Abstract
Bacillus subtilis is an attractive host for production of recombinant proteins. Promoters and expression plasmid backbones have direct impacts on the efficiency of gene expression. To screen and isolate strong promoters, a promoter trap vector pShuttleF was developed in this study. Using the vector, approximately 1000 colonies containing likely promoters from Bacillus licheniformis genomic DNA were obtained. Amongst them, pShuttle-09 exhibited the highest β-Gal activities in both Escherichia coli and B. subtilis. The activity of pShuttle-09 in B. subtilis was eight times of that of the P43 promoter, a commonly used strong promoter for B. subtilis. A sequence analysis showed that pShuttle-09 contained PluxS and truncated luxS in-frame fused with the reporter gene as well as another fragment upstream of PluxS containing a putative promoter. This putative promoter was a hybrid promoter and its β-Gal activity was higher than PluxS. Reconstructing the hybrid promoter from pShuttle-09 to PlapS further improved the β-Gal production by 60%. The usefulness of our promoter trap system is likely due to random shuffling and recombination of DNA fragments and adoption of a rapid and high-throughput screening. Thus, our data provide additional evidence to support the concept of using a promoter trap system to create new promoters.
Introduction
Bacillus subtilis is a non-pathogenic gram-positive bacterium and has been an attractive host for production of recombinant proteins from both prokaryotic and eukaryotic origins [1], [2], [3]. The suitability and popularity of B. subtilis as one of main hosts for recombinant protein production is due to several reasons: generally recognized as safe as a result of its lack of pathogenicity and the absence of endotoxins; capable of secreting functional proteins directly into culture media, easy for genetic manipulation and handling, and capable of large-scale fermentation [2], [4], [5], [6].
B. subtilis own proteins can be over expressed in B. subtilis in the order of several grams per liter [3]. However, secretion of heterologous proteins in B. subtilis is usually low [7]. Thus, efficient production of high-value recombinant proteins in B. subtilis remains a major challenge. To circumvent the problem, strong promoters, a variety of translation/secretion signals, and transcription terminators are continuously being explored. In particular, several strong promoters have been reported [8], [9], [10], [11], [12], [13], [14], [15]. In spite of the progress, it is still beneficial to find even more potent promoters.
Promoters are important regulatory elements in a genome and control spatial and temporal expression of genes and their expression strength. In bacteria, a promoter is recognized by RNA polymerases and associated sigma factors, which may be recruited to the promoter by regulatory proteins binding to specific sites in the promoter. There are several ways to find new promoters. The advent of DNA sequencing has significantly accelerated sequencing of many bacterial genomes and prediction of promoters. However, it is not yet possible to scan a bacterial genome sequence and readily predict the expression behavior of genes belonging to a regulon, largely because an accurate prediction of promoters is difficult [16]. Alternatively, a promoter trap vector, which is a plasmid containing a multiple cloning site at the 5′ end of a promoter-less marker gene, can be used to identify promoters [17], [18], [19]. An unidentified DNA fragment is cloned into the multiple cloning site and expression of the marker gene is monitored to identify active promoter elements in the unidentified DNA fragment. Promoter trap systems have been successfully used to identify promoters for B. subtilis either from B. subtilis itself or from other bacillus species [20], [21], [22], [23].
A promoter trap system could perform shuffling and recombination of DNA fragments and screen of strong promoters simultaneously. However, this has never being reported. Fortuitously, when a promoter trap system was used in this study to screen Sau3A I cut fragments from B. licheniformis genomic DNA for potential promoters, a strong double promoter was identified, containing a normal promoter and a hybrid promoter due to shuffling and recombination. The putative double promoter was further improved and used for protein expression both in E. coli and B. subtilis. Our results show that promoter trap systems could be suitable for finding novel strong promoters.
Materials and Methods
Bacterial strains, plasmids and growth conditions
B. subtilis 1A747 (B. subtilis PY79) was a gift from Bacillus Genetic Stock Centre of the Ohio State University. B. pumilus BYG, B. licheniformis A061, B. amyloliquefaciens and B. megaterium W-5 were isolated by our laboratory. The bacterial strains were isolated from effluent of a paper mill in Hubei province of China and partial 16S rDNA sequencing was used for identification of species in the genus Bacillus. The plasmids used in this study are listed in Table 1. E. coli DH5α was purchased from Novagen (Darmstadt, Germany). The bacterial strains were cultured in the Luria-Bertani (LB) medium at 37°C. The following concentrations of antibiotics were used for selection: 100 µg/mL ampicillin (Amp), 5 µg/mL chloramphenicol (Cm) and 50 µg/mL spectinomycin (Spec).
Table 1. Plasmids used in this study.
| Plasmids | Relevant characteristics | Sources |
| pGJ103 | E. coli-B. subtilis shuttle vector | [6] |
| pDL | bgaB gene donor | [6] |
| pDG1728 | specR gene donor | [27] |
| pShuttleF | Promoter-trapping vector | This study |
| pB43 | P43promoter donor | This study |
| pShuttle-09 | Recombinant cloned promoter fragment | This study |
| pShuttle-P43 | pShuttleF inserted P43 Promoter | This study |
| pShuttle-luxi | bgaB directed by PluxS of B. licheniformis in shuttle vector | This study |
| pShuttle-luxS | bgaB directed by PluxS of B. subtilis in shuttle vector | This study |
| pShuttle-luxP | bgaB directed by PluxS of B. pumilus in shuttle vector | This study |
| pShuttle-luxM | bgaB directed by PluxS of B. megaterium in shuttle vector | This study |
| pShuttle-Hyb | bgaB directed by hybrid promoter from pShuttle-09 | This study |
| pShuttle-Fus1 | pShuttleF harbouring cloned promoter without of 5′end of luxs CDS | This study |
| pShuttle-PLapS | pShuttle-F harbouring combined promoter PLapS | This study |
| pShuttle-PLapP | pShuttle-F harbouring combined promoter PLapP | This study |
| pShuttle-PLapL | pShuttle-F harbouring combined promoter PLapL | This study |
| pShuttle-LapM | pShuttleF -harbouring combined promoter PLapM | This study |
| pLus-Hyb | Expression vector based on PLapS | This study |
| pLus-His | Expression vector for expression purification | This study |
| pLu-bga | pLus-Hyb harbouring bgaB | This study |
| pLuHis-bga | pLus-His harbouring bgaB | This study |
| pLu-bioI | pLus-Hyb harbouring bioI | This study |
| pLuHis-bioI | pLus-His harbouring bioI | This study |
PCR and DNA manipulation
Polymerase chain reaction (PCR) primers and oligonucleotides used in this study are listed in Table 2. Isolation and manipulation of recombinant DNA was performed using standard techniques [24]. All enzymes were from Promega China (Beijing, China) and used as recommended by the manufacturer. The transformation of E. coli and B. subtilis was performed by electroporation [24], [25].
Table 2. Primers and oligonucleotides used in this study.
| Primers | Sequences (5′→3′) | Restriction sites |
| bgaB-1 | GCGGATCCATGAATGTGTTATCCTC | BamH I |
| bgaB-2 | TTGAGCTCCTCTA AACCTTCCCGG | Sac I |
| spec-1 | TTGGATCCGAATGGCGATTTTC | BamH I |
| spec-2 | TTGTCGACTTGAAAAAAGTGTTTCCAC | Sal I |
| P43-1 | TTGGGCCCTCAGCATTATTGAGTG | Apa I |
| P43-2 | TTGGATCCCATGTGTACATTCCTCTC | BamH I |
| insert-1 | TTGGATCCCACTTTATGGACGCC | BamH I |
| insert-2 | TTGGGCCCATTCGGATCGTCAC | Apa I |
| luxS-up | TTGGATCCACTCTCCCCTTTTTTAAAAATG | BamH I |
| luxS-down | TTGGGCCCTAATGTTTTTGTTTCTTTTC | Apa I |
| luxP-up | TTGGATCCATCAAGTTCAAAGCTTTC | BamH I |
| luxP-down | TTGGGCCCAAAAGTAAGTTATTTTTCC | Apa I |
| luxM-up | TTGGATCCCACTCCTTTTTTCTTCTTTC | BamH I |
| luxM-down | TTGGGCCCGTTTTACAGTCAAATAAG | Apa I |
| luxL-down | TTGGGCCCTTATTATAATATAAGC | Apa I |
| bgaB-fus | GGCGGGATCCTACGTAGGTACC | BamH I |
| insert-3 | TTGGATCCAGGTCAATGCTTTTC | BamH I |
| lux-2 | TTGGATCCTCTCTCCCCTCTAATCG | BamH I |
| apr-1 | TTGGGCCCTCAGGAGCATTTAAC | Apa I |
| apr-2 | CTCTATTTAGGTATATCATCTCTC | |
| apr-3 | TTGGGCCCTAAGAAAAATAGCATAC | Apa I |
| apr-4 | CTGTATATTCAGTTTAAGGGAAG | |
| apr-5 | TTGGGCCCTGCCAGGTTGAAG | Apa I |
| apr-6 | AAATAGAAGGATAATATAATCTATTCC | |
| apr-7 | TTGGGCCCAAAAATGGAAACAAAC | Apa I |
| apr-8 | GTAGACCCAATTTTTTTCAG | |
| insert1-up | TAGCGAGAGATGATACAAGAACGTCCTGATCTT | |
| insert2-up | TACTCTTATTTGCCTCAAGAACGTCCTGATCTT | |
| insert3-up | TATAATAAATTAACACAAGAACGTCCTGATCTT | |
| insert4-up | TAAAACAATCTGAAACAAGAACGTCCTGATCTT | |
| apr1-down | ATCAGGACGTTCTTGTATCATCTCTCGCTATTTC | |
| apr3-down | ATCAGGACGTTCTTGAGGCAAATAAGAGTAGACC | |
| apr5-down | ATCAGGACGTTCTTGTGTTAATTTATTATAGAA | |
| apr7-down | ATCAGGACGTTCTTGTTTTCAGATTGTTTTATTTC | |
| laps-down | TTGAATTCCTCTCTCCCCTCTAATCG | EcoR I |
| Tag-1 | CTAGACATCATCATCATCATCACAGCTAAATAAGAGCT | |
| Tag-2 | CTTATTTAGCTGTGATGATGATGATGATGT | |
| bgaB-3 | GCGGAATTCATGAATGTGTTATCCTC | EcoR I |
| bgaB-T | TTGGATCCAACCTTCCCGGCTTCATC | BamH I |
| bioI-1 | TTGAATTCGTGACAATTGCATCGTC | EcoR I |
| bioI-2 | TTGGATCCCACATTCTTAGGCTTATTC | BamH I |
| bioI-3 | TTTCTAGATTCAAAAGTCACCGGCAG | Xba I |
Construction of a promoter trap vector
Using the primer pair bgaB-1 and bgaB-2, the bgaB coding region was PCR amplified from the plasmid pDL [6]. The amplified fragment was flanked by BamH I and Sac I at 5′ and 3′ ends, respectively. The promoter trap vector was assembled as follows. Firstly, the obtained bgaB digested by BamH I and Sac I was cloned into corresponding sites of pGJ103, yielding pGJ-Bga. Then, the Apa I-BamH I-treated spectinomycin resistance gene, which was PCR amplified from the pDG1728 [26] using the primer pair spec-1 and spec-2, was inserted into corresponding sites of pGJ-Bga, resulting in a promoter trap vector pShuttleF.
Cloning of promoter fragments
The genomic DNA of B. licheniformis was partially digested with Sau3A I, and then ligated with the promoter trap vector pShuttleF treated with the BamH I and alkaline phosphatase. The ligation mixture was transformed into E. coli DH5α and recombinants harbouring promoter fragments were screened on the LB solid medium supplemented with X-Gal (20 µg/mL).
Sequencing and analysis
Promoters were sequenced by AuGCT Biotechnology (Beijing, China). The sequence analysis was performed online with NCBI blast 2.0 (www.ebi.ac.uk); promoter region was predicted by the BPROM program (Softberry Inc., Mount Kisco, NY, USA; http://linux1.softberry.com).
Sub-cloning of promoter regions
Using the primer pair P43-1/P43-2, the P43 promoter was PCR amplified from plasmid pB43. The resultant promoter fragment was digested with Apa I and BamH I, and cloned into corresponding sites of pShuttleF, resulting in pShuttle-P43. By means of primer pairs luxS-up/luxS-down, luxP-up/luxP-down and luxM-up/luxM-down, three luxS promoter fragments were cloned from genomic DNA of B. subtilis 1A747, B. pumilus BYG and B. megaterium W-5, respectively. The corresponding amplicons were then cloned into pShuttleF digested with Apa I and BamH I, generating pShuttle-luxS, pShuttle-luxP and pShuttle-luxM. Using insert-1/luxL-down as primers, the PluxS-i was amplified from pShuttle-09 and cloned into pShuttleF, resulting in pShuttle-luxi. The bgaB contained Shine–Dalgarno box (SD) was PCR amplified from pDL by using bgaB-fus and bgaB-2 and cloned into pshuttleF, resulting in pDET-1. Then, the hybrid promoter amplified from pShuttle-09 (using the primer pair insert-3/insert-2) was cloned into pDET-1 treated with Apa I and BamH I, resulting in pShuttle-Hyb. By using the primer pair lux-2/insert-2, an isolated promoter fragment (deletion of 5′ coding region of luxS) was amplified from pShuttle-09 and cloned into pShuttleF, yielding pShuttle-Fus1.
Reconstruction of cloned promoter
The reconstruction of promoter was carried out by the splicing by overlapping extension PCR. Four pairs of primers, apr-1/apr-2, apr-3/apr-4, apr-5/apr-6 and apr-7/apr-8, were employed to PCR amplified −35 region of promoter Papr (promoter for the alkaline protease gene) from genomic DNA of B. subtilis, B. pumilus, B. licheniformis and B. amyloliquefaciens, respectively, yielding PaprS-1, PaprP-1, PaprL-1 and PaprA-1. Four pairs of primers (insert1-up/Lux-2, insert2-up/Lux-2, insert3-up/Lux-2 and insert4-up/Lux-2) were used to amplify the PluxS and −10 region of the hybrid promoter from pShuttle-09. The upstream primers were designed about 15 bp sequence homogenous with 3′ end of PaprS-1, PaprP-1, PaprL-1 and PaprA-1, respectively, resulting in fragments luxF-1 to luxF-4. Other four pairs of primers (apr-1/apr1-down, apr-3/apr3-down, apr-5/apr5-down and apr-7/apr7-down) were employed to amplify promoters from PaprS-1, PaprP-1, PaprL-1 and PaprA-1respectively. The downstream primers were designed about 15 bp sequence homogenous with 5′end of −10 region of the hybrid promoter, resulting fragment PaprS-2, PaprP-2, PaprL-2 and PaprA-2. With the mixture pairs of PaprS-2/luxF-2, PaprP-2/luxF-3, PaprL-2/luxF-4 and PaprA-2/luxF-5 as templates, in which there were about 30 bp overlap in each mixture pair, four overlapping PCR amplifications were facilitated by means of apr-1/Lux-2, apr-3/Lux-2, apr-5/Lux-2 and apr-7/Lux-2, respectively. Recombined promoters PLapS, PLapP, PLapL and PLapA were digested with Apa I and BamH I and cloned into pShuttleF, respectively, resulting in pShuttle-PLapS, pShuttle-PLapP, pShuttle-PLapL and pShuttle-PLapA.
Construction of expression vectors
Using primers apr-1 and laps-down, the promoter PLapS flanked by Apa I and EcoR I was PCR amplified from pShuttle-PLapS. The resultant promoter was digested with Apa I and EcoR I and cloned into corresponding sites of pGJ103, yielding the expression vector pLus-Hyb. To introduce 6-His tag, synthetic oligonucleotides Tag-1 and Tag-2 were annealed. The annealed fragment with adhesive ends of Xba I and Sac I at 5′ and 3′ ends respectively was inserted into the Xba I-Sac I-treated pLus-Hyb, resulting in pLus-His.
Using primer pairs bgaB-3/bgaB-2 and bgaB-3/bgaB-T, two bgaB fragments were PCR amplified from pShuttleF, resulting in bgaF-1 flanked with EcoR I and Sac I and bgaF-2 with EcoR I and BamH I. bgaF-2 did not contain the termination codon. The bgaF-1 and bgaF-2 were cloned into pLus-Hyb and pLus-His, respectively, yielding pLu-bga and pLuHis-bga. Similarly, the bioI gene were PCR amplified from B. subtilis 1A747 genomic DNA by using primer pairs bioI-1/bioI-2 and bioI-1/bioI-3, resulting in bioIF-1 with EcoR I and BamH I and bioIF-2 with EcoR I and Xba I. The resultant fragments were inserted into pLus-Hyb and pLus-His, yielding pLu-bioI and pLuHis-bioI.
β-Gal activity assay
The β-Gal activity assay was carried out as previously described [27]. Samples were taken at different time points of culture and the β-Gal activity was measured. The activity was expressed as Miller units per mL sample (Miller U/mL). For each assay, three independent experiments were performed with two replicates. Statistical tests were carried out by the SPSS (Statistical Product and Service Solutions) software. Data are presented as means± S.D.
Results
Screening and isolation of the strong promoter fragments from B. licheniformis chromosomal DNA
To screen and isolate strong promoter elements, a promoter trap vector pShuttleF (Figure 1A) was constructed on an E. coli-B. subtilis shuttle vector pGJ103. The pShuttleF contained bgaB coding for a heat stable β-galactosidase (β-Gal) as a reporter gene. In addition, an alternative resistance selection marker, spectinomycin, was introduced into the pShuttleF beside the chloramphenicol resistance marker. Both spectinomycin and chloramphenicol resistance genes could confer the resistance selection either in E. coli or B. subtilis. Finally, an engineered BamH I restriction site was designed next to the start codon of bgaB in order to clone DNA fragments digested by the Sau3A I. Validation of the pShuttleF was achieved by inserting a commonly used strong promoter P43 (2, 6) in B. subtilis upstream of bgaB. The resultant pShuttle-P43 was transformed into E. coli DH5α and B. subtilis 1A747 and blue colonies on solid LB plate supplemented with X-gal were isolated. The bgaB directed by the P43 in pShuttleF was duly expressed in E. coli and B. subtilis (Figures 1B and 1C).
Figure 1. A map of the promoter trap vector pShuttleF (A) and β-Gal activities of 10 selective positive clones in E. coli (B) and B. subtilis (C).
(A) The rep represents the replication protein in B. subtilis. ColEI, bgaB and Cm represent the E. coli ColEI replicon, the coding sequence of β-Gal and chloramphenicol-resistance marker, respectively. The unique restriction sites are marked on the outside of the map. (B). Production of β-Gal from 10 selective positive clones in E. coli DH5α after 24 h culture. Different letters on columns indicate significant differences (p<0.05). (C). Production of β-Gal from 10 selective positive clones in B. subtilis 1A747 after 24 h culture. Different letters on columns indicate significant differences (p<0.05).
In order to identify new promoters, Sau3A I-digested B. licheniformis DNA fragments were inserted into the BamH I site of the promoter trap vector pShuttleF and resultant plasmids were electro-transformed into E. coli DH5α. Two hundred colonies were picked from about 1000 colonies according to visible coloration on the X-gal screen plate in the presence of both antibiotics. The β-Gal activities by these recombinants after 24 h of culture ranged from 500 Miller U/mL to 14016 Miller U/mL. Amongst them, the recombinant pShuttle-09 demonstrated the highest β-Gal production. The selected 200 colonies were also electro-transformed into the B. subtilis1A747. Ten blue colonies were selected to measure the β-Gal activities. As shown in Figure 1C, pShuttle-09 again showed the highest β-Gal activity with the activity of 16417±300 Miller U/mL at 24 h, which was eight times of that from the P43 promoter system in B. subtilis. To further verify the reporter gene product driven by pShuttle-09, SDS-PAGE analysis of the β-Gal from the pShuttle-09 both in E. coli and B. subtilis was carried out. Coomassie blue staining revealed a distinct band with a molecular mass of approximately 70 kDa, which corresponded to the molecular weight of β-Gal (data not shown). Taken together, these results suggested that pShuttle-09 contained a putative strong promoter from B. licheniformis chromosomal DNA and drove expression of the reporter gene both in E. coli and B. subtilis.
Sequence analysis, predication and characterization of the cloned promoter fragment
To characterize the putative promoter DNA element in pShuttle-09, the inserted fragment was enzyme cut and sequenced. The sequencing result showed that the inserted fragment was 305 bp long. Sequence alignment showed that the inserted sequence in pShuttle-09 belonged to B. licheniformis genome sequence (NC_CP000002.3) with 96% of homology. According to the annotation of B. licheniformis genomic DNA sequences, the inserted sequence contained two fragments (Figure 2A) corresponding to a partial sequence of the coding region of ylyB gene (about 109 bp) and a 5′end partial sequences of luxS (about 200 bp).
Figure 2. A map (A) and the sequence (B) of an inserted fragment in pShuttle-09.
(A) ylyb CDS is the coding sequence of ylyb; luxS CDS represents the coding sequence of luxS; Partial luxS includes 5′ non-translated region and an 87 bp coding sequence of luxS. (B) The conservative regions of two putative promoter (−10 and −35) are underlined. The Sau3AI restriction sites are indicated. The beginnings of open reading frames of luxS and bgaB under the putative promoters are indicated by arrows.
Sequence analyses (Figure 2B) also showed truncated luxS gene was fused with bgaB and a typical SD was present 7 bp upstream of the start codon of the luxS gene. It contained typical −35 and −10 elements recognized by a Sigma Factor σA. Therefore, the promoter PluxS might be the control element of bgaB in pShuttle-09. However, further in silico prediction of promoters (Figure 2B) indicated two conserved prokaryotic promoter regions with high probability scores in the cloned fragment. The first putative promoter (PluxS) was located in the 5′ non-translational region of luxS gene. Interestingly, the second putative promoter was located on two sides of the second Sau3A I-cutting site in pShuttle-09. The −35 element was located within the coding region of ylyB, while the −10 element was located upstream of the core promoter region of luxS.
In order to determine the effect of the first putative promoter (PluxS) on the reporter gene expression, a PluxS-i vector was constructed by sub-cloning a 200 bp PluxS fragment into pShuttleF. For facilitating a rigorous comparison, promoters of luxS were also cloned from genomic DNA of B. subtilis, B. pumilus and B. megaterium. The β-Gal production driven by PluxS from B. subtilis, B. pumilus and B. megaterium were about 78%, 63% and 70% of that from B. licheniformis (Figure 3A), respectively. However, the β-Gal production driven by PluxS from B. licheniformis was only about 27% of that from pShuttle-09 in B. subtilis (Figure 3A). These data strongly suggested that PluxS is not a major promoter for β-Gal expression in pShuttle-09.
Figure 3. β-Gal activities from PluxS (A), the hybrid promoter (B) and the reconstructed promoters (C).
(A) Production of β-Gal from pShuttle-09, pShuttle-luxi, pShuttle-luxS, pShuttle-luxP and pShuttle-luxM in B. subtilis 1A747 after 24 h culture. Different letters on columns indicate significant differences (p<0.05). (B) Production of β-Gal from pShuttle-Hyb (gray columns) and pShuttle-Fus1 (black columns) in B. subtilis 1A747 after different hours of culture. Different letters on columns in the same time point indicate significant differences (p<0.05). (C) Production of β-Gal from pShuttle-Fus1, pDE-PLapS, pDE-PLapP, pDE-PLapL and pDE-PLapA in B. subtilis 1A747 after 24 h culture. Different letters on columns indicate significant differences (p<0.05).
Analysis of the second putative promoter showed the −10 region was located at 6 bp in the second Sau3A I-cutting region and −35 region was located at 86 bp in the first Sau3A I-cutting region in pShuttle-09. A partial sequence of the coding sequence of the ylyB gene by itself could not have the promoter activity, since it did not contain complete promoter elements. It appears that the hybrid promoter was unintentionally created in pShuttle-09. Subsequently, this hybrid promoter was sub-cloned to determine whether it can direct the expression of β-Gal or not. As shown in Figure 3B, the β-Gal production driven by the hybrid promoter was about 67% of that from pShuttle-09 in B. subtilis. It seems that both the hybrid promoter and PluxS contributed additively to expression of β-Gal in pShuttle-09.
Improvement of the cloned double promoter through reconstruction of the hybrid promoter element
In order to further improve efficacy of the double promoter, the second Sau3A I-cutting region containing PluxS and another −10 region was assembled with −35 regions of PApr from B. subtilis, B. pumilus, B. licheniformis and B. amyloliquefaciens, respectively. The corresponding promoters, PLapS, PLapP, PLapL and PLapA, were used to drive the expression of β-Gal. The results (Figure 3C) indicated that β-Gal activity driven by PLapS was 1.6 fold higher than that from pShuttle-09 after 24 h culture. On the other hand, the production of β-Gal from PLapA, PLapP and PLapL was only about 81%, 32% and 33% of that from pShuttle-09, respectively. Subsequently, PLapS was used for construction of expression vectors.
Construction of expression vector using the improved promoter PLapS
To further exploit its application in B. subtilis, the strong promoter PLapS was sub-cloned as a truncated fragment flanked with engineered Apa I and EcoR I restriction sites, with the EcoR I site close to the SD. The resultant promoter was assembled to E. coli-B. subtilis shuttle vector pGJ103, generating an expression vector pLus-Hyb (Figure 4A). In order to easily detect and purify expressed protein, another vector pLus-His (Figure 4B) was constructed through introducing 6-his tag at the end of MCS in pLus-Hyb.
Figure 4. Maps of expression vectors pLus-Hyb (A), pLus-His (B), the β-Gal activity from the pLu-bga (C), SDS-PAGE analyses of BgaB in crude extract (D) or after purification (E).
(A) ORI+, ORI− and rep represent the single-strand replication origin, the double strand origin and the replication protein in B. subtilis, respectively. ColEI and Cm represent the E. coli ColEI replicon and a chloramphenicol-resistance marker. The unique restriction sites are marked on the outside of the map. PLapS represent the improved promoter. (B) His Tag represents the 6 histidine tag. (C) Production of β-Gal from pShuttle-Fus1 (◊) and pLu-bga (♦) in B. subtilis 1A747, respectively. (D) Lane 1, molecular mass markers (top to bottom: 116, 66, 45, 35 and 25 kDa); Lanes 2, 3 and 4, crude extract of three replicate cultures of B. subtilis 1A747 harbouring pLu-bga harvested at 24 h; lane 5, crude extract of B. subtilis 1A747 harbouring pLus-Hyb as a negative control. (E) Lanes 1 and 2, purified β-Gal from B. subtilis 1A747 harbouring pLuHis-bga; Lane 3, molecular mass markers (top to bottom: 116, 66, 45, 35 and 25 kDa).
To determine efficiencies of pLus-Hyb and pLus-His, bgaF-1 and bgaF-2 were cloned into pLus-Hyb and pLus-His, respectively, to facilitate β-Gal expression. The production of β-Gal from the pLu-bga reached 26037±1037 Miller U/mL (Figure 4C), indicating that the β-Gal was highly expressed. SDS-PAGE analyses of β-Gal from crude extract of B. subtilis harbouring pLu-bga (Figure 4D) or purified β-Gal from B. subtilis harbouring pLuHis-bga (Figure 4E) further verified that β-Gal was successfully expressed. Similarly, bioI gene involved in biotin biosynthesis pathway of B. subtilis was successfully expressed by using two similar expression vectors (pLu-biol and pLuHis-biol) in B. subtilis (Figure 5). Therefore, these results further demonstrated the effectiveness of the promoter systems for protein expression.
Figure 5. Wavelength scan analysis of Biol production from B. subtilis1A747 harbouring pLu-bioI (A) and SDS-PAGE analyses of Biol production from crude extract or purified Biol of B. subtilis1A747 harbouring pLu-bioI and pLuHis-bioI, respectively (B).
(A) The arrow indicating the characteristic absorption peak of BioI. (B) Lane 1, crude extract of B. subtilis 1A747 harbouring pLus-Hyb as a negative control; Lane 2, crude extract of B. subtilis 1A747 harbouring pLu-bioI; Lane 3, molecular mass markers (top to bottom: 116, 66, 45, 35 25 and 18 kDa); Lanes 4 and 5, purified β-Gal from B. subtilis 1A747 harbouring pLuHis-bioI.
Discussion
The major finding from this study is that an artificial double promoter was obtained from B. licheniformis through a promoter trap system. The double promoter contained PluxS and a hybrid promoter and can be used for protein expression in B. subtilis. These results support the notion that it is possible to shuffle, generate and select a strong prokaryotic promoter simultaneously, by applying a promoter trap system to randomly cut DNA fragments from a genome.
The interest in promoters stems from myriad opportunities for controlling gene expression. Our promoter trap system was designed to increase the stringency of screening by employing the coding region of bgaB rather than the bgaB gene with a SD as a reporter. So far, the promoter-less bgaB gene has been used as a reporter in several promoter trap systems [11], [22]. However, others usually used bgaB gene with a SD. In our system, promoter fragments inserted into the upstream of bgaB could not drive expression of β-Gal unless the cloned promoter fragments contain SD. This design might limit the number of recombinant clones which can be screened. Nevertheless, approximately 1000 blue recombinant colonies were observed in this study. The strength of cloned promoters was conveniently determined via coloration caused by production of β-Gal when a recombinant harbouring a promoter fragment was cultured on solid LB supplemented with X-gal. Further quantitative determination of putative promoter strength was easily achieved by measuring the activity of β-Gal.
B. licheniformis genomic DNA was used as a potential promoter source in this study. Recombinant protein expression in B. subtilis can be driven by promoters from B. subtilis or from other bacillus species. To date, several strong exogenous promoters for the B. subtilis system have been isolated and used to construct expression vectors [3], [12], [28]. For example, exogenous promoters Pxyl and Pspac have been widely used as expression control elements in B. subtilis [12], [28]. Our results support the notion that other bacillus species could be good sources of strong promoters for B. subtilis.
Our results exemplified the potential of a promoter trap system to create a strong hybrid promoter. A hybrid promoter is defined in this study as a promoter consisting of different core elements from two different genes. One promoter identified in this study is a hybrid promoter assembled artificially from a −35 region from the coding sequence of ylyB gene and a −10 element from non-coding sequence of luxS gene. Our hybrid promoter is artificially created and quite different from reported hybrid promoters, which contain elements from two different promoters. It is well known that a hybrid promoter could be far more efficient than either one of the parental promoters [29]. Recently, Kim [30] constructed a hybrid promoter, BJ27UP, from a strong promoter BJ27D88 and a fragment of the tac promoter in order to express B. licheniformis aminopeptidase in B. subtilis and found that the activity of the hybrid promoter was increased approximately threefold in comparison with the tac promoter. Nevertheless, the study on hybrid promoters is limited, presumably due to lack of suitable ways to create hybrid promoters.
The results from this study also demonstrated the capability of a promoter trap system to create a double promoter. Interestingly, both the hybrid promoter and PluxS promoter in our study contributed to transcription of the reporter gene in an additive way. A double promoter in this study is defined as the combination of two promoters which control transcription of same gene. This definition is different from most overlapping promoters often seen in bacteria. Analyzing the database of the E. coli genome, Bendtsen [31] found 14% of the identified ‘forward’ promoters overlap with a promoter oriented in the opposite direction. These overlapping promoters are arranged in three different ways: (i) each promoter transcribes a gene and one or more regulatory proteins are identified which affect transcription of at least one of the promoters directly; (ii) each promoter transcribes a gene but no regulatory proteins are known to bind the promoter region; and (iii) only one of the promoters transcribe an annotated gene, while the other promoter could transcribe a regulatory antisense RNA or act as a regulatory RNAP binding site which interferes with the promoter transcribing the annotated gene [31]. However, some overlapping promoters do control same gene. For example, Wang and Doi [32] detected two overlapping promoters for the chloramphenicol acetyltransferase gene and these two promoters were recognized by two different RNA polymerase holoenzymes. The authors further proposed that genes expressed during both growth and sporulation may be regulated by tandem overlapping promoters whose transcription initiation points are either identical or very close. The possible benefit of double promoters to increase transcription has been explored in biotechnological application. Most studies have showed that two or more tandem promoters could significantly improve the expression level of heterogeneous genes. Widner [33] found that gene expression was distinctly increased under the control of two or three tandem promoters in contrast to one alone in B. subtilis. Kang [34] also reported that two expression systems constructed by sequential alignment of a constitutive promoter for either α-amylase from B. subtilis NA64 or maltogenic amylase from B. licheniformis downstream of the Hpa II promoter elevated the TSaGT productivity by 11- and 12-fold, respectively, in comparison with the single Hpa II promoter system. Li [35] tried to construct multiple core-tac-promoters (MCPtacs) in tandem and found that integration of the phaCAB genes with the 5 copies of core-tac-promoters resulted in an engineered E. coli that can accumulate 23.7% polyhydroxybutyrate of the cell dry weight in batch cultivation. On the other hand, Wu [36] did not observe improvement of expression, when two tandem-linked promoters were used. Our results support the idea to use double promoters to increase production efficiency of recombinant proteins. Whether the double promoter in this study is targeted by same RNA polymerase or different RNA polymerases is not known at this time and worthy of further investigation.
In conclusion, our data support the concept of using a promoter trap system to discover new promoters. The usefulness of a promoter trap system is likely due to random shuffling and recombination of DNA fragments and adoption of a rapid and high-throughput screening. It is tempting to speculate that more novel promoters could be found if reaction conditions for cutting and ligation could be adjusted to increase chances for shuffling DNA fragments.
Funding Statement
This work was supported by grants from Chinese National Natural Science Foundation (30871813 and 31072060). The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Schallmey M, Singh A, Ward OP (2004) Developments in the use of Bacillus species for industrial production. Can J Microbiol 50: 1–17. [DOI] [PubMed] [Google Scholar]
- 2. Zhang XZ, Cui ZL, Hong Q, Li SP (2005) High-level expression and secretion of methyl parathion hydrolase in Bacillus subtilis WB800. Appl Environ Microbiol 71: 4101–4103. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Schumann W (2007) Production of recombinant proteins in Bacillus subtilis . Adv Appl Microbiol 62: 137–189. [DOI] [PubMed] [Google Scholar]
- 4. Nguyen HD, Schumann W (2006) Novel plasmid-based expression vectors for intra- and extracellular production of recombinant proteins in Bacillus subtilis . Prot Expr Purif 46: 189–195. [DOI] [PubMed] [Google Scholar]
- 5. Lee SJ, Pan JG, Park SH, Choi SK (2010) Development of a stationary phase-specific autoinducible expression system in Bacillus subtilis . J Biotechnol 149: 16–20. [DOI] [PubMed] [Google Scholar]
- 6. Yang MM, Zhang WW, Zhang XF, Cen PL (2006) Construction and characterization of a novel maltose inducible expression vector in Bacillus subtilis . Biotechnol Lett 28: 1713–1718. [DOI] [PubMed] [Google Scholar]
- 7. Zhu FM, Ji SY, Zhang WW, Li W, Cao BY, et al. (2008) Development and Application of a Novel Signal Peptide Probe Vector with PGA as Reporter in Bacillus subtilis WB700: Twenty-Four Tat Pathway Signal Peptides from Bacillus subtilis were monitored. Mol Biotechnol 39: 225–230. [DOI] [PubMed] [Google Scholar]
- 8. Meijer WJJ, Salas M (2004) Relevance of UP elements for three strong Bacillus subtilis phage phi29 promoters. Nucleic Acids Res 32: 1166–1176. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Zhang AL, Liu H, Yang MM, Gong YS, Chen H (2007) Assay and characterization of a strong promoter element from B. subtilis . Biochem Biophys Res Commun 354: 90–95. [DOI] [PubMed] [Google Scholar]
- 10. Li W, Li HX, Ji SY, Li S, Yang MM, et al. (2007) Characterization of two temperature-inducible promoters newly isolated from B. subtilis . Biochem Biophys Res Commun 358: 1148–1153. [DOI] [PubMed] [Google Scholar]
- 11. Phan TT, Nguyen HD, Schumann W (2012) Development of a strong intracellular expression system for Bacillus subtilis by optimizing promoter elements. J Biotechnol 157: 167–72. [DOI] [PubMed] [Google Scholar]
- 12. Bhavsar AP, Zhao XM, Brown ED (2001) Development and characterization of a xylose-dependent system for cloned gene in Bacillus subtilis: conditional complementation of a Teichoic acid mutant. Appl Environ Microbiol 67: 403–410. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Heravi KM, Wenzel M, Altenbuchner Josef (2011) Regulation of mtl operon promoter of Bacillus subtilis: requirements of its use in expression vectors. Microb Cell Fact 10: 83. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Yang MM, Zhang WW, Chen YL, Gong YS (2010) Development of a Bacillus subtilis expression system using the improved Pglv promoter. Microb Cell Fact 9: 55. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Sun T, Altenbuchner J (2010) Characterization of a mannose utilization system in Bacillus subtilis . J Bacteriol 192: 2128–2139. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Rhodius VA, Mutalik VK (2010) Predicting strength and function for promoters of the Escherichia coli alternative sigma factor, sigmaE. Proc Nat Acad Sci 107: 2854–2859. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Kaltwasser M, Wiegert T, Schumann W (2002) Construction and Application of Epitope- and Green Fluorescent Protein-Tagging Integration Vectors for Bacillus subtilis . Appl Environ Microbiol 68: 2624–2628. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Gat O, Inbar I, Aloni-Grinstein R, Zahavy E, Kronman C, et al. (2003) Use of a Promoter Trap System in Bacillus anthracis and Bacillus subtilis for the Development of Recombinant Protective Antigen-Based Vaccines. Infect Immun 71: 801–813. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Cui ZL, Zhang XZ, Zhang ZH, Li SP (2004) Construction and application of a promoter-trapping vector with methyl parathion hydrolase gene mpd as the reporter. Biotechnol Lett 26: 1115–1118. [DOI] [PubMed] [Google Scholar]
- 20. Aoki S, Kondo T, Ishiura M (2002) A promoter-trap vector for clock-controlled genes in the cyanobacterium Synechocystis sp. PCC 6803. J Microbiol Methods 49: 265–274. [DOI] [PubMed] [Google Scholar]
- 21. James AC, Philip ES, Patricia R, Abdallah FE, Claude FG (2003) An enhanced GFP reporter system to monitor gene expression in Borrelia burgdorferi. Microbiol 149: 1819–1828. [DOI] [PubMed] [Google Scholar]
- 22. Phan TT, Nguyen HD, Schumann W (2010) Establishment of a simple and rapid method to screen for strong promoters in Bacillus subtilis . Prot Expr Purif 71: 174–178. [DOI] [PubMed] [Google Scholar]
- 23. Wang YG, Xia QY, Gu WL, Sun JB, Zhang H, et al. (2011) Isolation of a strong promoter fragment from endophytic Enterobacter cloacae and verification of its promoter activity when its host strain colonizes banana plants. Appl Microbiol Biotechnol 93: 1585–1599. [DOI] [PubMed] [Google Scholar]
- 24.Maniatis T, Fritsch EF, Sambrook J. (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbour Laboratory Press, Cold Spring Harbour, NY
- 25. Yang MM, Zhang WW, Bai XT, Li HX, Cen PL (2010) Electroporation is a feasible method to introduce circularized or linearized DNA into B. subtilis chromosome. Mol Biol Rep 37: 2207–2213. [DOI] [PubMed] [Google Scholar]
- 26. Guerot-Fleury AM, Frandsen N, Stragier P (1996) Plasmids for ectopic integration in Bacillus subtilis . Gene 180: 57–61. [DOI] [PubMed] [Google Scholar]
- 27. Hirata H, Fukazawa T, Negoro S, Okada H (1986) Structure of a β-galactosidase gene of Bacillus stearothermophilus . J Bacteriol 166: 722–727. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Hartl B, Wehrl W, Wiegert T, Homuth G, Schumann W (2001) Development of a new integration site within the Bacillus subtilis chromosome and construction of compatible expression cassettes. J Bacteriol 183: 2696–2699. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. de Boer HA, Comstock LJ, Vasser M (1983) The tac promoter: a functional hybrid derived from the trp and lac promoters. Proc Nat Acad Sci 80: 21–25. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Kim JH, Lee BR, Lee YP (2011) Secretory overproduction of the aminopeptidase from Bacillus licheniformis by a novel hybrid promoter in Bacillus subtilis . World J Microbiol Biotechnol 27: 2747–2751. [Google Scholar]
- 31. Bendtsen KM, Erdossy J, Csiszovszki Z, Svenningsen SL, Sneppen K, et al. (2011) Direct and indirect effects in the regulation of overlapping promoters. Nucleic Acids Res 39: 6879–6885. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Wang PZ, Doi RH (1984) Overlapping promoters transcribed by Bacillus subtilis sigma 55 and sigma 37 RNA polymerase holoenzymes during growth and stationary phases. J Biol Chem 259: 8619–8625. [PubMed] [Google Scholar]
- 33. Widner B, Thomas M, Sternberg D, Lammon D, Behr R, et al. (2000) Development of marker-free strains of Bacillus subtilis capable of secreting high levels of industrial enzymes. J Ind Microbiol Biotechnol 25: 204–212. [Google Scholar]
- 34. Kang HK, Jang JH, Shim JH, Park JT, Kim YW, et al. (2010) Efficient constitutive expression of thermostable 4-α-glucanotransferase in Bacillus subtilis using dual promoters. World J Microbiol Biotechnol 26: 1915–1918. [Google Scholar]
- 35. Li MJ, Wang JS, Geng YP, Li YK, Wang Q, et al. (2012) A strategy of gene overexpression based on tandem repetitive promoters in Escherichia coli . Microb Cell Fact 11: 19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Wu SM, Feng C, Zhong J, Huan LD (2011) Enhanced production of recombinant nattokinase in Bacillus subtilis by promoter optimization. World J Microbiol Biotechnol 27: 99–106. [Google Scholar]





