Five out of twenty infants who had come for the follow up failed the screening resulting the prevalence of hearing impairment of 1.0% (95% CI 0.0–2.0). Craniofacial malformations, very low birth weight, ototoxic medication, stigmata / syndromes associated with hearing loss and hyperbilirubinaemia at the level of exchange transfusion were identified to be independent significant risk factors for hearing impairment (P<0.05). The mean total test time was 5.43 minutes. Poor apgar score and mechanical ventilation of more than 5 days were not found to be associated with hearing impairment in the present study population.

Conclusion :

Hearing screening in high-risk neonates revealed a prevalence of 1.0% with hearing loss. Significant risk factors were craniofacial malformations, very low birth weight, ototoxic medication, stigmata / syndromes associated with hearing loss hyperbilirubinaemia at the level of exchange transfusion. Other perinatal complications did not significantly influence screening results indicating improved perinatal handling in a neonatal population at risk for hearing disorders.

Malays J Med Sci. 2003 Jul;10(2):171.

A Study of Knowledge, Attitude and Practice on Contact Dermatitis Among Hospital Cleaners in Kota Bharu Kelantan

BA Hasniza ¹, BN Rusli ^1,^3,^✉, T Winn ¹, BMN Nazmi ², L Naing ¹, RC Sohel ¹

Abstract

Introduction :

Lack of awareness in potential health hazards at workplace may contribute towards a more tolerant attitude towards exposure to allergens and irritants.

Objectives :

This study aims to determine the knowledge, attitude and practice of contact dermatitis among hospital cleaners in Kota Bharu, Kelantan.

Methodology :

A cross-sectional study was undertaken in August 2001 to June, 2002. A pilot study was undertaken to validate the KAP questionnaire. Two hundred and ninety seven hospital cleaners were recruited from Hospital Universiti Sains Malaysia (HUSM) and Hospital Kota Bharu (HKB). Data were collected using the structured questionnaires comprising of 3 socio-demographic, 5 occupational, 25 Knowledge, 14 Attitude and 14 Practice (KAP) regarding contact dermatitis.

Results :

Results indicated that there was no significant difference in the mean scores of KAP between 22 hospital cleaners with contact dermatitis and 275 hospital cleaners without contact dermatitis.

Conclusions :

The non-significant KAP score between the two groups indicates that training on prevention of contact dermatitis among hospital cleaners need to highlight the relationships between dermatitis and risk factors.

Keywords: contact dermatitis, hospital cleaners, knowledge, attitude, practice HUSM, HKB

Malays J Med Sci. 2003 Jul;10(2):171.

Nutritional Status of Primary School Children in Bachok and Tumpat District

CT Asiah ¹, MH Mohd Hashim ¹, A Zulkifli ¹

Abstract

Objective :

The aims of this cross-sectional study were to investigate the nutritional status of primary school children and to identify its risk factors.

Introduction :

Undernutrition among children in Malaysia is common among poor rural families. The nutritional status is an important factor for growth and good academic performance. Nutritional status is related with food intake and socio economic status of families.

Methodology :

The study was a cross-sectional survey of standard one students. Eighteen primary schools in Tumpat and Bachok districts were selected randomly. Nine hundred and thirty seven standard one children were selected using cluster sampling. Weight and height of children were measured and socio-demographic data were taken using questionnaires answered by parents. Z-scores of weight-for-age, height-for-age and weight-for-height were calculated.

Results :

Subjects were almost equal between boys (50.1%) and girls (49.9%). Majority (71.2%) were come from family with low per capita income (<RM84.38). Majority of father (61.0%) work as labourer or farmer and majority of mother were full housewife. Mean family income was RM613.20, whereas mean family household was 7.8. Children who received breast feeding was 91.1%. Prevalence of underweight, stunted and wasted were 25.3%, 21.3% and 6.3% respectively. Multivariate analysis showed only gender has significant effect (p=0.013) on z-score of weight-for-age. Family income has significant effect (p=0.037) on z-score of height-for-age. Non variables has significant effect on z-score of weight-for-height.

Conclusion :

Malnutrition is still a public health problem in Tumpat and Bachok districts.

Malays J Med Sci. 2003 Jul;10(2):171–172.

Is there a Biasness in the Recording of Body Temperatures in Apyrexial Patients ?

Raudzah Mohamed Ariffin ¹, Asiah Abu bakar ¹, Che Noriah Othman ¹, HJ Singh ¹

Abstract

Measurement of body temperature, a well recognized aid in the diagnosis and treatment of numerous diseases, is the most frequently performed procedure on all wards. Mouth, axilla and rectum are the three most commonly used sites for monitoring body temperature. The recommended times for measurement of body temperature in adults, when using a mercury thermometer, range from between 3 to 7, 5 to 9 and 3 to 7 minutes for oral, axilla and rectum respectively. Despite its simplicity, there is always a tendency to error in its measurement, particularly in the duration of its measurement and its subsequent documentation. We investigated this possibility by examining the accuracy of its measurement and documentation in one of the local hospital. Fifty-four apyrexial adult medical patients took part in the study. After receiving an informed consent, oral and axillary temperatures were measured simultaneously immediately after the routine measurement by the nurse on the ward. Measurements were recorded after 30 seconds and then every minute for a period of twelve minutes for both the procedures. All measurements were recorded by the same investigator. Data were analysed using ‘ANOVA’ for repeated measures, ‘t’ tests for paired samples and ‘chi’ square test. As expected, mean oral temperature, at the end of the 12 minutes, was 0.6°C higher than that measured from the axilla. Measurements tended to plateau at about the eighth minute during oral measurement and by the tenth minute when measured from the axilla. Mean oral temperature measurements did not differ significantly from those recorded by the nurse on the ward (37.12 ± 0.10 vs 37.17 ± 0.83 °C). The correlation between the two sets of observations, though highly significant, (r = 0.783; p<0.00), however was not as close as one would expect when recording this parameter. There was a significant difference in the frequency distribution between the temperatures recorded by the investigator and those recorded by the nurse on the ward (p < 0.00). There was a tendency for the temperatures to be recorded and documented around the region of 37°C by the nurse on the ward. The duration per measurement by the nurses on the ward rarely reached the required minimum 8 – 10 minutes per patient. In conclusion, our data reveals that for accurate measurement of body temperature the thermometer has to be placed for a minimum period of 8 and 10 minutes either in the oral cavity or the axilla respectively. In addition, there also appears a tendency for temperatures to be recorded closer to 37°C by the nurse on the ward. The reason for this is unclear but it may reflect an element of biasness when expecting to record temperatures in apyrexial patients. This practice may have significant influence in cases with low grade pyrexia or in the elderly with hypothermia.

Malays J Med Sci. 2003 Jul;10(2):172.

Nurses Knowledge on Pressure Ulcer In Critical Care and Surgical Base Unit in Hospital Universiti Sains Malaysia

CI Zahniyah ¹, AS Halim ¹, H Noor Aini ¹

Abstract

Introduction :

Previous studies on the prevalence, incidence and nurses’ knowledge on pressure ulcers has identified that a lack of knowledge among caregivers was the primary factor that led to the development of pressure ulcers.

Objectives :

To evaluate nurses’ knowledge, perception and attitude regarding the risk factors and locations for development of pressure ulcer and a preventive strategy among nurses in Hospital Universiti Sains Malaysia (HUSM).

Methods :

One hundred and thirty six Registered Nurses in Critical Care Unit and Surgical based Unit were recruited into the study. A questionnaire consisting of 4 parts:

Demographic data
Multiple choice questions on knowledge of pressure ulcer
Open ended question on locations of pressure ulcer
Likert scale on attitude and role of nurses.

Conclusion :

The image guided surgery is a new technology where it helps surgeon to navigate through the body. This technology comes from abroad and we,despite incapable of producing one, should at least know on how to use it.(better than those who are incapable to produce but also ignorance in its technology.)
The modern and sophisticated machines emerged nowadays should encourage the thinkers and doers (not thinkers only) to produce manpower, capable of ‘producing’ rather than ‘using only’ technology.

Malays J Med Sci. 2003 Jul;10(2):173–174.

Smart Balancing for Vestibular Rehabilitation

S Sayuthi ^*, J Abdullah ^*, J Tharakan ^*, P George Jain ^*, A Prasad ^*, A Tahir ^*, SS Hassan ⁺, Z Idris ^*, ARI Ghani ^*, S Awang ^*, K Salleh ⁺, R Yaacob ⁺, Z Hussain ⁺

Abstract

Objective :

The use of a unique Smart Balancing (NeuroCom System Version 8.0.3) for balance rehabilitation in Malaysia. Report of the only centre for balance rehabilitation.

Introduction :

Physical therapy for dizziness and imbalance, also called “vestibular rehabilitation” can be accelerated by use of ‘Smart Balancing’ machine. Among he indications for vestibular rehabilitation include Benign Paroxysmal Positional Vertigo (BPPV), vestibular neuritis or acoustic neuroma, Meniere’s syndrome, post traumatic vertigo and multifactorial disequilibrum of the elderly.

Method :

Neurosains has only started the use of ‘Smart Balancing’ machine since January 2003. During this short period of time seven patients benefited from the use of the machine. They have balance disturbance due to bleeding Cerebellar AVM, Parkinson Disease, Von Hipple Lindau Syndrome, Brain stem stroke, and the rest were post traumatic vertigo secondary to motor vehicle accident. There is only one female patient and their age group range from 16 to 62 years old with average age of 38.7 years

Result :

Vestibular rehabilitation,has been used to improve gait of patients with neurological deficits.

Malays J Med Sci. 2003 Jul;10(2):174.

Magnetic Stimulation of The Central and Peripheral Nervous System – Our Experience in Neurosciences Unit

T Adnan ¹, A Saufi ¹, J Abdullah ¹, Z Idris ¹, ARI Ghani ¹, S Sayuti ¹, N Wahab ¹, D Ali ¹, K Rasamalingam ¹, J Tharakan ¹, A Prasad ¹, H Munawwir ¹, R Salmi ¹

Abstract

Introduction :

Transcranial magnetic stimulation (TMS) is a noninvasive technique to gather information about brain function. It is very useful when studying the ares of the brainrelated to motor activity (motor cortex, corticospinal tract, spinal cord and nerve roots). The procedure is conducted by transmitting a magnetic signal into the brain to stimulate an area of the body ¹.

Method :

The magnetic stimulator is connected to the standard needle electromyographic equipment. Once the stimulator releases thecharges which serve as an external trigger, this will produce a synchronized pulse which will display the motor response of a targeted muscle.

Result :

This method was successfully applied to five of our intraoperative spinal patients. It gives accurate data on compression on the spinal cord due to surgical intervention and prevention of untoward incidences.

Discussion :

Many abnormalities revealed by magnetic stimulation are not disease specific, therefore should be interpreted in the light of clinical data. This method is useful not only to diagnose neurological disorders but also an important tool for investigating normal activity of the nervous system as part of training in clinical neurophysiology.

References :

1.Stimulation of the Human Central and Peripheral Nervous System with a magnetic Stimulator, National Institute of Neurological Disorders and Stroke (NINDS)

Malays J Med Sci. 2003 Jul;10(2):174.

Analysis of Errors in Stereolithography Apparatus

Abdul Hakim Abdul Basir ⁽¹⁾, Ab Rani Samsudin ⁽¹⁾, Ibrahim Lutfi Shuaib ⁽²⁾

Abstract

Stereolithography apparatus (SLA)is a new technology in medical applications. SLA is originally used in rapid protoyping (RP) of engineering and modelling products. This technology use a laser to selectively beams and solidifies a monomer resin to eventually produce a three-dimensional (3D) SLA model. However, a very important issue in producing 3D SLA model is the accuracy obtained. We investigated errors generated during the production of 3D SLA models. The errors were mainly due to the volume-averaging effect, threshold value, and the difficulty of reproducing certain anatomical parts. We made 16 linear measurements on a dry skull, a 3D SLA model and a 3D virtual (STL) model. A comparison with other RP modalities had also been made and discussed.

Malays J Med Sci. 2003 Jul;10(2):174–175.

Comparison between Immunoblot Technique Versus Enzimmunoassay in The Detection of Antibodies to Extractable Nuclear Antigens

MD Sardi ^*, Z Ibrahim ^*, MT Mohktar ^*, M Mohammad ^*, N Kong ^**

Abstract

Objectives :

To evaluate three immunoassays for the detection of anti-ENAs.

Materials:

Serum specimens from 102 patients with systemic connective tissue diseases were tested for anti-ENAs.

Methods :

All 102 specimens were tested using an immunoblot technique (INOLIA) modified to detect antibodies to a panel of 13 ENAs simultaneously. 78 specimens were screened for anti-ENAs using a composite of 6 ENAs combined in an enzymimmunoassay (RELISA). 48 of the specimens were also specifically tested for anti-Sm/RNP, anti-SSA/Ro and anti-SSB/ La in individual enzymimmunoassays (CAPTIA-ENA).

Results :

55 out of 102 (54 %) were positive for anti-ENAs in the INOLIA assay and 54 of 78 (68 %) in the RELISA assay. The profile of anti-ENAs detected by the INOLIA assay include anti-Sm (18 ; 36 %), anti-RNP (17 ; 31 %), anti-SSA (36 ; 65 %), anti-SSB (11 ; 2 %), anti-histones (15 ; 27 %), anti-Ribosomal P (7), anti-Topo-I/Scl-70 (7), anti-Jo-1 (1) and anti-Cenp-B (1). In the individual CAPTIA assay, 11 of 48 (23%), 25 of 46 (54 %) and 3 of 46 (6 %) were positive for Sm/ RNP, SSA/Ro and SSB/La respectively.

Conclusion :

Anti-ENAs are present in systemic connective tissue diseases and can be easily detected using different types of immunoassays which show acceptable concurrence. RELISA assay maybe slightly more sensitive and suitable as a screening assay but INOLIA can test for 13 individual anti-ENAs simultaneously. The individual CAPTIA assay is useful if only one marker of interest is sought. Anti-ENAs may denote a propensity to certain subsets of systemic connective tissue disease, certain organ involvement, therapeutic outcome or poor prognosis. A further analysis in association with clinical features and other laboratory investigations should be done to determine its significance.

Malays J Med Sci. 2003 Jul;10(2):175.

Water quality and Waterborne Protozoa From Water Treatment Plants in the Klang Valley.

AGM KAMEL ¹, A NORAZAH ², J AZMI ¹, RA AHMAD ³

Abstract

Development of water supplies and sanitation systems has been a priority of many national and local governments and support agencies, as an essential step towards improving the health status of the communities they serve. However, in many developing countries outbreaks of waterborne diseases still prevail. The outbreak of cryptosporidiosis and giardiasis have led to much interest in monitoring of water for the presence of oocysts and cysts. This study demonstrated the presence of Cryptosporidium and Giardia oocysts and cysts from raw water samples from two conventional water treatment plants (Rapid Sand Filtration System), TP1 and TP2, both located in the Klang valley. Cryptosporidium and Giardia were detected in 58.3% and 41.6% of raw water samples from TP1 and 25.0% and 8.3% from TP2 respectively. Higher levels of Cryptosporidium (0.20–1.98 oocyst/l) and Giardia (0.35–0.66 cyst/ l) were detected from TP1 which received raw water directly from a nearby river. TP2, which received raw water from a dam, had lower levels of Cryptosporidium (0.36–0.52 oocyst/l) and Giardia (0.35 cyst/l). No parasites were detected from the treated water samples and this showed that both treatment plants were efficient in removing the oocysts and cysts. No significant correlation was found between the number of oocysts and cysts with coliform counts, free chlorine level, or other parameters such as temperature, pH and turbidity. Cryptosporidium and Giardia should be considered as microbial indicator for water quality as relying on coliform counts alone would give us a false sense of security on the water quality of drinking water.

Malays J Med Sci. 2003 Jul;10(2):175.

Multicenter Laboratory Evaluation of Brugia Rapid Dipstick Test for Detection of Brugian Filariasis

N Rahmah ¹, R K Shenoy ², T B Nutman ³, N Weiss ⁴, M Yazdanbakhsh ⁵, E Sartono ⁵

Abstract

Introduction :

Brugia malayi and B. timori accounts for about 13 million cases of lymphatic filariasis in Asia. Routine diagnosis of this infection is still dependent on the insensitive microscopy of night blood specimen. A gobal lymphatic filariasis elimination programme, initiated by WHO, has commenced. To ensure its success, it is crucial that accurate mapping of endemic areas at the start of the programme and accurate assessment of the elimination status at the end of the programme be achieved. Thus a sensitive and specific rapid test that obviates night blood sampling would be a highly desirable tool for both patient diagnosis and for the elimination programme.

Objective :

Brugia Rapid, a dipstick test for detection of brugian filariasis has been previously developed using a Brugia malayi recombinant antigen and anti-human IgG4 antibody conjugated with colloidal gold. This study is a second multicenter laboratory evaluation exercise to validate the sensitivity and specificity of the test

Methodology :

The dipsticks were distributed to four international laboratories i.e. T.D. Medical College (TDMC, India), National Institutes of Health (NIH, USA), Swiss Tropical Institute (STI, Switzerland) and Leiden University Medical Centre (LUMC,Netherlands). The evaluation was performed and interpreted independently by these centers using samples from each institution’s sera bank.

Results :

In comparison with microscopy, the dipstick demonstrated sensitivities of 97.2% (70/72) at TDMC, 91.6% (175/191) at LUMC and 100 % (6/6) at STI. Sera of chronic patients showed positivity rate of 11.3% (19/168) and 61.2% (71/116) at TDMC and LUMC respectively. All 266 sera of non-endemic normals from STI, NIH and LUMC tested negative with the dipstick. At LUMC, sera of ‘endemic normals’ (amicrofilaraemics with no clinical disease) from an area with ∼ 35% microfilaria positivity showed 60.8% positive results (31/51), thus demonstrating the likelihood of many cryptic infections occuring in this population. At the STI, the dipstick test demonstrated 100% specificity when tested with 75 sera from various protozoan and helminthic infections.

Conclusion :

Brugia Rapid is thus a promising tool for detection of B. malayi infection for use in patient diagnosis and in the filariasis elimination programme.

Malays J Med Sci. 2003 Jul;10(2):176.

Stereotactic Radiosurgery: One Step Forward to the Neurosurgical Management.

I Zamzuri ¹, J Abdullah ¹, P George Jain ¹, S Awang ¹, S Sayuthi ¹, ARI Ghani ¹, A Zakaria ¹, N Ruzman ¹, BM Biswal ¹

Abstract

Introduction :

Stereotactic Radiosurgery is the use of a computer guided radiation therapy system to aim highly focused beams of radiation directly into brain tumors and other abnormalities of the brain. This nonsurgical approach relies on the LINAC Scalpel, or stereotactic linear accelerator, a precision instrument that delivers high doses of radiation to specific areas within the head and brain. With this technique, all the radiation is focused directly to the area of the tumor or abnormality. Therefore, very little radiation reaches normal brain structures or tissue. Radiosurgery is ideal for treating arteriovenous malformations, acoustic neuromas, and tumors located deep within the brain. The neurosciences unit in collaboration with oncology and nuclear medical departments had started a free of charge treatment to the patients with brain pathology using stereotactic radiosurgery since 10^th of November 2001.We had treated 22 patients with this technique till month of February 2003.So far, no immediate complications arising. Most of the patients are still under regular follow up to see the progress after the treatment. The types of lesions we had treated were: 6 Cases for recurrent/residual meningiomas, 6 cases also for recurrent/residual acoustic Schwannoma, 3 cases for Arteriovenous-malformation(AVM), 3 cases for recuurent pituitary adenoma, 2 cases for recurrent and deep seated glioma, 1 case of residual spinal schwannoma and 1 case of residual Haemangioblastoma in the posterior fossa.

Discussion :

Stereotactic Radiosurgery is the preferred choice when lesions or tumors are surgically inoperable, when they have recurred or remained after surgery, and when patients are either too weak for surgery or choose not to have a major procedure under general anesthesia. Some of the disorders most commonly treated with radiosurgery include arteriovenous malformations (AVMs), acoustic neuromas, meningiomas, and malignant brain tumors.

Conclusion :

Stereotactic Radiosurgery is really a forward step to the management of previously thought inoperable or risky lesions that carry high morbidity and mortality if treated conventionally.
It is a one day treatment,where patient can walk in, get treated and walk out again to home.

Malays J Med Sci. 2003 Jul;10(2):176.

Malignant Melanoma in a Child

AR Ariff ¹, J Salmah ¹, S Magendran ¹, IL Shuaib ¹, A Shafie ¹, JM Abdullah ¹, A Zamzuri ¹

Abstract

Introduction :

Malignant melanoma is uncommon before the age of twenty. It’s manifestation is commonly associated with the cutaneous lesion. It tends to affect the fair skinned Caucasians especially Australians, New Zealanders, South Africans and Americans. Melanoma is the third common metastatic brain lesion in the west after lung and breast cancer.

Objectives :

A rare case of a 9-year- old boy with brain metastases which was confirmed as malignant melanoma.
CT-scan and MRI features of metastatic brain melanoma are highlighted

Methodology :

A 9- yr- old boy was admitted to the neuroscience ward complaining of persistent nausea and vomiting for the last one week. He also complained of headache for a month. There was no history of seizures, fever, blurring of vision or limb weakness. On clinical examinations there was no papillodema, nerve palsy, sensory deficit or motor weakness. There was neither cutaneous discolouration seen on the body nor in the throat.

Results :

An urgent CT brain of the brain was performed on 31/7/02. He underwent an urgent debulking surgery on the same day as CT-scan, to remove a part of the mass. Post operatively he developed hypotension and bradycardia. Histopathological examination revealed a melanoma. A CT – scan was repeated on 1/8/02. On 25/8/02 he was found to have a swelling on the operated wound. Hence he was sent for another CT-scan followed by an MRI which was performed on 5/9/02. Sad to say, he was discharged at the request of the parents.

Conclusion :

Malignant melanoma spreads rapidly in the brain. At times the primary lesion can be unknown.
Up to date the definite treatment for metastatic melanoma in the brain has not yet been found. Temozolomide is still under study. However it is believe that this chemo drug is more effective than DTIC (dacarbazine)

References :

1.Balch CM, Milton GW. JBA variation in the appearance of melanoma-in-situ (Clark’s level I malignant melanoma) Plast Reconstr Surg. 1994 Sep;94(3):513–7. doi: 10.1097/00006534-199409000-00014. [DOI] [PubMed] [Google Scholar]
2.Evans GR, Manson PN. Risk of cutaneous melanoma associated with a family history of the disease. The International Melanoma Analysis Group (IMAGE) Int J Cancer. 1995 Aug 9;62(4):377–81. doi: 10.1002/ijc.2910620403. [DOI] [PubMed] [Google Scholar]
3.Interferon alfa-2b adjuvant therapy of high-risk resected cutaneous melanoma: the Eastern Cooperative Oncology Group Trial EST 1684. J Clin Oncol. 1996 Jan;14(1):7–17. doi: 10.1200/JCO.1996.14.1.7. [DOI] [PubMed] [Google Scholar]

Malays J Med Sci. 2003 Jul;10(2):176–177.

Controversies in the Management of Neck in Differentiated Thyroid Cancer

Shahid Hassan ¹, Imran Abd Ghani ¹, Baharuddin Abdullah ¹

Abstract

Introduction :

The management of lymph node metastasis in differentiated thyroid cancer (DTC) has been a controversial subject. Whether it influences the prognosis? The lymph node metasis reflects host tumour relationship and together with other risk factors should be accounted for the outcome of the disease. No real evidence will be available until randomized controlled studies are carried out long natural history & lack of follow-up are the odds in deciding on the role of neck management in differentiated thyroid cancer.

Objective :

To review the literature towards achieving a consensus and adopting a policy of neck management in thyroid cancer practice of Hospital Universiti Sains Malaysia as experienced in Head & Neck setting.

Methodology :

The subject is discussed from various important aspects of lymphatic drainage of thyroid gland, incidence of metastasis, impact on prognosis and problems of surgically untreated as well as aggressively treated neck metastasis. This is to help evolve a policy of neck management in DTC Practice of Universiti Sains Malaysia.

Result & Conclusion :

Introduction :

Ocular involvement in patients undergoing hemodialysis has yet to be completely clarified and increased intraocular pressure seems to be one of the most recurrent problems. Increase in intraocular pressure (IOP) has been reportedly occurring during the course of hemodialysis.

Objective :

The aim of this study was to evaluate the intraocular pressure (IOP) changes during haemodialysis and to determine whether diabetic patients have higher IOP elevation during haemodialysis compared to nondiabetic patients.

Methodology :

A group of 32 patients (8 diabetic and 22 non-diabetic) with end-stage renal failure (ESRF) undergoing regular haemodialysis, the intraocular pressure was measured before and at hourly interval for four hours. The weight loss, the decrease systolic and diastolic blood pressure were also recorded before and after haemodialysis.

Results :

Generally, ESRF patients have fluctuation of increase IOP during haemodialysis, and showed the higher IOP at three hour of haemodialysis (4.6%). However the IOP elevation was not significant. The diabetic group showed higher IOP before and during haemodialysis compare to non-diabetic group. The IOP elevation in both groups was not significant. The different IOP rise between the two groups was not significant (p=0.67). There were no significant correlation between weight loss, decrease systolic and diastolic pressure and IOP changes.

Conclusion :

In conclusion, patients with ESRF with regular treatment at haemodialysis center at Hospital Kuala Terengganu, does not have significant IOP elevation during standard haemodialysis. Diabetic patients does not have significant IOP elevation as well as nondiabetic.

Malays J Med Sci. 2003 Jul;10(2):179–180.

The Co-application of Sprayed Cultured Autologous Keratinocytes and Modified Meek Micrograft Technique for Major Burn.

AS Halim ¹, HY Lau ¹, AA Dorai ¹, N D Omar ¹

Abstract

Introduction :

In skin grafting operations for extensive burn injuries, an alternative technique for expanding autografts has been used together with cultured autologous keratinocytes.

Case report :

A 7 years boy was admitted with a 20% full thickness burn of lower limb. Split skin grafts were performed in two sittings followed by Meek micrografting. The cell spray technique was incorporated during the Meek micrograft technique. The patient recovered well with good graft take rate and stable graft.

Discussion :

Early re-surfacing of burn wounds is ideal but is limited by the availability of skin graft donor sites. There are several approaches in managing this problem. Various technique of split skin graft expansion has been in practice. The modified Meek micrografting has been a revival to address various disadvantages of the traditional mesh grafting such as insufficient expansion and wastage of harvested skin. Cultured autologous keratinocytes on the other hand has been used to reduce the need for large donor site. However, there are known technical difficulties in the clinical use of this technique such as difficulties in handling the keratinocyte sheets. Therefore with the use of spray technique in conjunction with Meek micrografting the limitations have been addressed.

Results :

The diagnosis of supratentorial primitive neuroectodermal tumor (PNET) was made.

Conclusions :

PNETs in the supratentorial compartment are uncommon and the prognosis is poor.

Infants less than two years old at the time of diagnosis of supratentorial PNETs have a bleaker prognosis than older children.

The clinical presentation and behaviour of giant cell tumour of bone vary. The progression of the disease and metastases are unpredictable, but the overall prognosis is good. We describe the natural history and different clinical presentations of two cases of giant cell tumour of bone where the patients had refused the initial treatment and presented several years later with the disease.

Malays J Med Sci. 2003 Jul;10(2):185.

Salivary Mucus Extravasation Mucocele and Chronic Sclerosing Sialadenitis

BT Shareef ¹, KA Al-Salihi ¹, AR Samsudin ¹, A Pohchi ¹

Abstract

Objective :

To investigate the histopathological and ultra structural features of mucocele.

Introduction :

Salivary mucoceles refer to collections of mucus resulting from obstruction of, or leakage from, a major or minor salivary gland. Mucoceles occur commonly in the oral cavity, typically on the lower lip but may also in unusual locations. The mucus- extravasation type is more common than mucus-retention type and is caused by the laceration of a minor salivary gland by trauma. Chronic sclerosing sialadenitis is a chronic inflammatory response of salivary gland tissue to a wide spectrum of etiologic factors; it may occur as a consequence of mucus-extravasation mucocele.

Methodology :

Mucocele specimen was sent for routine histological and ultra Structural studies.

Results :

Clinical presentation and provisional diagnosis: An 18-yr-old Malaysian female presented with a hemispherical, fluctuant and bluish swelling (7 mm in diameter) on the lower lip. A provisional diagnosis of a mucocele was reached and a complete excision of the lesion with the associated minor salivary glands was done.

Histological presentation :

The histological examination of the specimen showed a typical appearance of a mucocele revealing a central space (lumen) containing mucus and cellular infiltration bordered by extremely fibrovascular connective tissue adjacent to the mucus. The mucus was positive with special stain (alcian blue). Within the pool of mucus, macrophages with phagocytized mucus were evident. There were also varying degrees of dilatation of the ductal system, hyperplasia of duct epithelium and periductal fibrosis within the adjacent accessory salivary gland. There were some areas showing acinar atrophy with replacement fibrosis and chronic inflammatory cell infiltration.

Ultra structural features :

Ultra structural features of mucocele revealed multiple round, membrane bound electron dense granules with varying electron density and diameter. Ductal cells with few microvilli, desmosomes and tonofilaments were prominent. There were also dilatation in the endothelium reticulum (ER) and lipid inclusions.

Conclusion :

An extravasation mucocele with chronic sclerosing sialadenitis was definitively diagnosed for this patient.

Malays J Med Sci. 2003 Jul;10(2):185–186.

Methicillin Resistant Staphyloccocus Aureus (MRSA) Septicaemia in Surgical Patient and Mortality. A Case Report

A Saufi ¹, J Abdullah ¹, J George ¹, N Wahab ¹, D Ali ¹, A Harun ¹, H Hasan ¹

Abstract

This is a case of 51 year old Malay lady with background history of hypertension and diabetes mellitus and diagnosed to have L temporoparietal meningioma. The tumor was excised and postoperatively was doing well till day two where she developed shortness of breath needing intubation. The endotracheal tube secretion grew MRSA. The site of operation became infected and swollen, needing second operation. Intraoperatively, noted to have pus collection which later grew MRSA. Soon after second operation, she progressively developed septic emboli and blisters over limbs and trunk. Blood culture also grew MRSA. IV Vancomycin was given twice weekly due to impaired renal function. No improvement,the whole body became odematous and after few weeks, she died.

Discussion :

Methicillin resistant staphylococcus aureus (MRSA) was first identified in 1961¹, the number of patients acquiring this nosocomial infection is increasing. MRSA bacteraemia has been associated with a poor prognosis.¹ French and colleagues showed, in Hong Kong, that 5 (14.8%) of 35 patients with MRSA septicaemia treated with vancomycin died.¹ The epidemiology of MRSA in Asian countries has not been as well documented as in the western countries. Nevertheless, published data available, reveals that the problem is significant in several countries including Malaysia, Singapore and Japan. In Malaysia the organism had been discovered in 1978 and was recognised as a problem in 1985. The incidence in 1985 was 18% compared to the earlier 11% in 1975.¹. Surgical patients with MRSA infection are a more debilitated and sicker. In addition, MRSA infection was seen more often in those patients who underwent a greater traumatic insult than the general surgical population admitted to the same hospital. These patients with MRSA infection stayed in hospital longer than non-MRSA infected controls. .². In conclusion, MRSA septicaemia in surgical patients can be very debilitating and has been associated with high mortality. Therefore, prevention is very important.

Reference :

1.French GL, Cheng AFB, Ling JML, Mo P, Donnan S. Hong Kong strains of methicillin-resistant and methicillin-sensitive staphylococcus aureus have similar virulence. J Hosp Infect. 1991;15:117–25. doi: 10.1016/0195-6701(90)90120-d. [DOI] [PubMed] [Google Scholar]
2.Menon* KV, Whithely* MS, Burden P, Galland* RB. *Department of Surgery and #Department of Microbiology. Royal Berkshire Hospital; Reading, U.K: [Google Scholar]

Malays J Med Sci. 2003 Jul;10(2):186.

Chromosomal Analysis of Wilms’ Tumor; Aniridia; Gonadoblastoma and Mental Retardation (WAGR) Syndrome

M Ros Sidek ¹, K Aqsoriah, RS Fatimah, MY Narazah, Salimah Tooh ², W M Wan Mohamed, Z Zubaidah ³

Abstract

Introduction :

WAGR syndrome is a rare disorder described for the first time in 1964 by Miller et al. It is caused by defects (mutations) of adjacent genes on a region of chromosome 11 (11p13). In most cases, such genetic changes (e.g., microdeletions at band 11p13) occur spontaneously during early embryonic development (de novo) for unknown reasons (sporadic) and can be manifested as a structural chromosome changes as a result of chromosome bands deletion by mean of chromosome karyotyping.

Clinically, WAGR Syndrome is defined as a genetic syndrome in which there is a predisposition to Wilms’ Tumor; Aniridia; Gonadoblastoma and abnormalities of the reproductive and urinary tracts (genitourinary); and Mental Retardation. The specific symptoms that occur depend upon the combination of disorders present.

Method :

Blood was collected from a male Malay patient, 27 months age, in sodium heparinised collection tubes. Peripheral lymphocytes culture was carried out in RPMI media, then chromosome slides were prepared after 72 hours culture. Leishman’s G-banding was utilized to screening the bands pattern of metaphase chromosomes.

Result :

G-band of the patients was 46, XY, del 11(p13), showed a deletion of one copy of chromosome 11 at band p13 (monosomy). This finding confirmed that this patient genetically as having WAGR syndrome.

[b1-mjms-10-2-103] 1.Madhavan, Nor Hayati Spectrum of thyroid diseases in hospital Universiti Sains Malaysia : a study of 300 consecutive cases. In Abstracts second national conference on medical sciences. Mal J Med Sci. 1996;3(2):58. [Google Scholar]

[b2-mjms-10-2-103] 2.Miller K. Immunocytochemical techniques. In: Bancroft JD, Stevans A, editors. Theory and practice of histological techniques. 4th edn. Sydney: Churchill Livingstone; 1996. pp. 435–470. [Google Scholar]

PERMALINK

8th. National Conference on Medical Sciences

New Insights on Genomic and Medicine

Dr Isa M Nizam

Roles

Abstract

New Insights on Genomics and Medicine

Poh San LAI

Abstract

Considerable Ethical, Social and Legal Implications in Genomic Medicine

Dr Isa M Nizam

Roles

Abstract

Molecular Analysis of Genetic Disorders for Clinical Application & Practice

Poh San LAI

Abstract

Lessons from the Molecular Biology of G6PD Deficiency

Narazah Mohd Yusoff

Abstract

Development of A Robot Surgical System

Zahari Taha

Abstract

Human-Machine Interface (HMI): An Application of Sensor Technology in Medicine

Mohd Rizal Arshad

Abstract

Concept of Disease Burden Measures

Virasakdi Chongsuvivatwong

Abstract

Global Burden of Disease: Implications on Health Policy

Syed Mohamed Aljunid

Abstract

Recent Trend in the Burden of Occupational Diseases and Injuries in Malaysia

Rusli Bin Nordin

Abstract

Effect of Albendazole on Cognitive Performance of Rural Primary School Children in Kelantan

AH Anees

A Zulkifli

MH Mohd Hashim

A Azni

N Kumaraswamy

Abstract

Objective :

Introduction :

Methodology :

Results :

Conclusion :

Characteristic Ocular Findings in Kelantanese Children with Down Syndrome

AT Liza Sharmini

BA Zilfalil

Abstract

Objective :

Introduction :

Methodology :

Results :

Conclusion :

A Comparative Study between Smokers and Non-Smokers

Agvina Bernadine Dicom

Abstract

A Study on Risk Factors of Repeated Admission among Schizophrenic Patients in Hospital Kota Bharu

SB Draman

MR Merchant

Tg Arif

M Harmy

SB Ismail

SS Jasmit Singh

Abstract

Introduction :

Objective :

Methodology :

Results :

Conclusion :

High Incidence of Metoprolol-Induced Bronchospasm Amongst Hypertensive Patients at Hospital USM and Hospital Kota Bharu.

BA Zilfalil

LK Teh

Rusli Ismail

Abstract

Introduction :

Methods :

Results :

Conclusion :

8^th. National Conference on Medical Sciences

Genetic Mutation of CYP2C192* and CYP2C193* in Malaysia

Comparison of Single Strand Conformation Polymorphism and Alleles Specific PCR Methods for Detection of CYP2D610* in Malaysian Population.

Angiotensin II Type I Receptor Gene A¹¹⁶⁶C Polymorphism; Role in Etiology of Essential Hypertension and Aortic Stiffness