Skip to main content
Investigative Ophthalmology & Visual Science logoLink to Investigative Ophthalmology & Visual Science
. 2013 Feb 5;54(2):987–998. doi: 10.1167/iovs.12-10992

Influence of Aromatase Absence on the Gene Expression and Histology of the Mouse Meibomian Gland

Raheleh Rahimi Darabad 1,2, Tomo Suzuki 1,2, Stephen M Richards 1,2, Roderick V Jensen 3, Frederick A Jakobiec 2,4, Fouad R Zakka 2,4, Shaohui Liu 1,2, David A Sullivan 1,2,4
PMCID: PMC3565996  PMID: 23233261

Abstract

Purpose.

We hypothesize that aromatase, an enzyme that controls estrogen biosynthesis, plays a major role in the sex-related differences of the meibomian gland. To begin to test this hypothesis, we examined the influence of aromatase absence, which completely eliminates estrogen production, on glandular gene expression and histology in male and female mice.

Methods.

Meibomian glands were obtained from adult, age-matched wild-type (WT) and aromatase knockout (ArKO) mice. Tissues were processed for histology or the isolation of total RNA, which was analyzed for differentially expressed mRNAs by using microarrays.

Results.

Our results show that aromatase significantly influences the expression of more than a thousand genes in the meibomian gland. The nature of this effect is primarily sex-dependent. In addition, the influence of aromatase on sex-related differences in gene expression is predominantly genotype-specific. However, many of the sex-related variations in biological process, molecular function, and cellular component ontologies, as well as in KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways, are remarkably similar between WT and ArKO mice. The loss of aromatase activity has no obvious effect on the histology of meibomian glands in male or female mice.

Conclusions.

Our findings demonstrate that aromatase has a significant impact on gene expression in the meibomian gland. The nature of this influence is sex-dependent and genotype-specific; however, many of the sex-related variations in gene ontologies and KEGG pathways are similar between WT and ArKO mice. Consequently, it appears that aromatase, and by extension estrogen, do not play a major role in the sex-related differences of the mouse meibomian gland.


Aromatase exerts a significant sex- and genotype-specific effect on meibomian gland gene expression. However, this enzyme, and by extension estrogen, do not play a major role in the sex-related differences in this tissue.

Introduction

Sex steroids exert a significant impact on the meibomian gland.1–3 These hormones regulate glandular function, modulate the quality and/or quantity of lipids produced by this tissue, and influence the formation of the tear film's lipid layer.1–3 Sex steroids may also prevent (e.g., androgens) or promote (e.g., estrogens) meibomian gland dysfunction (MGD) and evaporative dry eye disease.1–3

Of particular interest, the differential action of sex steroids, as with other sebaceous glands,4,5 may contribute to the sex-related differences known to exist in the morphology, gene expression, neutral and polar lipid patterns, and secretory output of the meibomian gland.2,6–17 Consistent with this proposal is the observation that androgens appear to mediate almost 30% of the sex-associated variations in gene expression of the mouse meibomian gland.7

It is quite possible that sex-specific aromatase activities may also play a role in the sex-related differences of the meibomian gland. Aromatase is a cytochrome P450 enzyme that catalyzes the formation of estrogens from androgens,18–20 and contributes to a number of sex-specific differences throughout the body.21–25 This steroidogenic enzyme is present in numerous tissues,18-20 including the meibomian gland.26 In the absence of aromatase, the synthesis of estrogens is completely eliminated.27–29

We hypothesize that aromatase, through its control of estrogen biosynthesis, is a critical factor in the sex-related differences of the meibomian gland. To begin to test this hypothesis, we examined the effect of aromatase absence on gene expression in male and female meibomian glands. We also explored the impact of aromatase loss on tissue morphology. These studies were made possible by our use of aromatase knockout (ArKO) mice, which were generated by the targeted disruption of exon IX in the cyp19 gene and produce no estrogen.30 In addition, we used both Affymetrix and CodeLink microarrays in these studies, because these platforms have different gene identification capabilities.31–35 The use of different microarrays to analyze the same samples has been proposed to provide a more meaningful transcriptome assessment.33

Materials and Methods

Animals and Tissue Collections

Breeding pairs of C57BL/6J ArKO heterozygous mice were obtained from Dr Orhan Oz (University of Texas Southwestern Medical Center, Dallas, TX). Animals were shipped to Charles River Breeding Laboratories (Wilmington, MA) for initial quarantine, health monitoring, and serology, and then forwarded to the Animal Facilities of the Schepens Eye Research Institute (Boston, MA). Mice were housed and bred in constant-temperature rooms with fixed light/dark intervals of 12 hours' duration. Offspring were genotyped according to a published protocol.30 In brief, genomic DNA was isolated from tails by using a GenElute Mammalian Genomic DNA Miniprep Kit (Sigma-Aldrich, St. Louis, MO). The DNA was amplified by PCR with a Hybaid OMN-E thermocycler (Thermo Electron Corp, Burlington, Ontario, Canada) by using exon IX gene primers (forward: GTGACAGAGACATAAAGATCG; reverse: GTAAATTCATTGGGCTTAGGG) and neo gene primers (forward: ATCAGGATGATCTGGACGAAGA; reverse: CCACAGTCGATGAATCCAGAA). The PCR conditions were 1 cycle (3 minutes at 94°C), 35 cycles (40 seconds at 94°C, 30 seconds at 55°C, 45 seconds at 72°C) and 1 cycle (5 minutes at 72°C) and amplicons were evaluated on 2.5% agarose gels. Band sizes were 220 bp from wild-type (WT) mice, 170 bp from ArKO mice, and both fragments from heterozygotes.

When indicated, mice were killed by CO2 inhalation and either meibomian glands were removed for molecular biological procedures, or lids and globes were obtained for histology. For molecular studies, the meibomian glands were excised from the upper and lower lids under direct visualization with a biomicroscope. This surgical method involved making a small incision near the inner corner of the eyelid, separating skin and subcutaneous tissue from the inner to outer aspect of the lid, and then removing skin from the meibomian glands by cutting at the mucocutaneous junction. After these steps, the palpebral conjunctiva was removed from the meibomian glands, and the glands were dissected from the remaining tissue by starting at the outer lid corner and carefully avoiding an adjacent vein. Glandular samples were prepared by combining tissues from 5 mice/sex/group. Three such pooled sample preparations were made for each tissue/sex/group and then processed for RNA analysis.

For histological analyses, tissues were fixed in 10% buffered formalin, dehydrated, embedded in methacrylate, cut into 3-μm sections, and stained with hematoxylin and eosin or with periodic acid-Schiff, according to previously described techniques.36 Sections were obtained from different tissue areas, all separated by minimal distances of at least 30 μm. Slides were observed with an Olympus BH-2 light microscope (Olympus, Center Valley, PA) and micrographs were taken with a Nikon Eclipse E800 (Nikon, Tokyo, Japan) and SPOT camera (MicroVideo Instruments, Inc., Avon, MA).

All studies with mice were approved by the Institutional Animal Care and Use Committee of The Schepens Eye Research Institute and adhered to the Association for Research in Vision and Ophthalmology Statement for the Use of Animals in Ophthalmic and Vision Research.

Molecular Biological Procedures

Total RNA was extracted from tissues by using TRIzol reagent (Invitrogen Corp., Carlsbad, CA) and further purified with RNAqueous spin columns (Ambion, Austin, TX). Glandular RNA samples were treated with RNase-free DNase (Invitrogen), analyzed spectrophotometrically at 260 nm to determine concentration and examined with a RNA 6000 Nano LabChip (Agilent Technologies, Palo Alto, CA) and an Agilent 2100 Bioanalyzer (Agilent Technologies) to confirm RNA integrity. The RNA samples were then stored at −80°C until processed by using two different procedures.

The first procedure to evaluate gene expression involved the use of CodeLink UniSet Mouse 20K I Bioarrays (n ∼ 20,000 genes/array; Amersham Biosciences/GE Healthcare, Piscataway, NJ). The RNA samples were processed for CodeLink Bioarray hybridization, according to published procedures.37 Briefly, cDNA was synthesized from RNA (2 μg) with a CodeLink Expression Assay Reagent Kit (Amersham) and then purified with a QIAquick purification kit (Qiagen, Valencia, CA). Samples were dried, and cRNA was produced with a CodeLink Expression Assay Reagent Kit (Amersham), recovered with an RNeasy kit (Qiagen) and quantified with an UV spectrophotometer. Fragmented and biotin-labeled cRNA was incubated and shaken (300 rpm shaker) on a CodeLink Bioarray at 37°C for 18 hours. Following this time period, the Bioarray was washed, exposed to streptavidin-Alexa 647, and scanned by using ScanArray Express software and a ScanArray Express HT scanner (Packard BioScience, Meriden, CT) with the laser set at 635 nm, laser power at 100%, and photomultiplier tube voltage at 60%. Scanned image files were evaluated by utilizing CodeLink image and data analysis software (Amersham), which yielded both raw and normalized hybridization signal intensities for each array spot. The intensities of the ∼20,000 spots on the Bioarray image were standardized to a median of 1. Normalized data, with signal intensities exceeding 0.50, were analyzed with sophisticated software (Geospiza, Seattle, WA). This comprehensive software also generated gene ontology and z score reports. These ontologies covered biological processes, molecular functions, and cellular components and were organized according to the guidelines of the Gene Ontology Consortium (http://www.geneontology.org/GO.doc.html).38

The second procedure to evaluate, and in part to verify, the differential expression of various mRNAs, involved the hybridization of each cRNA (20 μg) sample to a GeneChip Mouse Genome 430A 2.0 Array (Affymetrix, Santa Clara, CA) according to the manufacturer's protocol. Hybridized GeneChips were scanned with an Affymetrix Model 700 Scanner and expression data files were produced from array images using Affymetrix Microarray Suite 4.0 software. GeneChip data were standardized by selecting the default scaling in Affymetrix GeneChip Operating Software, which generates a trimmed mean intensity of 500 for each GeneChip microarray. Normalized data with a quality value of 1.0 were then analyzed with GeneSifter software.

Gene expression data were assessed without log transformation, and statistical analysis of these data was performed with Student's t-test (two-tailed, unpaired) by using GeneSifter software. Our statistical analyses were not tailored for multiple comparisons. Genes that were expressed in analogous directions in different groups were identified by using “Gene ID” accession numbers and an intersector program (Geospiza; www.public.genesifter.net). Data from the individual CodeLink and Affymetrix arrays are freely accessible for download through the National Center for Biotechnology Information's Gene Expression Omnibus (http://www.genesifter.net/web/dataCenter.html) via series accession number GSE5878.

Results

Effect of Aromatase Absence on Gene Expression in Male and Female Meibomian Glands

To determine the effect of aromatase absence on gene expression in the meibomian gland, tissues were obtained from adult, age-matched male and female WT (male = 159 ± 6 days; female = 150 ± 7 days) and ArKO (male = 151 ± 7 days; female = 152 ± 8 days) mice (n = 5/sex/group; n = 3 separate experiments). Glands were pooled according to sex and group, processed for the isolation of total RNA, and analyzed for differentially expressed mRNAs by using CodeLink Bioarrays and Affymetrix GeneChips. Microarray data were evaluated with Geospiza bioinformatics software.

Our results demonstrate that aromatase significantly influences gene expression in the meibomian gland. As shown in Tables 1 and 2, both aromatase presence (i.e., WT) and absence (i.e., ArKO) are associated with a significant up- and downregulation of more than a thousand genes. Genes with the greatest expression differences in terms of ratios included those increased in female WT (Affymetrix [A]: phosphopantothenoylcysteine decarboxylase, 6.5↑; CodeLink [C]: secreted frizzled-related protein 2, 12.2↑) and ArKO (A: hydroxymethylbilane synthase, 4.6↑; C: palladin, cytoskeletal-associated protein, 2.3↑), as well as in male WT (A: phosphopantothenoylcysteine decarboxylase, 5.9↑; C: Crystallin, α B, 3.2↑) and ArKO (A: β defensin 8, 14.6↑; C: tryptophan 2,3-dioxygenase, 1.97↑) meibomian glands.

Table 1. .

Influence of Aromatase Absence on Gene Expression in the Female and Male Mouse Meibomian Gland

Group
Microarray
Genes
WT > ArKO
ArKO > WT
Total
Female Affymetrix 783 950 1733
CodeLink 719 254 973
Male Affymetrix 856 388 1244
CodeLink 483 321 804
Male + Female Affymetrix 837 872 1709
CodeLink 435 220 655

The expression of listed genes was significantly (P < 0.05) upregulated between the comparative groups.

Table 2. .

Influence of Aromatase on Gene Expression Ratios in the Mouse Meibomian Gland

Accession No.
Gene
Ratio
P value
Ontology
F, WT > ArKO
 NM_031188 Major urinary protein 1 3.89 0.0073 Pheromone binding
 NM_022984 Resistin 2.89 0.0145 Response to insulin stimulus
 NM_134066 Aldo-keto reductase family 1, member C18 2.68 0.0046 Progesterone catabolic process
 BM230253 Centromere protein N 2.48 0.0499 Chromosome, centromeric region
 NM_054077 Proline arginine-rich end leucine-rich repeat 1.96 0.0453 Cell aging
 NM_013459 Complement factor D (adipsin) 1.96 0.0301 Proteolysis
F, ArKO > WT
 BB000512 Hydroxymethylbilane synthase 4.62 0.0021 Porphyrin biosynthetic process
 BB490338 Calponin 3, acidic 4.59 0.0002 Actomyosin structure organization
 AI019214 Transcription elongation factor B, polypeptide 1 4.44 0.0240 Transcription, DNA-dependent
 BC002148 Fatty acid binding protein 4, adipocyte 4.33 0.0221 Cytokine production
 AK018666 Cysteine-rich repeat-containing protein CRIM1 3.78 0.0406 Regulation of cell growth
 AK014590 Kinesin family member 5B 3.53 0.0163 Mitochondrial transport
M, WT > ArKO
 BB329391 Phosphopantothenoylcysteine decarboxylase 5.91 0.0002 Coenzyme A biosynthetic process
 C77434 Lanosterol synthase 5.16 0.0283 Steroid biosynthetic process
 BM115860 Mortality factor 4 like 1 3.87 0.0026 Double-strand break repair via homologous recombination
 C85064 V-ATPase E2 subunit 3.74 0.0090 ATP catabolic process
 AJ002522 Myosin heavy chain 2X, partial 3.09 0.0110 Muscle myosin complex
 BG141806 Ribosomal protein L27a 2.91 0.0267 Translation
M, ArKO > WT
 AJ300674 βdefensin 8 14.57 0.0107 Defense response
 AF425084 Serine (or cysteine) peptidase inhibitor, clade B, member 6c 3.14 0.0030 Negative regulation of endopeptidase activity
 AV006000 Rho GTPase activating protein 5 2.31 0.0456 Positive regulation of mesenchymal cell proliferation
 BC003267 cDNA sequence BC003267 2.16 0.0235 Metal ion binding
 NM_011726 X-linked lymphocyte-regulated 3A 2.02 0.0029 Biological process
 Z67747 Zinc finger protein 62, transcript variant 1 1.88 0.0363 Transcription, DNA-dependent

Relative ratios were calculated from Affymetrix data by comparing the degree of gene expression in meibomian glands from male (M), female (F), WT, and ArKO groups. Genes listed had a signal intensity of ≥ 100 in at least one group, a comparative P value (between treatments) of < 0.05 and a known identity.

As anticipated, many genes identified as differentially expressed by the Affymetrix and CodeLink arrays were unique to each platform (Table 3). For example, Affymetrix (ratio ≥ 1.80, signal intensity ≥ 500 in at least one group) and CodeLink (ratio ≥ 1.80, signal intensity ≥ 5 in at least one group) platforms identified 72 and 8 genes, respectively, that showed significant differences between female WT and ArKO meibomian glands. Of these genes, only one, small proline-rich protein 2A (ArKO, 2.1-fold↑), was the same in both platforms. Similarly, if all male and female platform-specific data were combined, then only 2 genes, with ratios and intensity thresholds as above, were similar in Affymetrix and CodeLink platforms. These genes were adipsin (WT, 2.0- and 1.9-fold↑) and resistin (WT, 2.7- and 1.9-fold↑). Our findings are consistent with other investigations, which report little agreement between Affymetrix and CodeLink arrays in the detection of differential gene expression.31–34,39 However, although these arrays appear to measure different things,33 most gene expression changes revealed by each of the platforms are believed to be biologically correct.32,33 Given that all our data from the Affymetrix and CodeLink arrays are available in GEO (series number), we will focus predominantly on the Affymetrix data in this Results section.

Table 3. .

Differences between Affymetrix and CodeLink Platforms in the Identification of Differentially Expressed Genes in WT and ArKO Meibomian Glands

Platform
Database Genes
Genes with Ratio ≥ 1.8
Same Response in Other Array
Affymetrix
 F, WT vs ArKO 6112 197 10
 M, WT vs ArKO 6273 64 1
CodeLink
 F, WT vs ArKO 4969 18 1
 M, WT vs ArKO 4946 2 1

Database genes are the number of genes in Affymetrix and CodeLink platforms with signal intensities ≥ 500 and ≥ 5 units, respectively. These threshold intensities, which occur in regions of minimal variation on scatter plots (data not shown), include approximately 40% of the total genes (range: 12,564 to 14,536) detected with the Affymetrix (intensity range: 2.8 to 25,650 units) and CodeLink (intensity range: 0.01 to 1,127 units) arrays. Genes with Ratio ≥ 1.8: total number of genes significantly up- and downregulated by ≥ 1.8-fold on the designated platform; Same Response as in Other Array: number of genes from the “Ratio” column that responded in the same way in the database of the other platform.

The nature of the aromatase impact on meibomian gland gene expression is sex-dependent. As demonstrated by analyses of both Affymetrix and CodeLink data, fewer than 5% of the genes significantly influenced by aromatase were the same in males and females (Table 4). In other words, more than 95% of the aromatase-linked genes are sex-specific.

Table 4. .

Comparative Influence of Aromatase and Sex on Gene Expression in the Mouse Meibomian Gland

Microarray
Comparison 1
Comparison 2
Total Genes
Common Genes
Common/Total (%)
Affy F, WT > ArKO M, WT > ArKO 1540 75 4.9
CL F, WT > ArKO M, WT > ArKO 1167 35 3.0
Affy F, ArKO > WT M, ArKO > WT 1269 51 4.0
CL F, ArKO > WT M, ArKO > WT 562 11 2.0
Affy WT, M > F ArKO, M > F 2526 508 20.1
CL WT, M > F ArKO, M > F 1818 408 22.4
Affy WT, F > M ArKO, F > M 1624 174 10.7
CL WT, F > M ArKO, F > M 2415 320 13.3

Following analyses of Affymetrix (Affy) and CodeLink (CL) data, common genes were identified by using the Geospiza Intersector program. The expressions of genes in the “Total” column were significantly (P < 0.05) upregulated in the designated comparison groups.

The absence of aromatase exerted a significant effect on numerous biological processes, molecular functions, and cellular components. As shown by z score analyses, this enzyme deficiency stimulated the expression of male and female genes related to actin binding and non–membrane-bounded organelles, and suppressed genes associated with catalytic activity and protein transport (Table 5). Aromatase absence also influenced many KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways (e.g., ArKO, pentose phosphate pathway, 2.2–3.8↑ in male and female). Of particular interest, most of the affected ontologies and KEGG pathways were sex-dependent (Table 6). For example, analysis of Affymetrix data identified 185 and 85 biological process ontologies (≥30 genes/ontology) that were significantly altered in meibomian glands of females and males, respectively. However, only 22 of these ontologies were the same in each sex. Similarly, evaluation of CodeLink data demonstrated that almost all ontologies (≥20 or 30 genes/ontology) influenced by aromatase absence were different in meibomian glands of females and males (data not shown).

Table 5. .

Similar Gene Ontologies Influenced by Aromatase Absence in Female and Male Meibomian Glands

Ontology
WT Genes ↑
ArKO
Genes ↑
WT z Score
ArKO
z Score
Cytoplasm 431, 436 445, 188 7.54, 4.82 2.91, 1.60
Cellular metabolic process 372, 380 380, 168 4.54, 3.03 0.66, 1.18
Catalytic activity 258, 259 233, 110 4.43, 2.40 −0.9, 0.58
Ligase activity 33, 28 21, 13 4.25, 2.37 0.37, 1.65
ATP binding 80, 93 77, 33 3.1, 3.83 1.1, 0.68
Intracellular transport 53, 49 56, 25 3.82, 2.5 3.07, 2.28
Intracellular organelle lumen 101, 114 104, 41 3.32, 3.76 1.62, 0.43
Protein transport 63, 59 60, 30 3.54, 2.25 1.71, 2.13
DNA metabolic process 41, 38 34, 15 3.18, 2.05 0.73, 0.63
Neurological system process 19, 27 32, 15 −3.34, −2.42 −2.12, −1.02
Actin binding 15, 22 30, 12 0.45, 1.91 3.71, 2.03
Non–membrane-bounded organelle 115, 121 153, 64 1.99, 1.42 3.7, 2.15
Cellular macromolecular complex subunit organization 20, 28 33, 19 0.29, 1.79 2.43, 3.23
Cellular macromolecular complex assembly 17, 25 29, 18 0.1, 1.74 2.24, 3.47
Cation transmembrane transporter activity 13, 23 13, 4 −1.68, 0.11 −2.34, −2.02

Specific biological process, molecular function, and cellular component ontologies, with some of the highest and lowest z scores, were chosen following the analysis of nontransformed data. A z score is a statistical rating of the relative expression of genes, and shows how much they are over- or underrepresented in a given gene list.70 Positive z scores represent a greater number of genes meeting the criterion than is expected by chance, whereas negative z scores represent fewer genes meeting the criterion than expected by chance.70 The z scores with values >2.0 or less than −2.0 are significant and are highlighted in bold print. Criteria for inclusion in this table were an ontology containing ≥27 genes, a z score >2.0 or less than −2.0, and similar responses in both female and male meibomian glands. The first number in each column was from female tissues, and the second from male tissues.

WT Genes ↑, number of genes upregulated in WT tissues; ArKO Genes ↑, number of genes upregulated in ArKO tissues; z Score, specific score for the upregulated genes in the WT and ArKO tissues.

Table 6. .

Different Gene Ontologies Influenced by Aromatase Absence in Female and Male Meibomian Glands

Ontology
WT Genes ↑
ArKO
Genes ↑
WT z Score
ArKO
z Score
Female
 Coenzyme metabolic process 23 13 5.05 0.92
 Catabolic process 113 103 4.97 1.9
 mRNA binding 13 7 4.42 0.95
 Posttranscriptional regulation of gene expression 26 18 4.37 1.22
 Lyase activity 18 10 4.13 0.51
 Cellular ketone metabolic process 52 34 4.01 −0.4
 Organelle membrane 80 48 3.98 −2.12
 Mitochondrial part 44 30 3.92 −0.07
 Integral to membrane 134 174 −2.89 −2.11
 Molecular transducer activity 36 76 −4.19 −0.49
 Receptor activity 25 61 −4.46 −0.69
 Extracellular region 35 79 −4.7 −0.84
 Cellular component organization or biogenesis 153 205 1.67 4.12
 Cytoskeletal protein binding 26 45 0.75 3.74
 Glycosaminoglycan binding 5 17 −0.57 3.57
 Immune response 14 51 −2.65 3.56
 Protein binding 264 337 1.29 3.35
 Protein targeting 17 26 1.33 3.08
 Basolateral plasma membrane 10 23 −0.15 3.05
 Response to chemical stimulus 62 116 −1.86 2.95
 Cytoskeleton 63 91 0.78 2.83
Male
 Cellular component organization or biogenesis 188 72 3.91 0.56
 Protein modification process 129 41 3.81 −0.5
 Regulation of protein kinase activity 34 5 3.62 −1.3
 Protein kinase activity 44 7 3.54 −1.53
 Intracellular signal transduction 95 32 3.5 0.08
 Enzyme binding 63 24 3.38 1.1
 Cell junction 46 11 3.31 −0.71
 Nuclear lumen 96 38 3.25 0.94
 Protein complex binding 30 8 2.6 −0.26
 Extracellular region 55 24 −2.97 −2.27
 RNA binding 33 28 −0.13 3.32
 Cellular component assembly at cellular level 42 26 1.57 2.8
 Cation binding 149 86 0.28 2.66
 Golgi apparatus 53 31 1.25 2.29
 Endomembrane system 42 27 0.56 2.21
 Hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides 34 22 0.57 2.15
 Ion transport 40 11 −0.35 −2.01
 Plasma membrane 168 54 1.14 −2.48
 Signal transducer activity 70 20 −0.67 −2.64
 Transporter activity 45 10 −0.51 −2.7
 Cellular response to stimulus 206 65 1.38 −2.89

Specific biological process, molecular function, and cellular component ontologies, with some of the highest and lowest z scores, were selected following the analysis of nontransformed data. Criteria for inclusion in this table were an ontology containing ≥ 20 genes, a z score >2.0 or less than −2.0 (in bold print), and different responses in female and male meibomian glands.

For those ontologies that were the same in males and females, most of the genes were also different. For instance, in the protein transport ontology, the expressions of 123 and 89 genes were significantly influenced in females and males, but only 5 of the genes were the same between sexes. Another example was the cellular macromolecular complex assembly ontology, in which 46 genes were significantly affected in the female, and 43 in the male, but only 1 gene was the same in both sexes.

The ontologies (≥20–30 genes/ontology) identified by the Affymetrix and CodeLink arrays, were, for the most part, unique to the specific platform (data not shown). In those instances in which ontologies overlapped, the inherent gene populations were commonly different between the arrays (Table 7).

Table 7. .

Differences in Ontology Gene Profiles Identified with Affymetrix and CodeLink arrays

Comparison
Ontology
Genes – Affy
Genes – CL
Same – Affy + CL
WT > ArKO Posttranscriptional regulation of gene expression 34 11 3
WT > ArKO Transferase activity, transferring acyl groups 34 10 1
ArKO > WT Mitotic cell cycle 63 20 3
ArKO > WT Proteasome 13 4 1
M > F RNA splicing 150 91 43
M > F Helicase activity 33 16 8
F > M Chemotaxis 56 73 22
F > M Polysaccharide binding 39 41 16

The comparison groups include genes from WT (male plus female), ArKO (male plus female), male (M, WT plus ArKO), and female (F, WT plus ArKO) mice. The first group in each comparison had a significantly increased z score for the given ontology. The ontologies are from biological processes, molecular functions, and cellular components categories. The “Genes – Affy” and “Genes – CL” columns reflect the number of genes, identified by the Affymetrix and CodeLink microarrays, that were significantly up- and downregulated in each ontology. The “Same – Affy + CL” column represents the number of genes that show the same pattern of response in both Affymetrix and CodeLink platforms.

Overall, our data show that aromatase significantly influences gene expression in the meibomian gland. The nature of this effect, though, is predominantly sex-dependent.

Influence of Aromatase Absence on Sex-Related Differences in Meibomian Gland Gene Expression

To determine whether aromatase absence influences sex-related differences in meibomian gland gene expression, we identified the female and male gene profiles of WT and ArKO meibomian glands and then compared the sex-associated patterns of WT and ArKO mice.

Our findings show that sex significantly influences the expression of thousands of genes in WT and ArKO meibomian glands (Table 8). Genes linked to X and Y chromosomes demonstrated the greatest differences in terms of ratios (Table 9), but more than 96.6% of the affected genes were linked to other chromosomes (data not shown). In addition, as we discovered during our WT and ArKO comparisons (above), most genes found to be differentially expressed between males and females were platform-specific (Table 10). Thus, Affymetrix and CodeLink arrays both revealed significant sex-related differences in the expression of meibomian gland gene populations, but the gene identities were most often unique to the platform (Table 10).

Table 8. .

Impact of Aromatase Absence on Sex-Related Gene Expression in the Mouse Meibomian Gland

Group
Microarray
Genes
M > F
F > M
Total
WT Affymetrix 1844 861 2705
CodeLink 1014 1399 2413
ArKO Affymetrix 1271 968 2239
CodeLink 1216 1458 2674
WT + ArKO Affymetrix 2371 1261 3632
CodeLink 1766 2398 4164

The expression of listed genes was significantly (P < 0.05) upregulated between the comparative groups.

Table 9. .

Effect of Aromatase on Sex-Related Differences in Gene Expression in Meibomian Glands

Accession No.
Gene
Ratio
P Value
Ontology
WT, M > F
 BB667072 DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked 335.89 0.0009 ATP catabolic process
 NM_012011 Eukaryotic translation initiation factor 2, subunit 3, structural gene Y-linked 185.55 0.0020 GTP catabolic process
 AF127244 Smcy 23.65 0.0003 Chromatin modification
 BB742957 Ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome 20.08 0.0067 Chromatin modification
 BF537798 Metastasis-associated lung adenocarcinoma transcript 1 5.16 0.0261 Biological process
 BE197934 Keratin 14 5.07 0.0011 Epithelial cell differentiation
WT, F > M
 L04961 Xist (X inactive specific transcript) 202.1 0.0073 Dosage compensation, by inactivation of X chromosome
 BG806300 Domesticus antisense RNA from the Xist locus, complete sequence 113.26 0.0094 Dosage compensation, by inactivation of X chromosome
 NM_031188 Major urinary protein 1 4.2 0.0064 Pheromone binding
 NM_007753 Carboxypeptidase A3, mast cell 2.64 0.0004 Proteolysis
 NM_134072 Aldo-keto reductase family 1, member C14 2.63 0.0006 Metabolic process
 BC009165 Thyroid hormone responsive SPOT14 homolog 2.32 0.0020 Transcription, DNA-dependent
ArKO, M > F
 BB667072 DEAD (Asp-Glu-Ala-Asp) box polypeptide 3, Y-linked 384.4 0.0004 ATP catabolic process
 NM_012011 Eukaryotic translation initiation factor 2, subunit 3, structural gene Y-linked 225.87 0.0002 GTP catabolic process
 BB742957 Ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome 118.68 0.0011 Chromatin modification
 AJ300674 β-defensin 8 68.91 0.0086 Defense response
 AF127244 Smcy 14.25 0.0000 Chromatin modification
 BE197934 Keratin 14 3.83 0.0092 Epithelial cell differentiation
ArKO, F > M
 L04961 Xist (X inactive specific transcript) mRNA for open reading frame 273.5 0.0001 Dosage compensation, by inactivation of X chromosome
 BG806300 Domesticus antisense RNA from the Xist locus, complete sequence 108.04 0.0000 Dosage compensation, by inactivation of X chromosome
 NM_007894 Eosinophil-associated, ribonuclease A family, member 1 3.69 0.0075 Nucleic acid binding
 BC026054 Neuronal pentraxin 2 2.82 0.0053 Sugar binding
 BB031119 Src-like adaptor 2.71 0.0108 Protein binding
 BE994609 Myelin basic protein 2.68 0.0171 Myelination

Ratios were calculated from Affymetrix data by comparing the degree of gene expression in meibomian glands from M, F, WT, and ArKO groups. The genes listed had a signal intensity of ≥100 in at least one group, a comparative P value (between treatments) of <0.05, and a known identity.

Table 10. .

Differences between Affymetrix and CodeLink Platforms in the Identification of Sex-Related Differences in Gene Expression of WT and ArKO Meibomian Glands

Platform
Database Genes
Genes with Ratio ≥ 1.8
Same Response as in Other Array
Affymetrix
 WT, F vs M 6263 366 20
 ArKO, F vs M 6221 290 26
CodeLink
 WT, F vs M 5093 331 22
 ArKO, F vs M 5022 233 23

Database genes are the number of genes in Affymetrix and CodeLink arrays with signal intensities ≥500 and ≥5 units, respectively. These threshold intensities include about 40% of the total genes (range: 12,717 to 14,486) detected with the Affymetrix (intensity range: 1.03 to 20,266 units) and CodeLink (intensity range: 0.02 to 980.3 units) platforms. Genes with ratio ≥1.8 are the total number of genes significantly up- and downregulated by ≥1.8-fold on the designated platform. Same Response as in Other Array, number of genes from the “Ratio” column that responded in the same way in the database of the other platform.

The effect of aromatase absence on sex-related differences in gene expression was genotype-specific. As detailed in Table 4, between 78% and 80% of the genes expressed more highly in the male, as compared with female, meibomian glands were different between WT and ArKO mice. Similarly, between 87% and 89% of those genes upregulated in females, relative to males, were different between WT and ArKO mice.

However, despite these specific gene differences, many, although not all, sex-related variations in ontology categories were remarkably similar between WT and ArKO mice (Table 11). The 17 highest z scores of biological process ontologies (Affymetrix, ≥30 genes/ontology) in the WT male were also all increased in the ArKO male. These included an upregulation of RNA splicing and processing, DNA replication, and cell-cycle processes in both genotypes. In an analogous manner, a number of the increased z scores in biological process ontologies of female glands were elevated in both WT and ArKO mice. These included antiapoptosis, tissue development, cell proliferation, and protein complex biogenesis (Table 11). These similarities in many WT and ArKO ontology responses were also observed in the molecular function and cellular component categories (Table 11; ≥20–46 genes/ontology), as well as in KEGG pathways (e.g., female, focal adhesion, z scores = 2.74 and 6.29; male, cell cycle, z scores = 2.66 and 3.09). Of interest, female ArKO mice also had significant increases in a variety of immune function ontologies, whereas male ArKO mice had increases in mitotic ontologies (Table 12). There were a number of sex-related parallels in the CodeLink data that were similar to those described above for Affymetrix ontologies (e.g., male, glycerophospholipid metabolism, z scores = 3.50 and 2.09).

Table 11. .

Sex-Related Differences in Ontologies in Meibomian Glands of WT and ArKO Mice

Ontology
M Genes ↑
F Genes ↑
M z Score
F z Score
RNA splicing 73, 53 21, 12 8.48, 7.66 2.23, −0.76
RNA processing 106, 73 29, 20 7.99, 6.66 1.26, −1.24
Membrane-bounded organelle 916, 621 408, 402 7.37, 6.08 4.13, 0.07
Nucleotide binding 291, 205 109, 88 7.1, 6.47 2.06, −1.37
Cytoplasm 884, 594 410, 425 6.41, 4.96 4.8, 2.33
ATP binding 196, 134 52, 49 6.1, 5.06 −1.09, −2.24
DNA replication 37, 38 18, 9 2.96, 5.79 2.44, −0.82
Nuclear lumen 205, 136 72, 81 5.51, 4.16 0.76, 0.78
Catalytic activity 551, 274 232, 217 4.59, 3.75 1.63, −1.42
Cell cycle process 89, 77 32, 25 2.14, 4.29 0.02, −1.91
Protein kinase activity 81, 56 21, 27 3.83, 3.28 −0.77, −0.03
Extracellular matrix 19, 7 27, 49 −2.56, −3.37 3.3, 8.25
Extracellular region 79, 36 93, 147 −7.44, −7.78 2.38, 7.57
Cell proliferation 91, 68 68, 98 −3.23, −1.83 2, 5.12
Glycosaminoglycan binding 6, 5 14, 20 −2.42, −1.64 2.99, 4.92
GTPase activity 14, 11 2, 15 −0.86, −0.22 4.9, 2.28
Pattern binding 7, 7 16, 21 −2.48, −1.28 3.3, 4.71
Growth factor binding 11, 5 14, 17 −0.47, −1.26 3.63, 4.48
Antiapoptosis 21, 14 18, 25 −0.56, −0.5 2.46, 4.08
Tissue development 97, 43 61, 75 −0.9, −3.63 2.28, 3.39
Protein complex biogenesis 62, 44 41, 42 0.42, 0.68 3.08, 2.49
Endoplasmic reticulum 111, 73 65, 68 1.21, 0.71 3.08, 2.49

Biological process, molecular function, and cellular component ontologies, with some of the highest z scores, were selected following the analysis of nontransformed data. Criteria for inclusion in this table were an ontology containing ≥20 genes, a z score >2.0 (in bold print), and similar responses between WT and ArKO mice. The first number in each column was from WT tissues, and the second from ArKO. M Genes ↑, number of genes upregulated in M tissues; F Genes ↑, number of genes upregulated in F tissues; z score, specific score for the upregulated genes in the M and F tissues.

Table 12. .

Expression of Various Immune Function and Mitotic Ontologies in Meibomian Glands of Male and Female ArKO mice

Ontology
M Genes ↑
F Genes ↑
M z Score
F z Score
Immune Function
 Regulation of immune system process 34 67 −1.37 6.82
 Positive regulation of immune system process 20 49 −1.89 6.12
 Immune system process 56 97 −2.93 5.4
 Regulation of immune response 17 39 −1.54 5.3
 Immune response 29 58 −2.13 5.2
 Activation of immune response 11 24 −0.78 4.56
 Positive regulation of immune response 12 30 −1.67 4.54
 T-cell activation 14 28 −0.99 4.27
 Defense response 24 55 −3.38 4.01
 Lymphocyte activation 18 36 −1.75 3.94
 Immune effector process 12 30 −2.04 3.94
 Leukocyte activation 21 40 −1.9 3.82
 Regulation of leukocyte activation 14 24 −0.82 3.34
 Leukocyte differentiation 15 25 −0.96 3.12
 Regulation of lymphocyte activation 12 21 −0.91 3.01
 Lymphocyte differentiation 12 19 −0.48 2.96
 Innate immune response 17 24 −0.47 2.84
 Regulation of cytokine production 9 23 −2.24 2.81
 Cytokine production 12 25 −2.01 2.65
 Response to cytokine stimulus 22 19 −0.49 2.64
 Regulation of defense response 15 22 −1.06 2.15
Mitosis
 Cell cycle 103 45 4.1 −1.03
 Mitotic cell cycle 56 22 3.48 −0.92
 Regulation of cell cycle process 29 9 3.27 −0.9
 Negative regulation of cell cycle 30 11 3.24 −0.47
 Cell cycle phase 54 19 3.15 −1.52
 M phase 41 11 2.93 −2.02
 Regulation of cell cycle 47 25 2.56 0.17
 M phase of mitotic cell cycle 29 10 2.51 −1.03
 Mitosis 27 10 2.19 −0.93
 Nuclear division 27 10 2.19 −0.93
 Negative regulation of cell proliferation 27 33 −0.14 2.97

Listed biological process ontologies were selected following the analysis of nontransformed Affymetrix data. The z scores with values >2.0 are highlighted in bold print. Criteria for inclusion in this table were an immune function or mitotic ontology containing ≥30 genes in the meibomian glands of M and F ArKO mice. One immune function ontology (i.e., positive regulation of leukocyte activation) was also upregulated in F WT mice. Meibomian glands of M WT mice expressed genes associated with a downregulation of cell cycle ontologies (i.e., ↑ cell cycle arrest and negative regulation of cell cycle; ↓ epithelial cell proliferation and regulation of epithelial cell proliferation). Similar findings related to immune function and mitotic ontologies in males and females were observed with CodeLink data (not shown).

Although a number of sex-associated differences in ontologies were identical between WT and ArKO mice, the specific genes within these ontologies were often not the same. For example, analysis of multiple biological process ontologies in Affymetrix and CodeLink databases showed that about 70% of the genes in a given ontology were different between WT and ArKO mice. Similarly, if comparing various Affymetrix and CodeLink ontologies found to be upregulated in WT and ArKO mice in both platforms, fewer than 9% of the genes were the same within each ontology.

Impact of Aromatase Absence on the Histological Appearance of Male and Female Meibomian Glands

To assess whether aromatase absence alters the structure of meibomian glands, tissues (n = 4/sex/strain) from adult, age-matched male and female WT (male = 127 ± 0 days; female = 125 ± 2 days) and ArKO (male = 122 ± 5 days; female = 123 ± 2 days) mice were processed for histological evaluation. As shown in the Figure, our analyses revealed no effect of aromatase deficiency on the glandular histology of either male or female mice. In addition, no abnormalities or inflammation were observed in any of the gland sections.

Figure. .

Figure. 

Representative light micrographs of male and female WT and ArKO meibomian glands. There are no obvious histological differences between WT and ArKO glands. Sections were stained with hematoxylin and eosin. All panels are ×40 magnification.

Discussion

The present study demonstrates that aromatase has a significant impact on gene expression in the mouse meibomian gland. The nature of this effect is primarily sex-dependent and genotype-specific. However, many of the sex-related variations in ontologies and KEGG pathways are similar between WT and ArKO mice. Given this finding, it appears that aromatase, and by extension estrogen, do not play a major role in the sex-related differences of the meibomian gland. Of particular interest, the loss of aromatase activity has no obvious effect on meibomian gland histology.

Our results show that the presence or absence of aromatase significantly influences the expression of more than a thousand genes in meibomian glands of male and female mice. The loss of aromatase, and consequently estrogen, led to significant changes in the expression of numerous ontologies related to biological processes, molecular function, and cellular components, as well as to KEGG pathways, in both male and female glands. These included an upregulation of genes related to actin binding, the pentose phosphate pathway and non–membrane-bounded organelles in ArKO tissues, and a corresponding downregulation of genes linked to such ontologies as catalytic activity and protein transport. The ability of aromatase to significantly affect gene transcripts has also been found in the ovary.40 Further, our finding that aromatase affects gene expression in the male meibomian gland is consistent with investigations showing that estrogen action is extremely important in other male tissues.41,42

We discovered that the nature of aromatase's effect on meibomian gland gene expression is sex-dependent. As demonstrated by both Affymetrix and CodeLink data analyses, fewer than 5% of the genes significantly influenced by aromatase were the same in both males and females. Put another way, more than 95% of the aromatase-linked genes were sex-specific. Similarly, the majority of affected ontologies and KEGG pathways were sex-dependent: most differences between female WT and ArKO glands were not the same as those between male WT and ArKO tissues. This sexual dimorphism in response to aromatase is not uncommon, and has also been reported for aromatase/estrogen regulation of the liver, adipose tissue, brain, and serum leptin levels.22,43–47 How this sexual difference in responsiveness may affect meibomian gland physiology in males and females remains to be elucidated.

In these studies, we used both Affymetrix GeneChips and CodeLink Bioarrays, because we and others have identified significant differences between these platforms in their ability to detect differential gene expression.31–34 Indeed, as found again in this investigation, there is little agreement between these platforms concerning the lists of the differentially expressed genes.31–35 This low concordance in gene identification seems to be due to intrinsic variations in platform design, including differences in probe length and content, deposition technology, labeling approaches, hybridizing protocols, image segmentation, signal detection, background correction, data normalization, and data mining,32–34,39 as well as to the innate instability of lists of significantly changed genes based on P value cutoffs.48 The consequence is that CodeLink and Affymetrix arrays, both of which have proven reproducibility and accuracy, appear to measure different things.34 Most gene expression changes revealed by each of the platforms are believed to be biologically correct, and these differences cannot be attributed to technological variations.32,33 For these reasons, researchers have suggested that a more meaningful transcriptome assessment may be obtained by analyzing the same sample with different microarray platforms.33 The genes contained in the intersection of Affymetrix and CodeLink lists can be used as reliable biomarkers, whereas the genes in the union can be used to identify biological pathways.

Our analyses demonstrate that the effect of aromatase absence on sex-related differences in gene expression was genotype-specific. Thus, up to 90% of the sex-associated genes in meibomian glands of WT mice were different from those in tissues of ArKO mice. However, despite these specific gene differences, many sex-related variations in gene ontologies and KEGG pathways were remarkably similar between WT and ArKO mice. For instance, ontologies, such as RNA splicing and ATP binding, were significantly increased in male WT and ArKO glands, whereas those linked to growth factor binding and endoplasmic reticulum were upregulated in female WT and ArKO tissues. Given these similarities, it appears that aromatase does not play a predominant role in the sex-related differences of the mouse meibomian gland. This conclusion is consistent with a recent finding that estrogen action does not seem to make a major contribution to the sex-associated differences in gene expression of the meibomian gland.7

Our observation that female and male ArKO mice have significant differences in the expression of a variety of immune function and mitotic ontologies was intriguing, but the underlying bases have yet to be determined. These variations may represent sexually dimorphic responses to the known increases in the serum concentrations of testosterone, androstenedione, prolactin, follicle-stimulating hormone, luteinizing hormone, or leptin in ArKO mice,30,45,49,50 or to hormone-independent processes,51,52 or to the effects of Y-linked genes or X inactivation in the ArKO strain.53–56

Some limitations in this study should be considered. First, it is possible that tiny pieces of adjacent lid tissue adhered to the meibomian glands during isolation under the dissecting microscope; however, such possible contamination would be similar for all tissues, given that the same individual obtained glands from every lid segment in the same manner. Second, because lid glands were pooled, we do not know whether differences in gene expression exist between the meibomian glands of upper and lower lids. Such differences could theoretically occur, given that glandular anatomy varies between the upper and lower lids of humans.4 Third, our data represent mRNA levels. We have yet to determine whether these transcripts are translated into active proteins.

Our tissue evaluations revealed no effect of aromatase absence on the meibomian gland histology of male or female mice. In addition, no abnormalities or inflammation were observed in any of the gland sections. This finding is in stark contrast to a report that describes a significant B-cell accumulation in salivary glands of male and female ArKO mice, and concludes that estrogen deficiency results in a lymphoproliferative autoimmune disease resembling Sjögren's syndrome.57 MGD is known to occur in this autoimmune disease,3 but there is no evidence of MGD in ArKO mice.

The lack of influence of complete aromatase and estrogen absence on the meibomian gland is also noteworthy, because this tissue is a large sebaceous gland. Estrogens are known to cause a significant reduction in the size, activity, and lipid synthesis of sebaceous glands in multiple species.2,3,4,58–64 In fact, estrogen was once called the prototype agent for the suppression of sebum production,63 and for years was used to decrease sebaceous gland function and secretion in humans.5,61,62,65–67 A mechanism proposed for this hormone action is that estrogen stimulates the intra-sebocyte release of lysosomal enzymes, leading to premature cellular destruction and reduced sebum output.63,68 Another suggested mechanism is that estrogens attenuate testosterone uptake, interfere with testosterone's conversion to dihydrotestosterone, and antagonize androgen activity in the sebaceous gland.60,63,69 Consequently, one might anticipate that loss of estrogen might affect the histology of the meibomian gland. Given that such an effect was not found, it may simply reflect the heterogeneity known to exist in the sebaceous gland control mechanisms in different parts of the body.58

Acknowledgments

The authors thank Orhan Oz (Dallas, TX), Evan Simpson (Clayton, Victoria, Australia) and Britt Bromberg (New Orleans, LA), Alexia Thomas (Dallas, TX), Michael J. Lombardi, Patricia Rowley and Marie Ortega (Boston, MA), and Adam M. Papallo (Cambridge, MA) for their assistance.

Footnotes

Supported by National Institutes of Health Grant R01EY05612, the Margaret S. Sinon Scholar in Ocular Surface Research fund, and postdoctoral fellowship awards from Allergan, Japan, Bausch & Lomb, and the Japan Eye Bank Association.

Disclosure: R. Rahimi Darabad, None; T. Suzuki, None; S.M. Richards, None; R.V. Jensen, None; F.A. Jakobiec, None; F.R. Zakka, None; S. Liu, None; D.A. Sullivan, None

References

  • 1. Sullivan DA, Sullivan BD, Evans JE, et al. Androgen deficiency, meibomian gland dysfunction and evaporative dry eye. Ann N Y Acad Sci. 2002; 966: 211–222 [DOI] [PubMed] [Google Scholar]
  • 2. Sullivan DA, Jensen RV, Suzuki T, Richards SM. Do sex steroids exert sex-specific and/or opposite effects on gene expression in lacrimal and meibomian glands? Mol Vis. 2009; 15: 1553–1572 [PMC free article] [PubMed] [Google Scholar]
  • 3. Knop E, Knop N, Millar T, Obata H, Sullivan DA. The International Workshop on Meibomian Gland Dysfunction: Report of the Subcommittee on Anatomy, Physiology, and Pathophysiology of the Meibomian Gland. Invest Ophthalmol Vis Sci. 2011; 52: 1938–1978 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Deplewski D, Rosenfield RL. Role of hormones in pilosebaceous unit development. Endocr Rev. 2000; 21: 363–392 [DOI] [PubMed] [Google Scholar]
  • 5. Pochi PE, Strauss JS. Endocrinologic control of the development and activity of the human sebaceous gland. J Invest Dermatol. 1974; 62: 191–201 [DOI] [PubMed] [Google Scholar]
  • 6. Suzuki T, Sullivan BD, Liu M, et al. Estrogen and progesterone effects on the morphology of the mouse meibomian gland. Adv Exp Med Biol. 2002; 506: 483–488 [DOI] [PubMed] [Google Scholar]
  • 7. Richards SM, Yamagami H, Schirra F, Suzuki T, Jensen RV, Sullivan DA. Sex-related effect on gene expression in the mouse meibomian gland. Curr Eye Res. 2006; 31: 119–128 [DOI] [PubMed] [Google Scholar]
  • 8. Sullivan BD, Evans JE, Cermak JM, Krenzer KL, Dana MR, Sullivan DA. Complete androgen insensitivity syndrome: effect on human meibomian gland secretions. Arch Ophthalmol. 2002; 120: 1689–1699 [DOI] [PubMed] [Google Scholar]
  • 9. Sullivan BD, Evans JE, Dana MR, Sullivan DA. Impact of androgen deficiency on the lipid profiles in human meibomian gland secretions. Adv Exp Med Biol. 2002; 506: 449–458 [DOI] [PubMed] [Google Scholar]
  • 10. Sullivan BD, Cermak JM, Sullivan RM, et al. Correlations between nutrient intake and the polar lipid profiles of meibomian gland secretions in women with Sjögren's syndrome. Adv Exp Med Biol. 2002; 506: 441–448 [DOI] [PubMed] [Google Scholar]
  • 11. Sullivan BD, Evans JE, Dana MR, Sullivan DA. Influence of aging on the polar and neutral lipid profiles in human meibomian gland secretions. Arch Ophthalmol. 2006; 124: 1286–1292 [DOI] [PubMed] [Google Scholar]
  • 12. Chew CKS, Hykin PG, Janswijer C, Dikstein S, Tiffany JM, Bron AJ. The casual level of meibomian lipids in humans. Curr Eye Res. 1993; 12: 255–259 [DOI] [PubMed] [Google Scholar]
  • 13. Den S, Shimizu K, Ikeda T, Tsubota K, Shimmura S, Shimazaki J. Association between meibomian gland changes and aging, sex, or tear function. Cornea. 2006; 25: 651–655 [DOI] [PubMed] [Google Scholar]
  • 14. Schaumberg DA, Sullivan DA, Buring JE, Dana MR. Prevalence of dry eye syndrome among US women. Am J Ophthalmol. 2003; 136: 318–326 [DOI] [PubMed] [Google Scholar]
  • 15. Schaumberg DA, Dana R, Buring JE, Sullivan DA. Prevalence and risk factors for dry eye disease among US men. Arch Ophthalmol. 2009; 127: 763–768 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Chia EM, Mitchell P, Rochtchina E, Lee AJ, Maroun R, Wang JJ. Prevalence and associations of dry eye syndrome in an older population: the Blue Mountains Eye Study. Clin Experiment Ophthalmol. 2003; 31: 229–232 [DOI] [PubMed] [Google Scholar]
  • 17. Lin PY, Tsai SY, Cheng CY, Liu JH, Chou P, Hsu WM. Prevalence of dry eye among an elderly Chinese population in Taiwan: the Shihpai Eye Study. Ophthalmology. 2003; 110: 1096–1101 [DOI] [PubMed] [Google Scholar]
  • 18. Jones ME, Boon WC, Proietto J, Simpson ER. Of mice and men: the evolving phenotype of aromatase deficiency. Trends Endocrinol Metab. 2006; 17: 55–64 [DOI] [PubMed] [Google Scholar]
  • 19. Santen RJ, Brodie H, Simpson ER, Siiteri PK, Brodie A. History of aromatase: saga of an important biological mediator and therapeutic target. Endocr Rev. 2009; 30: 343–375 [DOI] [PubMed] [Google Scholar]
  • 20. Czajka-Oraniec I, Simpson ER. Aromatase research and its clinical significance. Endokrynol Pol. 2010; 61: 126–134 [PubMed] [Google Scholar]
  • 21. Takeda K, Toda K, Saibara T, et al. Progressive development of insulin resistance phenotype in male mice with complete aromatase (CYP19) deficiency. J Endocrinol. 2003; 176: 237–246 [DOI] [PubMed] [Google Scholar]
  • 22. Hewitt KN, Boon WC, Murata Y, Jones ME, Simpson ER. The aromatase knockout mouse presents with a sexually dimorphic disruption to cholesterol homeostasis. Endocrinology. 2003; 144: 3895–3903 [DOI] [PubMed] [Google Scholar]
  • 23. Murata Y, Robertson KM, Jones ME, Simpson ER. Effect of estrogen deficiency in the male: the ArKO mouse model. Mol Cell Endocrinol. 2002; 193: 7–12 [DOI] [PubMed] [Google Scholar]
  • 24. Dieudonné MN, Sammari A, Dos Santos E, Leneveu MC, Giudicelli Y, Pecquery R. Sex steroids and leptin regulate 11beta-hydroxysteroid dehydrogenase I and P450 aromatase expressions in human preadipocytes: sex specificities. J Steroid Biochem Mol Biol. 2006; 99: 189–196 [DOI] [PubMed] [Google Scholar]
  • 25. Fester L, Prange-Kiel J, Zhou L, et al. Estrogen-regulated synaptogenesis in the hippocampus: sexual dimorphism in vivo but not in vitro. J Steroid Biochem Mol Biol. 2012; 131: 24–29 [DOI] [PubMed] [Google Scholar]
  • 26. Schirra F, Suzuki T, Dickinson DP, Townsend DJ, Gipson IK, Sullivan DA. Identification of steroidogenic enzyme mRNAs in the human lacrimal gland, meibomian gland, cornea and conjunctiva. Cornea. 2006; 25: 438–442 [DOI] [PubMed] [Google Scholar]
  • 27. Agarwal VR, Sinton CM, Liang C, Fisher C, German DC, Simpson ER. Upregulation of estrogen receptors in the forebrain of aromatase knockout (ArKO) mice. Mol Cell Endocrinol. 2000; 162: 9–16 [DOI] [PubMed] [Google Scholar]
  • 28. Simpson ER. Models of aromatase insufficiency. Semin Reprod Med. 2004; 22: 25–30 [DOI] [PubMed] [Google Scholar]
  • 29. Yan M, Jones ME, Hernandez M, Liu D, Simpson ER, Chen C. Functional modification of pituitary somatotropes in the aromatase knockout mouse and the effect of estrogen replacement. Endocrinology. 2004; 145: 604–612 [DOI] [PubMed] [Google Scholar]
  • 30. Fisher CR, Graves KH, Parlow AF, Simpson ER. Characterization of mice deficient in aromatase (ArKO) because of targeted disruption of the cyp19 gene. Proc Natl Acad Sci U S A. 1998; 95: 6965–6970 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Suzuki T, Richards SM, Liu S, Jensen RV, Sullivan DA. Impact of sex on gene expression in human corneal epithelial cells. Mol Vision. 2009; 15: 2554–2569 [PMC free article] [PubMed] [Google Scholar]
  • 32. Yauk CL, Berndt ML, Williams A, Douglas GR. Comprehensive comparison of six microarray technologies. Nucleic Acids Res. 2004; 32: e124 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Hollingshead D, Lewis DA, Mirnics K. Platform influence on DNA microarray data in postmortem brain research. Neurobiol Dis. 2005; 18: 649–655 [DOI] [PubMed] [Google Scholar]
  • 34. Tan PK, Downey TJ, Spitznagel EL Jr, et al. Evaluation of gene expression measurements from commercial microarray platforms. Nucleic Acids Res. 2003; 31: 5676–5684 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Pedotti P, Hoen PA, Vreugdenhil E, et al. Can subtle changes in gene expression be consistently detected with different microarray platforms? BMC Genomics. 2008; 9: 124 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Sato EH, Sullivan DA. Comparative influence of steroid hormones and immunosuppressive agents on autoimmune expression in lacrimal glands of a female mouse model of Sjögren's syndrome. Invest Ophthalmol Vis Sci. 1994; 35: 2632–2642 [PubMed] [Google Scholar]
  • 37. Richards SM, Jensen RV, Liu M, et al. Influence of sex on gene expression in the mouse lacrimal gland. Exp Eye Res. 2006; 82: 13–23 [DOI] [PubMed] [Google Scholar]
  • 38. Ashburner M, Ball CA, Blake JA, et al. Gene ontology: tool for the unification of biology. The Gene Ontology Consortium. Nat Genet. 2000; 25: 25–29 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Consortium MAQC. The MicroArray Quality Control (MAQC) project shows inter- and intraplatform reproducibility of gene expression measurements. Nat Biotechnol. 2006; 24: 1151–1161 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Liew SH, Sarraj MA, Drummond AE, Findlay JK. Estrogen-dependent gene expression in the mouse ovary. PLoS One. 2011; 6: e14672 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Grumbach MM, Auchus RJ. Estrogen: consequences and implications of human mutations in synthesis and action. J Clin Endocrinol Metab. 1999; 84: 4677–4694 [DOI] [PubMed] [Google Scholar]
  • 42. MacGillivray MH, Morishima A, Conte F, Grumbach M, Smith EP. Pediatric endocrinology update: an overview. The essential roles of estrogens in pubertal growth, epiphyseal fusion and bone turnover: lessons from mutations in the genes for aromatase and the estrogen receptor. Horm Res. 1998; 49: 2–8 [DOI] [PubMed] [Google Scholar]
  • 43. Simpson ER, Misso M, Hewitt KN, et al. Estrogen—the good, the bad, and the unexpected. Endocr Rev. 2005; 26: 322–330 [DOI] [PubMed] [Google Scholar]
  • 44. Chavez C, Gogos A, Jones ME, van den Buuse M. Psychotropic drug-induced locomotor hyperactivity and prepulse inhibition regulation in male and female aromatase knockout (ArKO) mice: role of dopamine D1 and D2 receptors and dopamine transporters. Psychopharmacology (Berl). 2009; 206: 267–279 [DOI] [PubMed] [Google Scholar]
  • 45. Jones MEE, Thorburn AW, Britt KL, et al. Aromatase-deficient (ArKO) mice have a phenotype of increased adiposity. Proc Natl Acad Sci U S A. 2000; 97: 12735–12740 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46. Hewitt KN, Pratis K, Jones ME, Simpson ER. Estrogen replacement reverses the hepatic steatosis phenotype in the male aromatase knockout (ArKO) mouse. Endocrinology. 2004; 145: 1842–1848 [DOI] [PubMed] [Google Scholar]
  • 47. Hill RA, Pompolo S, Jones ME, Simpson ER, Boon WC. Estrogen deficiency leads to apoptosis in dopaminergic neurons in the medial preoptic area and arcuate nucleus of male mice. Mol Cell Neurosci. 2004; 27: 466–476 [DOI] [PubMed] [Google Scholar]
  • 48. Shi L, Jones WD, Jensen RV, et al. The balance of reproducibility, sensitivity, and specificity of lists of differentially expressed genes in microarray studies. BMC Bioinformatics. 2008; 9: S10 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Britt KL, Drummond AE, Dyson M, et al. The ovarian phenotype of the aromatase knockout (ArKO) mouse. J Steroid Biochem Mol Biol. 2001; 79: 181–185 [DOI] [PubMed] [Google Scholar]
  • 50. McPherson SJ, Wang H, Jones ME, et al. Elevated androgens and prolactin in aromatase-deficient mice cause enlargement, but not malignancy, of the prostate gland. Endocrinology. 2001; 142: 2458–2467 [DOI] [PubMed] [Google Scholar]
  • 51. Rinn JL, Snyder M. Sexual dimorphism in mammalian gene expression. Trends Genet. 2005; 21: 298–305 [DOI] [PubMed] [Google Scholar]
  • 52. Isensee J, Noppinger PR. Sexually dimorphic gene expression in mammalian somatic tissue. Gender Med. 2007; 4: S75–95 [DOI] [PubMed] [Google Scholar]
  • 53. Ostrer H. Sex-based differences in gene expression. J Appl Physiol. 2001; 91: 2384–2388 [DOI] [PubMed] [Google Scholar]
  • 54. Disteche CM, Filippova GN, Tsuchiyad KD. Escape from X inactivation. Cytogenet Genome Res. 2002; 99: 36–43 [DOI] [PubMed] [Google Scholar]
  • 55. Xu J, Disteche CM. Sex differences in brain expression of X- and Y-linked genes. Brain Res. 2006; 1126: 50–55 [DOI] [PubMed] [Google Scholar]
  • 56. Migeon BR. The role of X inactivation and cellular mosaicism in women's health and sex-specific diseases. JAMA. 2006; 295: 1428–1433 [DOI] [PubMed] [Google Scholar]
  • 57. Shim GJ, Warner M, Kim HJ, et al. Aromatase-deficient mice spontaneously develop a lymphoproliferative autoimmune disease resembling Sjogren's syndrome. PNAS. 2004; 101: 12628–12633 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 58. Thody AJ, Shuster S. Control and function of sebaceous glands. Physiol Rev. 1989; 69: 383–416 [DOI] [PubMed] [Google Scholar]
  • 59. Wirth H, Gloor M, Kimmel W. Influence of cyproterone acetate and estradiol on cell kinetics in the sebaceous gland of the golden hamster ear. Arch Dermatol Res. 1980; 268: 277–281 [DOI] [PubMed] [Google Scholar]
  • 60. Schafer G, Krause W. The effect of estradiol on the sebaceous gland of the hamster ear and its antagonism by tamoxifen. Arch Dermatol Res. 1985; 277: 230–234 [DOI] [PubMed] [Google Scholar]
  • 61. Sweeney TM, Szarnicki RJ, Strauss JS, Pochi PE. The effect of estrogen and androgen on the sebaceous gland turnover time. J Invest Dermatol. 1969; 53: 8–10 [PubMed] [Google Scholar]
  • 62. Strauss JS, Kligman AM, Pochi PE. The effect of androgens and estrogens on human sebaceous glands. J Invest Dermatol. 1962; 39: 139–155 [DOI] [PubMed] [Google Scholar]
  • 63. Sansone-Bazzano G, Reisner RM, Bazzano G. A possible mechanism of action of estrogen at the cellular level in a model sebaceous gland. J Invest Dermatol. 1972; 59: 299–304 [DOI] [PubMed] [Google Scholar]
  • 64. Azzi L, El-Alfy M, Labrie F. Gender differences and effects of sex steroids and dehydroepiandrosterone on androgen and oestrogen α receptors in mouse sebaceous glands. Br J Dermatol. 2006; 154: 21–27 [DOI] [PubMed] [Google Scholar]
  • 65. Pochi PE. Acne: endocrinologic aspects. Cutis. 1982; 30: 212–222 [PubMed] [Google Scholar]
  • 66. Saihan EM, Burton JL. Sebaceous gland suppression in female acne patients by combined glucocorticoid-oestrogen therapy. Br J Dermatol. 1980; 103: 139–142 [DOI] [PubMed] [Google Scholar]
  • 67. Pochi PE, Strauss JS. Sebaceous gland inhibition from combined glucocorticoid-estrogen treatment. Arch Dermatol. 1976; 112: 1108–1109 [PubMed] [Google Scholar]
  • 68. Smith E, Szego CM. Direct photomicroscopic evidence for rapid nuclear penetration of lysosomal products in steroid targets after estrogen in vivo. Endocrinology. 1971; 88: A151 [Google Scholar]
  • 69. Azzi L, El-Alfy M, Labrie F. Gender differences and effects of sex steroids and dehydroepiandrosterone on androgen and oestrogen alpha receptors in mouse sebaceous glands. Br J Dermatol. 2006; 154: 21–27 [DOI] [PubMed] [Google Scholar]
  • 70. Doniger SW, Salomonis N, Dahlquist KD, Vranizan K, Lawlor SC, Conklin BR. MAPPFinder: using Gene Ontology and GenMAPP to create a global gene-expression profile from microarray data. Genome Biol. 2003; 4: R7 [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Investigative Ophthalmology & Visual Science are provided here courtesy of Association for Research in Vision and Ophthalmology

RESOURCES