A synonymous mutation in LMAN1 creates an ectopic splice donor site and causes combined deficiency of FV and FVIII

Combined deficiency of factor V and factor VIII (F5F8D) is manifested by factor V (FV) and factor VIII (FVIII) levels in the 5–30% range [1, 2]. Although the spontaneous bleeding tendency is usually mild to moderate, severe bleeding can occur after trauma or surgery [1, 2]. The molecular basis of this genetic disorder was first determined to be mutations in LMAN1 (lectin, mannose‐binding 1, also called ERGIC‐53), which encodes a protein residing in the endoplasmic reticulum (ER)‐Golgi intermediate compartment (ERGIC) [3]. F5F8D was later demonstrated to be a heterogeneous disorder [4, 5], and the second disease gene was reported in 2003 to be MCFD2 (multiple coagulation factor deficiency gene 2), a small soluble protein with EF hand domains that binds to LMAN1 in the ERGIC [6]. The LMAN1‐MCFD2 complex plays a vital role in the cargo trafficking of FV and FVIII from the ER to the Golgi complex [7, 8].

At least 33 LMAN1 and 18 MCFD2 mutations have been reported. Most mutations are null mutations resulting from insertion, deletion or splice site mutations. Patients with MCFD2 mutations tend to have lower FV and FVIII levels than patients with LMAN1 mutations, although these two groups of patients are clinically indistinguishable [2]. Only two missense mutations have been reported in LMAN1, both of which destabilize the protein [8, 9]. In contrast, 8 of the 18 reported MCFD2 mutations are missense mutations, all of which are localized to the EF hand domains [1, 2]. Biochemical experiments show that MCFD2 missense mutations abolish LMAN1 binding, indicating the importance of the LMAN1‐MCFD2 complex formation for the cargo receptor function [6, 7, 10]. To date all mutations that result in splicing defects in LMAN1 and MCFD2 are located in intronic splice junctions of the genes. We now report a novel mutation in exon 9 of LMAN1 that creates an ectopic splice donor site that displaces the natural splice donor site at the exon 9‐intron 9 junction.

The patient (B30) was a 12‐year‐old white female of US origin from a consanguineous relationship. She had a history of significant menorrhagia and epistaxis, as well as a history of chronic right hip pain. She was admitted for an arthroplasty (hip surgery) for avascular necrosis (AVN) of her right hip. The cause of the AVN is unknown. At the time of the hip surgery, she had extensive bleeding complications requiring multiple units of red blood cell transfusion for severe anemia from the bleeding. Further coagulation testing revealed low FV and FVIII levels (average of 20.7% and 26%, respectively), which confirmed a diagnosis of F5F8D.

Genomic DNA was extracted from the peripheral blood after informed consent in accordance with the Declaration of Helsinki. The study protocol was approved by the Cleveland Clinic Institutional Review Board on Human Subject Research. Sequencing of LMAN1 and MCFD2 identified no non‐synonymous mutations in exons and no variations in the intron‐exon junctions. However, Western blot analysis of Epstein‐Barr virus immortalized lymphocytes derived from this patient showed no detectable amount of LMAN1 expression (Fig. 1A). MCFD2 is also undetectable by regular Western blot analysis in LMAN1 mutant cells because it requires LMAN1 for the intracellular retention [6]. In the absence of LMAN1, MCFD2 is secreted out of the cell [10]. As expected, MCFD2 is missing from cells with a MCFD2 null mutation (Fig. 1A). Reexamination of the sequencing data revealed a homozygous single nucleotide transition (c.1083A > G) in exon 9. Although this synonymous mutation does not change the underlying amino acid residue, it could potentially create a new splice donor site (Fig. 1B). We performed a reverse transcriptase PCR (RT‐PCR) analysis of total RNA extracted from the immortalized lymphocytes, which detected a slightly smaller LMAN1 cDNA product from B30 compared with the normal control (Fig. 1C). In addition, no wild‐type cDNA was detected in the patient. Sequencing of the RT‐PCR product showed a deletion of 67 nucleotides from the 3′ end of exon 9, which correlates with the alternative splicing from the new splice donor site created by the synonymous transition to the splice acceptor site of exon 10 (Fig. 1D and Fig. S1A). The consequence of this 67 nucleotide deletion is a frameshift and the introduction of premature stop codon 9 amino acid residues later. The premature stop codon does not lead to nonsense mediated decay (NMD), because the mRNA level in B30 cells is indistinguishable from the wild‐type control cells (Fig. S1B). This is consistent with a recent report on the lack of NMD in LMAN1 mRNA with a frameshift mutation in exon 8 [11]. Even if it were stably expressed, this truncated protein is expected to be non‐functional and secreted from the cell because it lacks the transmembrane domain and the C‐terminal cytoplasmic domain that contains the ER exit and retention motifs [12].

Figure 1.

 Mutation analysis. (A) Western blot analysis of Epstein‐Barr virus immortalized B lymphocytes derived from a patient with a LMAN1 null mutation (LMAN1 ^−/−), the proband (B30), a patient with a MCFD2 null mutation (MCFD2 ^−/−), and a wild‐type control individual (WT). Antibodies used in Western blot were: monoclonal anti‐LMAN1 [16], monoclonal anti‐MCFD2 [6] and monoclonal anti‐β‐actin (Sigma). (B) Genomic DNA sequence showing a homozygous single nucleotide substitution of adenine with guanine in B30. (C) Reverse transcriptase PCR demonstrates that the cDNA of B30 is shorter than the WT cDNA. RT‐PCR was performed using the primers ggaggaatttgagcactttca (allele to sequence in exon 8) and ttttttggcagctgcttcttgct (allele to sequence in exon 13). (D) Schematic diagram shows the altered splicing pattern of exon 9 and exon 10 of LMAN1 in B30.

Donor and acceptor sites in genomic DNA are marked by the invariant dinucleotides GT and AG, respectively, in introns immediately adjacent to exons. However, the strengths of splice sites are determined by additional nucleotide sequences at the exon‐intron junction [13]. In fact, the most common mutation in MCFD2, c.149 + 5G > A, changes the fifth nucleotide in the donor splice site and completely destroys the normal splicing [6]. To understand the reason why a single nucleotide substitution in exon 9 leads to near complete switch of the natural splice donor site to the one created by the mutation, we used the BDGP splicing predictor program (http://www.fruitfly.org/seq_tools/splice.html) to analyze the strengths of all splice donor and acceptor sites in the LMAN1 gene. This program assigns scores based on the strengths of splice sites, with 1 being the maximum strength. The analysis showed three weak splice sites in LMAN1 (scores < 0.4): the donor sites of exon 1 and exon 9 and the acceptor site of exon 8 (Table S1). The acceptor site of exon 8 is particularly weak (score < 0.1), which suggests that intronic and exonic splice enhancers are essential for the usage of this site. This could explain a previously reported case of exon 8 skipping [9]. In that particular case no mutations were found in exons or exon‐intron junctions. Instead, a four nucleotide insertion was identified in intron 7 (c.822 + 33–34 insGGTT), which may disrupt an intronic splice enhancer site that results in no usage of the endogenous splice acceptor site of exon 8. Remarkably, the new splice donor site (AAG/GTATGT, where / indicates the exon‐intron boundary) created by the c.1083A > G mutation has a strength score of 1. As a consequence, the natural splice donor site for exon 9 is bypassed completely (Fig. 1D).

With the decreasing costs and the increasing utilization of the whole genome sequencing, it is critical to properly ascertain the potential functional consequences of single nucleotide polymorphisms (SNPs). Our results suggest that if an exonic SNP can potentially create a new splice site, it is important to gauge its strength relative to the nearby endogenous splice sites. Interestingly, Zucker et al. [14] recently reported multiple cases of missense mutations that cause partial splice defects in FXI deficiency due to disruption of exonic splicing enhancers. These splicing mutations all happen in exons with weak splice acceptor sites. Exonic mutations that affect pre‐mRNA splicing have been reported in a number of other genes [13, 15]. Ultimately, a definitive answer on the effect of a new splice site created by an exonic SNP on RNA splicing requires the analysis of the mRNA in question.

Disclosure of Conflict of Interests

The authors state that they have no conflict of interest.

Supporting information

Figure S1. (A) cDNA sequences of patient B30 and a wild‐type control individual near the exon 9 and exon 10 junction.

Table S1. Strengths of splice donor and acceptor sites in all exons of LMAN1.

Supporting info item

Supporting info item