Abstract
Mature mammalian sperm contain a complex population of RNAs some of which might regulate spermatogenesis while others probably play a role in fertilization and early development. Due to this limited knowledge, the biological functions of sperm RNAs remain enigmatic. Here we report the first characterization of the global transcriptome of the sperm of fertile stallions. The findings improved understanding of the biological significance of sperm RNAs which in turn will allow the discovery of sperm-based biomarkers for stallion fertility. The stallion sperm transcriptome was interrogated by analyzing sperm and testes RNA on a 21,000-element equine whole-genome oligoarray and by RNA-seq. Microarray analysis revealed 6,761 transcripts in the sperm, of which 165 were sperm-enriched, and 155 were differentially expressed between the sperm and testes. Next, 70 million raw reads were generated by RNA-seq of which 50% could be aligned with the horse reference genome. A total of 19,257 sequence tags were mapped to all horse chromosomes and the mitochondrial genome. The highest density of mapped transcripts was in gene-rich ECA11, 12 and 13, and the lowest in gene-poor ECA9 and X; 7 gene transcripts originated from ECAY. Structural annotation aligned sperm transcripts with 4,504 known horse and/or human genes, rRNAs and 82 miRNAs, whereas 13,354 sequence tags remained anonymous. The data were aligned with selected equine gene models to identify additional exons and splice variants. Gene Ontology annotations showed that sperm transcripts were associated with molecular processes (chemoattractant-activated signal transduction, ion transport) and cellular components (membranes and vesicles) related to known sperm functions at fertilization, while some messenger and micro RNAs might be critical for early development. The findings suggest that the rich repertoire of coding and non-coding RNAs in stallion sperm is not a random remnant from spermatogenesis in testes but a selectively retained and functionally coherent collection of RNAs.
Introduction
Mammalian sperm are considered terminally differentiated and functionally dormant cells with the sole purpose of delivering the paternal genome into the zygote [1], [2]. Therefore, early claims about the presence of RNA in mouse [3], bull [4], rat and human sperm [5] were met with skepticism. However, research over the past decade has provided compelling evidence that mature mammalian sperm contain complex populations of RNAs [1], [2], [6], [7], [8], [9]. These include over 3,000 mRNAs [6], [8], and a heterogeneous population of small and long non-coding RNAs [8], [10], [11], [12], [13], [14], though typically sperm are depleted of intact ribosomal RNAs [6].
The functions of sperm RNAs remain a subject of debate. The initial opinion was that sperm RNAs have no functions of their own and are simply residues of spermatogenesis, reflecting the events that occurred during their formation in the testes [1]. This may be partially valid, although recent discoveries have essentially expanded these views showing that sperm mRNAs constitute a population of stable full-length transcripts, many of which are selectively retained during spermatogenesis [6], [11]. Some mRNAs are thought to have a role in sperm chromatin reorganization by setting up boundaries between protamine- and histone-packaged DNA [11], [15]. Some mRNAs/cDNAs can be sperm-borne via transcription and reverse-transcription [10], [16]. It has been reported that sperm mRNAs can be de novo translated using mitochondrial-type ribosomes during capacitation [17], [18], [19]. Both sperm mRNAs and micro RNAs (miRNAs) are involved in non-Mendelian inheritance, serving as transgenerational epigenetic signals for zygotic gene regulation [20], [21], [22]. Furthermore, a few RNAs have been found only in the sperm and the zygote, but not in the oocyte, providing evidence for a unique paternal contribution [23], [24].
Even though the functions of the majority of the sperm RNAs remain enigmatic, it has been proposed that sperm transcriptional profiles might provide clinical markers for male fertility [1], [11]. Moreover, the non-invasive sample procurement through semen collection makes the approach particularly attractive. Indeed, an increasing number of studies in humans demonstrate that sperm mRNA profile can serve as a molecular diagnostic platform for evaluating male fertility [1], [9], [25], [26]. Consistent and biologically relevant qualitative and quantitative differences are present between the sperm RNAs of fertile men and men with abnormal reproductive phenotypes, such as skewed protamine ratios [27], teratozoospermia [26], cryptorchidism [28], reduced sperm motility [29], and idiopathic infertility [30], [31]. Similarly, sperm transcriptome studies have been initiated in bulls [29], [32], [33], [34] and boars [23], [35], [36] showing differences between the mRNA profiles of high- and low fertility bulls [34]. Analysis of porcine sperm, oocytes and two-cell embryos reveal that mRNAs of some genes, viz., CLU, PRM1 and PRM2 are delivered to the zygote exclusively by the sperm [23].
Despite the promising diagnostic potential of sperm RNAs for male fertility, the approach has found only limited attention in stallions [37], [38]. At the same time, poor fertility of breeding stallions is a recognized concern in the equine industry. While foal crop and stud fees form a principal component of the economy of the industry, stallions are typically selected on the basis of their ancestry and performance, and not for their reproductive potential [39]. As a result, about 36–43% of prospective breeding stallions do not pass the breeding soundness tests [40], [41].
The goal of this study was to obtain detailed information about the RNAs present in the sperm of normal fertile stallions to improve understanding of the biological significance of sperm RNAs and to establish a foundation for the discovery of sperm-based biomarkers for stallion fertility.
Results
Expression microarray analysis
Gene expression microarray analysis revealed 6,761 gene/EST transcripts in stallion sperm and 11,112 in the testes. The majority (97%) of the sperm transcripts were shared with the testes, while surprisingly, 165 transcripts were detected (at signal-to-noise ratio, SNR ≥2) only in the sperm and not in the testes, and are referred to as sperm-enriched transcripts.
Gene Ontology (GO) annotations were found for 3,319 (49%) sperm transcripts and grouped according to biological process (2,136; 78.9%), molecular function (1,503; 55.5%) and cellular component (2,270; 83.8%) (Table S1). The sperm transcripts were most significantly (p<0.001) involved in chemoattractant-activated signal transduction pathways, viz., sensory perception and G-protein coupled signaling, and ion transport related biological processes. The most prevalent molecular functions were related to ion-, nucleotide-, and chromatin binding and the associated cellular components were membranes and vesicles (Table S2). These functional categories were also represented among the 165 sperm-enriched transcripts, though with lower significance values because of fewer genes analyzed (Table S3). In contrast, testes transcripts were localized in all cellular compartments and involved in diverse molecular functions and biological processes (data not shown).
Comparison of the expression of the 6,596 transcripts common for the sperm and the testes (Fig. 1) identified 155 genes/transcripts that were differentially expressed (DE) between them. Of these, 60 were up-regulated (fold change; FC>2; p<0.05) and 95 were down-regulated (FC<−2; p<0.05) in the sperm (Table S4). Gene ontology terms could be determined for 37 up-regulated and 47 down-regulated transcripts showing that the former were involved in cell motility and cytoskeleton functions, while the latter were associated with functions in translation and non-membrane-enclosed organelles, e.g., ribosomes (Fig. 2). Microarray results for the most significant (p<0.005) DE genes were confirmed by quantitative RT-PCR (qRT-PCR) (Fig. 3; Fig. S1; Table 1).
Figure 1. Venn diagram of transcripts detected in stallion sperm and testes by microarray analysis (SNR ≥2).

Figure 2. Heat maps of GO functional groups for sperm up-regulated (a) and sperm down-regulated (b) transcripts.
Blue boxes denote that the gene has not been associated with the corresponding GO category. Genes with symbols in red font were validated by qRT-PCR.
Figure 3. Validation of significantly (p<0.05) sperm up-regulated (a) and sperm down-regulated (b) genes by qRT-PCR (see also Table 1).
Table 1. Selected most significantly (p<0.005) differentially expressed genes between stallion sperm and testes by microarray analysis and qRT-PCR (see also Fig. 3).
| Gene symbol | DE | Primers for qRT-PCR 5′-3′ | Function: GeneCards:http://www.genecards.org/ |
| PADI6 | up | F: GATTGTGATGGGCAAGAACC | Embryonic development |
| R: AGCAGCTGGCAGATCTTTTC | |||
| DNAJC16B | up | F: GAGAAGCAGGGCTACCAGAA | Unannotated |
| R: TCTTTCCAAACAGGCTCGAT | |||
| DCDC2 | up | F: TGGCTTTTACCTGTGGGTCT | Sperm motility-sperm flagellum outer layer |
| R: TACACCAGCACGCTCTTCAC | |||
| CTTN | up | F: CTGGAACCCGTGTACAGCA | Sperm structure -organizing the cytoskeleton |
| R: GCCTCCGTGCTTTCATAGAC | |||
| REEP6 | up | F: GGCTTCCTGTTGTTCTGCAT | Sperm structure-outer dense fiber of sperm tails |
| R: CACTGCCTCGTGATGCTTTA | |||
| ARID5B | up | F: GCTTGCACGGACCTTACATT | Regulation-regulator of smooth muscle cell differentiation and proliferation, defects in male reproductive organs; cryptorchid phenotype |
| R: GGAGTGTCTTCTGGGAGGAA | |||
| ATG12 | up | F: TGGCAGTGATGGTAAACTGG | Regulation-bulk-protein degradation pathway, essential for autophagosomal formation |
| R: CCACAAGTCTCTTGCCACAA | |||
| GSTA1 | down | F: GGAAGTTTGATGTTCCAGCA | Regulation-cytosolic and membrane bound- detoxification of electrophilic compounds |
| R: GTATTTGGCGGCGATGTAGT | |||
| DYNTL1 | down | F: GCCTACCAGCACAGCAAAGT | Sperm structure -minus-end, microtubule-based motile processes |
| R: TTAAACGGTTTTCCCAGCTT | |||
| SPA17 | down | F: TCCAAGGAGATGTCGATTCC | Surface protein -sperm surface zona pellucida binding protein |
| R: GTTGCTCCCTCAGAATCTCG | |||
| PRPSAP1 | down | F: CTGATCATGGCTTACGCTCT | Regulation-negative regulation of 5-phosphoribose 1-diphosphate synthesis |
| R: ATGGAACCCCTCTTCCTCAT |
RNA sequence analysis
Mapping RNA sequence reads in the equine genome
Next generation sequencing (NGS) of total RNA from the sperm of two reproductively normal stallions generated about 70 million raw reads and more than 3 Gb of sequence per sample; over half of these aligned with the EcuCab2 [42] reference genome (Table 2). Average coverage (AC; normalized number of transcripts) values could be calculated for over 30 million reads that mapped to all equine chromosomes, including ChrUn and the mitochondrial genome (Table 2, Table S9), whereas 19,257 sequence tags with AC ≥1 were uniquely mapped to specific locations in the horse genome (Table 2). Of these, 14,982 map locations were shared between the two samples, while 2,188 and 2,087 were unique to sample 1 and sample 2, respectively (Fig. 4a). These differences could be due to a combination of individual and technical variations, and justified the use of two biological replicates in this study. Genomic locations of all mapped tags together with their absolute and relative AC values are presented in Table S5. The data are deposited in NCBI Gene Expression Omnibus [43], [44] and are accessible through GEO series accession number GSE38725 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE38725).
Table 2. Summary statistics for stallion sperm RNA-seq.
| Number of: | Sperm 1 | Sperm 2 |
| Raw reads | 64,488,380 | 76,386,416 |
| Base-pairs | 3,224,419,000 | 3,819,320,800 |
| Reads aligned to EcuCab2 | 45,266,539 | 42,335,436 |
| Alignment % to EcuCab2 | 70.2 | 55.4 |
| Non-match reads | 19,221841 | 34,050,980 |
| Calculated total mapped reads* | 38,087,876 | 30,261,556 |
| Unique mapped reads** | 17,170 | 17,069 |
Aligned reads with calculated AC values.
Reads with AC ≥1 mapped to unique locations (see Table S5 for details).
Figure 4. Summary statistics for mapped RNA sequence tags.

: (a) Comparison of mapped tags (AC≥1) between the two sperm samples; (b) Proportions of tags with very high (AC≥100), high (10<AC<100), and medium (1≤AC≤10) expression.
The 19,257 sequence tags mapped to all horse (Equus caballus, ECA) autosomes, the X chromosome, chromosome Un, and the mitochondrial (Mt) genome (Table 3). Because the horse Mt genome is only 16,660 bp [45], it showed the highest number of mapped tags per megabase (Mb) though only 3 tags mapped to this part of the genome. Among the autosomes, the number of tags in relation to chromosome size correlated well with the known gene densities and was the highest in ECA11, ECA12 and ECA13, and the lowest in ECA9 and ECAX (Table 3).
Table 3. Distribution and expression of mapped RNA sequence tags in the horse genome.
| Sequence map data | RNA-seq data | |||||
| Horse chr. | Chr size, Mb | No. of genes* | Genes/Mb | No of tags(AC≥1) | Tags/Mb | ACmax |
| ECA1 | 185.8 | 2070 | 11.1 | 1,741 | 9 | 242,049 |
| ECA2 | 120.8 | 1273 | 10.5 | 696 | 6 | 85,760 |
| ECA3 | 119.4 | 1063 | 8.9 | 566 | 5 | 155,206 |
| ECA4 | 108.5 | 980 | 9.0 | 390 | 4 | 30,327 |
| ECA5 | 99.6 | 1221 | 12.3 | 440 | 4 | 15,063 |
| ECA6 | 84.7 | 1107 | 13.1 | 346 | 4 | 31,927 |
| ECA7 | 98.5 | 1455 | 14.8 | 412 | 4 | 49,977 |
| ECA8 | 94 | 880 | 9.4 | 372 | 4 | 9,702 |
| ECA9 | 94 | 610 | 6.5 | 276 | 3 | 7,597 |
| ECA10 | 83.9 | 1204 | 14.4 | 1,451 | 17 | 18,607 |
| ECA11 | 61.3 | 1245 | 20.3 | 1,544 | 25 | 49,866 |
| ECA12 | 33 | 742 | 22.5 | 775 | 23 | 1,244 |
| ECA13 | 42.5 | 745 | 17.5 | 1,023 | 24 | 4,197 |
| ECA14 | 93.9 | 839 | 8.9 | 1,141 | 12 | 10,517 |
| ECA15 | 91.5 | 815 | 8.9 | 1,159 | 13 | 42,457 |
| ECA16 | 87.3 | 846 | 9.7 | 1,160 | 13 | 1,592 |
| ECA17 | 80.7 | 497 | 6.2 | 754 | 9 | 4,436 |
| ECA18 | 82.5 | 578 | 7.0 | 782 | 9 | 5,761 |
| ECA19 | 59.9 | 541 | 9.0 | 574 | 10 | 2,189 |
| ECA20 | 64.1 | 840 | 13.1 | 484 | 8 | 57,595 |
| ECA21 | 57.7 | 491 | 8.5 | 290 | 5 | 1,717 |
| ECA22 | 49.9 | 613 | 12.3 | 278 | 6 | 3,832 |
| ECA23 | 55.7 | 410 | 7.4 | 281 | 5 | 14,218 |
| ECA24 | 46.7 | 564 | 12.1 | 276 | 6 | 37,167 |
| ECA25 | 39.5 | 605 | 15.3 | 284 | 7 | 12,795 |
| ECA26 | 41.8 | 272 | 6.5 | 203 | 5 | 12,070 |
| ECA27 | 39.9 | 277 | 6.9 | 217 | 5 | 5,922 |
| ECA28 | 46.1 | 477 | 10.3 | 263 | 6 | 56,479 |
| ECA29 | 33.6 | 246 | 7.3 | 141 | 4 | 55,336 |
| ECA30 | 30 | 218 | 7.3 | 127 | 4 | 1,233 |
| ECA31 | 24.9 | 176 | 7.1 | 116 | 5 | 19,300 |
| ECAX | 124.1 | 1239 | 10.0 | 390 | 3 | 133,493 |
| ECAUn | n/a | n/a | n/a | 302 | n/a | 272,950 |
| Mt | 0.016 | 37 | 2312.5 | 3 | 188 | 4,390 |
| TOTAL | 19,257 | |||||
Mb–megabase-pair; AC–average coverage; Mt–mitochondrial genome; map information for horse chromosomes was retrieved from Ensemb (http://www.ensembl.org/index. html); * includes known and novel protein coding, miRNA, rRNA, snRNA, snoRNA and Misc RNA genes.
According to the AC value which was used as the measure of expression level, the 19,257 tags fell into three categories: i) 1,028 (5%) tags with very high expression and AC≥100; ii) 8,759 (45%) tags with high expression and AC between 10 and 100, and iii) 9,470 (50%) tags with medium expression and AC between 1 and 10 (Fig. 4b). The distribution of very highly expressed tags in the horse genome was not uniform and tags with ACmax>100,000 were predominantly found in ECAUn, ECA1, ECA3, and ECAX, possibly indicating the locations of functionally important genes for the sperm. However, accumulation of very highly expressed tags to ECAUn is more likely because it contains multicopy sequences encoding for 18S and 28S ribosomal RNA which form about 80% of raw reads (see below). Compared to this, the ACmax in ECA12, ECA16 and ECA30 was less than 1,000 sequence reads per locus (Table 3).
Overall, there was a good agreement between the two sperm samples regarding the number and AC values of about 80% of mapped tags across the genome, including the tags with very high expression (Table S5). The most pronounced differences were cases where the same tag scored high or very high (AC>10) in one sample and low (AC<1) in another. Some differences in alignment of data in biological replicates were likely due to sequencing errors and chance alignments which is a significant problem for short reads and low alignment scores [46]. Among the 19,257 tags, 22% fell into this category and were uniquely mapped in sperm 1 or sperm 2 (Fig. 4a; Table S5).
Structural and functional annotation of RNA sequence data
Structural and GO annotations of the 19,257 mapped RNA-seq tags with AC≥1 were conducted by alignment to the equine reference sequence (EcuCab2; UCSC Genome Browser; http://genome.ucsc.edu/) using Enhanced Read Analysis of Gene Expression (ERANGE) software packages [47], as well as by homology-based approach against the human genome in GOanna (AgBase; http://www.agbase.msstate. edu/cgi-bin/tools/GOanna.cgi) pipeline. A total of 5,903 (∼30%) of all mapped tags, aligned with annotated genes in the horse genome and were classified by ERANGE as expressed sequence tags (5,268), mRNAs (495) and micro RNAs (140) (Fig. 5a). Since the structural annotation of the equine genome is as yet incomplete, we used a permissive ±20 kb parameter to identify additional untranscribed regions (UTRs), new external exons, and to discriminate best candidates for novel genes. Among the 5,903 annotated transcripts, ∼17% entirely fell within the boundaries of annotated genes, 83% partially aligned with known genes, and 0.03% localized within the extended gene boundaries (see Materials and Methods). Only 1,378 annotations uniquely corresponded to individual equine genes. Similarly, 34% (6,606) of all mapped RNA-seq tags aligned with annotated sequences in the human genome identifying 3,262 unique genes. Because the horse (ERANGE) and human (GOanna) annotations shared only 136 genes in common (Table S6), stallion sperm transcripts as observed by RNA-seq analysis corresponded to a total of 4,504 annotated genes (Fig. 5b).
Figure 5. Structural annotation of 19, 257 mapped RNA sequence tags (AC≥1):
(a) Distribution of the tags in structural annotation categories by ERANGE; (b) Comparison of annotated genes by GOanna (human genome) and ERANGE (horse genome).
The majority of mapped RNA sequence tags (13,354 tags, 70%) had no match in the current horse genome draft assembly by ERANGE. From the tags that could not be annotated, we selected 12 tags with extremely high average coverage values (AC>50,000) and showed by manual BLAST analysis that 67% of these tags were highly similar to the rRNA in the 60S (5S, 28S) and 40S (18S) subunits of the eukaryotic ribosome (Table 4). High AC values of these tags indicated abundant representation of rRNA in stallion sperm.
Table 4. NCBI BLAST alignments for 12 most abundant (AC>50,000) un-annotated mapped RNA sequence tags.
| Chromosomal Location | AC | NCBI BLAST alignment | NCBI accession number | E-value | Identity % |
| chrUn:41671499-41671648 | 272,950 | Sus scrofa 28S rRNA | AB117610 | 2E-48 | 92 |
| chr1:183854089-183854405 | 189,364 | Homo sapiens RPS29 gene for ribosomal protein S29 | AB061847 | 3E-150 | 99 |
| chr3:36417092-36417971 | 155,205 | Mouse 28S rRNA | X00525 | 0 | 91 |
| chrX:51467917-51468014 | 133,492 | Crocodylus siamensis 18S rRNA | EU727190 | 1E-13 | 93 |
| chr1:89070737-89071827 | 104,507 | Equus caballus 28S rRNA | NR_046309 | 0 | 99 |
| chrUn:55274673-55275483 | 98,778 | Homo sapiens 28S rRNA | M11167 | 0 | 91 |
| chrX:87062618-87062767 | 82,610 | Homo sapiens 7SL RNA, | NG_002426 | 2E-54 | 94 |
| chrUn:64060479-64061987 | 62,499 | Bubalus bubalis 18S rRNA | JN412502 | 0 | 99 |
| chr20:7063095-7063141 | 57,594 | Crocodylus porosus 18S rRNA | EU727191 | 3E-10 | 98 |
| chr28:36791911-36792005 | 56,479 | Homo sapiens 7SL RNA | M20910 | 9E-30 | 94 |
| chr29:1282347-1282467 | 55,336 | Homo sapiens 45S pre-rRNA | NR_046235 | 3E-51 | 99 |
| chr1:89070491-89070650 | 53,940 | Equus caballus hypothetical protein | XM_001916364 | 1E-60 | 94 |
Gene ontology analysis of the sperm transcripts that corresponded to 1,378 annotated equine genes and 3,262 human orthologs produced 10 main functional categories: 1) plasma membrane; 2) mitochondrial ribosomal protein; 3) chemokine receptor and protein folding; 4) transcription regulation; 5) ion binding; 6) cytoskeleton; 7) DNA packaging; 8) chromatin assembly complex; 9) GTPase activator, and 10) RNA processing factors and protein transport. Notably, EST and mRNA sequences with the highest AC values all had known functions in spermatogenesis or sperm-egg interactions (Table 5).
Table 5. Structural and functional annotations for mRNAs and ESTs with the highest AC values by RNA-seq.
| NCBI Accession No | Gene symbol | Gene name | Location Chr:Mb | AC value | Predicted or known function(s) | Ref. |
| mRNA | ||||||
| NM_001081847 | MMP1 | Matrix metallopeptidase 1 | 7:12.7 | 11766 | spermatogenesis | [94] |
| NM_001082495 | MMP3 | Matrix metallopeptidase 3 | 7:12.7 | 11766 | spermatogenesis | [94] |
| NM_001135102 | TNP2 | Transition protein2 | 13:33.2 | 1730 | sperm chromatin structure | [95] |
| NM_001083596 | PRM1 | Protamine 1 | 13:33.2 | 1730 | sperm chromatin structure | [96] |
| NM_001159690 | PKM2 | Pyruvate kinase, muscle | 1:121.0 | 297 | high fertility sperm | [97] |
| NM_001163873 | GRP94 | Glucose-regulated protein | 28:27.3 | 238 | sperm maturation | [98] |
| NM_001081764 | COL2A1 | Collagen, type II, alpha 1 | 6:65.6 | 222 | testes development and descent, male infertility | [98] |
| NM_001160296 | FBXO9 | F-box protein 9 | 20:50.6 | 182 | expressed in male germ-cells, sperm differentiation | [95], [99] |
| NM_001081842 | CASP1 | Caspase 1, apoptosis-related cysteine peptidase | 7:14.5 | 119 | male fertility | [100], [101] |
| NM_001081932 | CRISP2 | Cysteine-rich secretory protein 2 | 20:47.7 | 114 | sperm capacitation and sperm-egg fusion | [102] |
| NM_001081874 | CRISP3 | Cysteine-rich secretory protein 3 | 20:47.7 | 114 | protects sperm from degradation | [103] |
| dbEST | ||||||
| CD470129 | NEMF | Nuclear export mediator factor | 1:183.8 | 242048 | sperm-egg interaction | [104] |
| CX595503 | CTNNBIP1 | Beta-catenin-interacting protein 1 | 2:41.4 | 85760 | cytoskeletal, cellular morphogenesis, germ cell loss and sterility | [105], [106] |
| CD466273 | LCP1 | Lymphocyte cytosolic protein 1 | 7:12.7 | 11766 | sperm maturation | [107] |
| CD472316 | DNTTIP2 | Deoxynucleotidyltransferase, terminal, interacting protein 2 | 5:71.1 | 11420 | chromatin remodeling | [108] |
| CD467145 | FGD3 | FGD1 family, member 3 | 23:54.9 | 10551 | sperm motility | [109] |
| CX595998 | LYRM1 | LYR motif containing 4 | 20:5.6 | 8565 | mitochondrial membrane polarization | [110], [111] |
| CX596255 | PDIA4 | Protein disulfide-isomerase A4 precursor | 4:101.1 | 4232 | spermatogenesis, sperm maturation | [112] |
| CX592294 | NDUFV2 | NADH dehydrogenase (ubiquinone) flavoprotein 2 | 8:34.0 | 1997 | expressed in sperm | [113] |
Finally, among the 140 sequence tags classified as miRNAs, 82 unique miRNAs were identified of which 17 completely aligned with known equine miRNA genes (Table S7). The majority of miRNAs (76%) showed high expression level (10 AC 100), 13 miRNAs (16%) had AC lower than 10, whereas 6 miRNAs-MIR34B, MIR34C, MIR191, MIR223, MIR1248, and MIR1905C-showed very high expression levels (AC≥100) in stallion sperm (Table S7).
Comparison of RNA-seq data with current gene models
Structural annotations of RNA-seq data by ERANGE for pyruvate kinase (PKM2), cysteine-rich secretory protein 3 (CRISP3), protamine 1 (PRM1), and transition protein 2 (TNP2) were compared with the current NCBI equine gene models (UCSC Genome Browser; http://genome.ucsc.edu/). The genes were selected due to their known functions in sperm motility, packaging, structure and fertilization (Table 5), and because all four genes were represented by high number of transcripts (AC>100) in the sperm.
Of the 9 tags that mapped to PKM2, each corresponded to two different NCBI accessions (Table S8) suggesting the presence of two splice variants in stallion sperm. Based on the AC values, the variant comprising of exons 1, 3, 4, 5, and 6 was more abundant than a variant where exons 2 and 9 were included; no tags aligned with exons 7, 8, 10, and 11. However, a relatively abundant (AC = 94.16) sequence tag aligned with a 5′ upstream region of the gene indicating likely presence of an additional exon (Fig. 6a).
Figure 6. Comparison of RNA-seq data with current equine gene models:
(a) PKM2 showing 9 in silico prediction sites, of which two are positioned 5′ upstream to exon 1; (b) CRISP3 with 3 in silico prediction sites, all located 5′ upstream to exon 1; (c) PRM1 and TNP2 cluster (the protamine cluster) with 12 in silico prediction sites of which only two align with PRM1 and TNP2 exons. Black boxes with numbers –exons in current gene models; blue boxes –very highly expressed tags (AC≥100); red boxes–highly expressed tags (10<AC<100); green boxes–tags with medium expression (1≤AC≤100). Exact start and end sites of all mapped tags are presented in Additional file 7.
The three CRISP3 sequence tags mapped 5′ upstream from the current gene model and did not align with any of the eight known exons (Fig. 6b). This could indicate inaccurate annotation of the gene in the equine draft assembly (EcuCab2) [42] or the presence of additional 5′exons.
All RNA-seq mapped tags that aligned with PRM1, aligned also with TNP2, thus having two distinct accession locations (Table S8, Fig. 6c) in this tightly regulated protamine gene cluster [48], [49]. Transcripts with the highest AC values aligned with the two PRM1 exons, while a number of sequence tags with high to medium AC values mapped 5′ upstream of PRM1, and between PRM1 and TNP2 (Fig. 6c)-the latter corresponding to parts of the initial joint transcript of the protamine gene cluster [48], [49].
Discovery of Y chromosome transcripts in stallion sperm
Horse Y chromosome sequences are not present in the draft assembly (EcuCab2) [42] or in the whole genome (WG) expression oligoarray [50]. Therefore, we used the recently published catalogue for 29 ECAY genes and ESTs that have cDNA evidence [51], and found seven transcripts in the sperm (Fig. 7). These included one X-degenerate gene (DDX3Y), three horse specific novel transcripts (ETSTY4, ETSTY6 and ETY1), and three Y-acquired retrotransposed genes (EIF3CY, MTND1 and RPS3AY).
Figure 7. ECAY transcripts in stallion sperm.

Agarose gel images showing RT-PCR amplicons of 7 ECAY genes and transcripts in stallion sperm.
Comparison of microarray and RNA-seq data
The 21,000-element equine gene expression oligoarray is designed to specifically target genes, so that each probe on the array corresponds to a specific gene or EST [50]. The RNA-seq data, on the other hand, comprises the entire transcriptome and multiple sequence tags can be mapped to a genomic region corresponding to one gene. This explains the substantial difference between the number of sperm RNAs detected by microarray analysis (6,761 transcripts) and by RNA-seq (19,257 mapped tags). Nevertheless, the two datasets were similar regarding the number of annotated genes: 3,319 by microarray and 4,504 by RNA-seq. While 65–70% of the microarray transcripts were present among RNA sequences (data not shown), RNA-seq additionally identified miRNAs and over 13,000 anonymous mapped tags. The latter potentially correspond to splice variants of known genes, to genes yet to be annotated, to various non-coding RNAs (ncRNAs), and maybe even to a few novel genes. Importantly, RNA-seq data allowed refined quantitation of RNA transcripts as expressed by the AC values (Table S5), to determine the level of their expression in stallion sperm.
Discussion
The discovery of haploid transcripts in mammalian sperm dates back to almost two decades when c-MYC mRNA [52] and MHC Class I transcripts [53] were detected by RT-PCR in human sperm. Since then, a number of studies have characterized individual transcripts, as well as the global transcriptome of the sperm in normal and subfertile men [6], [8], [28], [31], [54]. In animals, sperm transcripts have been studied in bulls [29], [32], [33], [34], boars [23], [35], and recently in the water buffalo [55] using human microarrays, species-specific small custom-made microarrays, or quantitative PCR. To our best knowledge, the present study is the first global sperm RNA analysis in stallions, though massively parallel sequencing has been recently used to study RNAs in the sperm of men [56] and mice [57]. Our findings that thousands of coding and non-coding RNAs are present in mature stallion sperm are in good agreement with previous research in the field [6], [34], [56], [57].
Microarray analysis versus RNA-seq
Analysis of stallion sperm transcriptome by microarray and RNA-seq in the present study, allowed comparison of the two approaches for the efficiency to detect sperm mRNAs. The information obtained by gene expression microarrays is typically influenced by array design and annotation, with a possible advantage that previously known annotations of array probes will reduce the bioinformatics load of analysis. The 21,351-element equine WG oligoarray [50] used in this study contains 14,531 GO annotated gene products (AgBase: http://www.agbase.msstate.edu/) of which 3,319 were identified in the sperm. In contrast, transcriptional profiling by RNA-seq is unbiased, targets all classes of RNAs, and substantially outperforms microarray in the dynamic range of the expression levels [47], [58]. Indeed, the heterogeneity and expression range of the 19,257 mapped RNA-seq tags in stallion sperm essentially exceeded the microarray data. The downside, however, was limited power of structural annotation of the RNA sequences due to which 70% of mapped tags remained anonymous and will be targets for bioinformatics pipelines in the future. Partial incompatibility between the accession identities of microarray and RNA-seq annotations set additional limitations to efficiently compare the two datasets. We conclude that RNA-seq is certainly the method of choice for global transcriptome analysis and for the discovery of biomarkers for stallion fertility.
Sperm versus testis: selective retention of mRNAs in sperm
The sperm of reproductively normal stallions contained a rich repertoire of about 6,000 mRNAs/ESTs (Figs. 1, 5a) which, according to microarray analysis, represent approximately 50% of the mRNAs found in the testes (Fig. 1), a ratio similar to that reported for men [6]. The ∼11,000 testes transcripts, as determined here by microarray, are close in number to the 12,013 expressed genes recently found in stallion testes by RNA-seq [59].
The majority of mRNA/EST transcripts in stallion sperm were concordant with those in testes (Fig. 1), supporting the prevailing idea that sperm transcripts are solely historical records of spermatogenesis in testes [1], [6], [7], [8], [60], [61]. Therefore, the detection of 60 sperm up-regulated and 165 sperm-enriched transcripts by microarray analysis was a surprise. Because GO analysis of these transcripts showed their direct relevance to sperm functions (Figs. 2, 3; Tables S2, S3), it is tempting to speculate that certain transcriptional products of spermatogenesis are selectively retained in the sperm but not in the testes. This was further supported by GO annotations for the sperm RNAs that corresponded to known genes, mRNAs and ESTs (Table S1, Table 5) showing that the majority of sperm transcripts relate to a few defined functional categories. These included cytoskeleton and G-protein coupled receptor activities, transmembrane transport, ion channels, and mitochondrial ribosomal proteins-functions involved in sperm chemotaxis, capacitation, sperm-egg interactions, and the acrosome reaction [62], [63], [64]. For example, ion channels play an important role in fertilization by facilitating interactions of the sperm with its environment and the egg during capacitation, sperm-egg recognition, and the acrosome reaction [65], [66]. Trans-membrane transport of glycoproteins on the surface of sperm tails, on the other hand, is required for primary binding of the sperm to the zona pellucida during capacitation and sperm-cumulus interaction [67]. Even though the high abundance of olfactory receptors (OR) and the predominance of sensory perception related biological processes in sperm transcriptome (Table S1) seems at first sight bizarre, ORs too are directly involved in sperm functions. There are between 20 and 66 testicular ORs in mammals which play pivotal roles in progesterone activated signal transduction pathways in guiding sperm chemotaxis, capacitation, Ca2+- channels and acrosome reaction [64], [68]. The findings also set an important foundation for future research to examine whether the regulation of ORs in individual sperm cells is as tightly controlled as their expression in the central nervous system, where each neuron expresses monoallelically only one particular OR [69]. This might be of value for assisted reproduction and for the improvement of the therapy of subfertility.
Y chromosome transcripts in stallion sperm
One of the original findings was the detection of seven Y chromosome mRNAs in stallion sperm (Fig. 7). Sequences of the Y chromosome are typically missing from EST and cDNA libraries, from genome sequence draft assemblies, and thus, from expression arrays and gene annotation pipelines. Therefore, Y transcripts in the sperm have been identified only in species with advanced Y chromosome gene catalogues–DBY, SRY, and RPS4Y in men [70] and Dby in mice [24]. Given the known role of Y chromosome genes in spermatogenesis and male fertility and their high expression levels in testes [51], [71], the presence of Y transcripts in sperm is not surprising. Although, it is noteworthy that among tens of Y genes expressed in testes, only a few transcripts are retained in the sperm. Among these, DBY (alias DDX3Y) is of particular interest because it is present in the sperm of all three species–humans, mice and horses. In mice, Dby transcripts are retained in the sperm after capacitation and transferred into the oocyte during fertilization. These transcripts are thought to be necessary for the early development because blocking Dby with antisense RNA results in inhibition of zygotic development in mice [24]. Given that Y transcripts are delivered to the zygote exclusively by the sperm, the functions of ECAY transcripts in stallion sperm need further investigation.
In summary, functional coherence of the GO categories of stallion sperm coding RNAs is in agreement with the observations in humans that sperm mRNAs are not random untranslated remnants of spermatogenesis but constitute a population of stable full-length transcripts that are selectively retained for functions in fertilization and early development [6], [11].
Non-coding RNAs: rRNAs, miRNAs and lncRNAs
Direct sequencing of stallion sperm total RNA allowed the discovery and identification of RNA species other than mRNAs. Among these, ribosomal RNAs (rRNAs) comprised a substantial portion of mapped tags with very high AC values (Table 4). This was a surprise because it has been a common knowledge that the sperm are depleted of rRNA [6], [72]. Absence of intact 18S and 28S rRNA peaks has been shown in most microarray-based sperm transcriptome studies [6], [32], [35], [38] and is an established standard for sperm RNA quality evaluation [73]. Recent RNA-seq of human sperm transcriptome [56] reveals that the truth lies in the middle: 18S and 28S are the most abundant (80%) sperm transcripts but they are not intact. Sperm rRNAs undergo selective cleavage which specifically destroys full-length rRNAs but does not affect mRNAs or small non-coding RNAs. Cleavage of sperm rRNAs is needed to ensure translational cessation and prevent spurious protein synthesis in the sperm. These findings explain the presence of rRNAs in the stallion sperm in this study but also clarify why 18S and 28S peaks are absent from sperm RNA quality control electropherograms [73].
One of the most exciting results was the discovery of 82 sperm miRNAs (Table S7) which comprised 0.73% of all RNA-seq mapped tags (Fig. 4) and were annotated according to the in silico detection of miRNAs in the horse genome [74]. The number of miRNAs in stallion sperm was comparable with the 68 miRNAs found in human spermatozoa [13], and several stallion miRNAs were the same as identified in the sperm of men [75], boars [76] and mice [57], [77]. Among the latter, the most noteworthy were the sperm-borne miRNAs which are required for the first cleavage division and are found in mouse sperm and one-cell embryos but not in the oocytes or embryos past the one-cell stage. Three such miRNAs [77], MIR34B, MIR34C and MIR449A, were highly abundant (AC≥100) in stallion sperm (Table S7). While the functions of sperm microRNAs in equine biology are yet to be determined, recent discoveries in mouse and humans suggest that sperm miRNAs, as well as novel piRNA- and tRNA-derived small RNAs [57], [78], regulate gene expression in the early zygote either by direct interaction with mRNA or via epigenetic mechanisms [13], [20], [21], [77], [79]. For example, miR-124, also found in stallions, is critical for the establishment of a distinct, heritable chromatin structure in the promoter region of Sox9 and is responsible for RNA-mediated epigenetic control of embryonic and adult growth in mice [79]. Further, recent comparative study on birth and expression evolution of mammalian miRNA genes [80] indicates the particular importance of X-linked miRNAs in testes where they are potentially involved in diverse functions during spermatogenesis. These X derived miRNAs tend to be duplicated and have higher expression levels than autosomal miRNAs. Though the functions of miRNAs in testes and sperm are likely different, it is worth mentioning that among the 82 sperm miRNAs identified in this study, six were derived from the X chromosome of which MIR223 has high expression level (AC = 295; Table S7).
The discovery of over 100 sperm miRNA sequence tags of which 82 could be aligned with unique miRNAs evidenced that to some extent the small RNA fraction can be successfully targeted by global transcriptome sequencing, without special small RNA library construction. However, given that mammalian species on average have about 300 miRNAs [80] and that sperm are enriched with mse-tsRNAs (mature sperm-enriched tRNA-derived small RNAs) [78] and other small non-coding RNAs [57] with likely functions in development, additional studies are needed for in depth analysis of the small non-coding RNA fraction of stallion sperm.Male germ cells also contain transcripts of long non-coding (lnc) regulatory RNAs [21] which are longer than 200 nucleotides, have little or no protein-coding capacity, and regulate gene expression through a diversity of mechanisms [81]. Because only three lncRNA genes are available for the horse in the Long Non-Coding RNA Database (http://lncrnadb.com/) and lncRNA sequences are not conserved across species [81], the RNA-seq annotation pipelines (ERANGE, AgBase) [47] did not identify any lncRNAs. However, we anticipate that among the over 13,000 RNA-seq tags that could not be annotated in this study, many represent small and long regulatory RNA species.
Functions of sperm transcripts
Recent studies have essentially challenged the prevalent concept that the sperm are transcriptionally and translationally dormant cells [82] and that sperm transcripts have no functions of their own [1], [6], [7], [8], [11], [61], [83]. For example, there is evidence that the mature sperm possess an efficient RNA polymerase machinery for transcription, mRNA splicing and for reverse transcription of the primary RNA into stable cDNAs [84], majority of which are delivered during fertilization to the zygote [16]. Sperm mRNAs can be de novo translated using mitochondrial-type ribosomes and at least 26 such sperm-translated proteins are known to be required during capacitation, sperm-egg interactions and fertilization [17], [18], [19], [85]. Also, sperm coding and non-coding RNAs are thought to have a role in stabilizing sperm chromatin and facilitating the selective escape of sequences necessary for early development from repackaging by protamines [15]. This is in line with our findings that stallion sperm mRNAs are not retained randomly but form a distinct population with functions directly relevant to sperm-egg interactions, fertilization and embryonic development. Furthermore, the presence of non-coding regulatory RNAs suggests that like in mice, RNAs can serve as epigenetic modifiers of gene regulation in early equine development [10], [20], [21], [86]. Despite these recent advances, functions of the majority of RNAs found in mammalian sperm remain to be identified [10] and need further investigation.
The primary practical goal of sperm transcriptome analysis in humans and animals is the detection of transcripts that could serve as biomarkers or diagnostic tools for fertility evaluation. For example, elevated protamine mRNA retention in human sperm is an indication of abnormal protamine translation and infertility [27]. Also, consistent and biologically relevant differences in sperm mRNA expression profiles have been found between fertile men and men with teratozoospermia [26], cryptorchidism [28] and idiopathic infertility [30], [31]. In bulls, DE sperm transcripts have been associated with high or low sperm motility [29], as well as with overall high- and low-fertility [34]. In boars, statistically significant differences in sperm mRNA profiles have been associated with seasonal changes in the reproductive status [36]. Overall, the current knowledge about sperm transcriptome in men and animals suggests that sperm RNA profiles could be used as a genetic fingerprint of normal fertile males and as a molecular diagnostic platform for male infertility. In this respect, the results of the present study, particularly the expression data for sperm miRNAs and the mRNAs relevant to sperm functions, set a foundation for the development of sperm-based markers for fertility evaluation in stallions in the future.
RNA-seq data and structural annotation of the horse genome
While the primary goal of this study was to characterize in detail the transcriptome of stallion sperm, the generated RNA-seq data is a valuable resource for the improvement of horse genome structural annotation [54]. This was illustrated by suggesting additional exons, splice variants or another genomic location for four important sperm genes-PKM2, CRISP3, TNP2 and PRM1 (Fig. 6). Thus, the RNA-seq data is a valuable resource to improve the structural annotation of the horse genome, and for the discovery of novel genes and regulatory RNAs.
Methods
Ethics statement
Procurement of stallion semen and testes was performed according to the United States Government Principles for the Utilization and Care of Vertebrate Animals Used in Testing, Research and Training and were approved by the Clinical Research Review Committee (CRRCs #08–19; #08–33; #09–32; #09–47) and Animal Use Protocol #2009–115 at Texas A&M University, supplemented with Informed Owner Consent From stating that owners of the stallions gave permission for their animals to be used in this study.
Samples
Fresh ejaculates from five reproductively normal stallions were collected using an artificial vagina (Missouri model). The ejaculates were first evaluated for sperm concentration, motility characteristics and morphological features [87], [88], followed by purification from somatic cells and immature sperm by EquiPure™ (Nidacon International, Sweden) discontinuous gradient centrifugation [73]. Testes samples were obtained from four normal stallions by castration. Purified sperm and testes were stored in RNAlater (Ambion) at −80°C until use.
RNA isolation and evaluation
Total RNA was isolated from sperm with TRIzol reagent (Invitrogen) as described by Das and colleagues [73], and from testes using RNeasy mini elute kit (Qiagen) and manufacturer's protocol. The RNA samples were cleaned from genomic DNA (gDNA) with Turbo DNase kit (Applied Biosystems/Ambion) and purified with RNeasy MinElute Cleanup kit (Qiagen). The quantity and quality of isolated RNA were evaluated with spectrophotometer (NanoDrop 1000, Thermo Fisher Scientific), Bioanalyzer (Agilent Technologies), and reverse transcriptase PCR (RT-PCR) using primers for sperm- and testes-specific PRM2 (protamine 2), and somatic cell-specific PTPRC (protein tyrosine phosphatase, receptor type, C) (Fig. S2) [73]. The spectrophotometer OD values for all total RNA samples must to be 1.70–1.75 for absorbance ratios A260/A280, indicating that the RNA is free from proteins and organic compounds [89]. The Bioanalyzer profiles distinguish between testes and sperm total RNA: RNA Integrity Number (RIN) above 8 and two peaks corresponding to 18S and 28S rRNAs are indicators for the good quality of testes RNA; in contrast, sperm is depleted of intact rRNA (Fig. S2) [73]. RT-PCR with intron-spanning primers for PRM2 validate that all RNA samples are free of genomic DNA, while no amplification of PTPRC in sperm indicates that the sperm RNA is not contaminated with RNA from somatic cells (Fig. S2) [73].
RNA linear amplification
For microarray hybridizations, sperm and testes total RNA was subjected for two rounds of linear amplification by T3/T7 promoter synthesis with RNA Amplification RampUp kit (Genisphere) following manufacturer's instructions. Starting with 20–30 ng of total RNA, about 20–60 µg of sense-strand mRNA was obtained and stored at −80°C until use.
Expression microarray hybridizations
Four different testes and five sperm RNA samples were used for microarray hybridizations. Testes samples were pooled to generate a reference RNA for normal stallion testes, while sperm samples were used individually. Individual sperm and pooled testes RNA was converted into cDNA and labeled with Cy3 or Cy5 using 3DNA Array 900MPX Detection kit (Genisphere). Transcriptional profiles of stallion sperm and testes were studied by hybridization to the Texas A&M 21,351-element equine WG expression oligoarray [50]. Each hybridization experiment comprised a pair of differently labeled (Cy3 or Cy5) RNAs: the testes reference and one of the five sperm samples. Including a dye swap, a total of ten microarray hybridizations were conducted in a Sure Hyb hybridization chamber (Agilent Technologies) overnight, followed by post-hybridizaton washes in pre-warmed (42°C) 2× SSC with 0.2% SDS and 0.2× SSC at room temperature for 15 min each.
Microarray data analysis
The slides were scanned with a Gene Pix 4100B scanner at 5 micron resolution (Molecular Devices). Spot-finding and quantification of array images was carried out using Gene Pix Pro 6.1 software and the data were stored as GenePix Results (.gpr) files. The raw intensity data were normalized within individual arrays using print-tip LOWESS method [90]. To be considered significant, the signal for a candidate had to be above a threshold value (SNR ≥2) determined according to the fluorescence output of the negative controls printed on the microarray. Bayesian t-test was performed to consider DE genes between the sperm and testes: signal FC >2 and p value 0.05 were considered significant. The normalized data were analyzed with Bioconductor LIMMA package in the R computing environment, followed by GO analysis using DAVID Bioinformatics Resources (http://david.abcc.ncifcrf.gov/) to describe those molecular functions and biological processes that appeared to be influential.
Validation by quantitative real-time PCR (qRT-PCR)
The cDNA was synthesized from 2 µg of linearly amplified testes and sperm RNA with SuperScript VILO cDNA synthesis kit (Invitrogen), purified with MinElute PCR purification kit (Qiagen), and evaluated for quantity and quality with a NanoDrop spectrophotometer (Thermo Fisher Scientific). Aliquots of cDNA were stored at −20°C until use. Exon spanning primers for qRT-PCR were designed for selected genes (Table 1) using Primer3 ver 0.4.0 software [91], and the efficiency of all primers was evaluated by making a standard curve in the sperm and testes samples. Duplicate qRT-PCR reactions in triplicate experiments were carried out on a Light Cycler® 480 (Roche Diagnostics) along with two housekeeping genes (ACTB, β-actin and PPIA, peptidylprolyl isomerase α) as controls. Each qRT-PCR assay used ∼100 ng of mRNA in a 20 µL reaction with 1× Universal SYBR® Green Master Mix (Applied Biosytems, CA) and 300 nM primers. The results were analyzed with LightCycler 480 Software v1.5 by calculating log2 −ΔΔCt; the P-value was calculated by performing student's t-test and p<0.05 was considered significant. Scatter plots for qRT-PCR statistics were generated in Microsoft Excel (Fig. S1).
Detection of Y chromosome transcripts in stallion sperm
Reverse transcriptase PCR experiments on stallion sperm and testes were carried out according to standard protocol [73] using primers for 29 known horse Y chromosome genes and transcripts with cDNA evidence [51], along with primers for PRM2 and PTPRC as positive and negative controls, respectively.
RNA-seq library construction and sperm RNA sequencing
Total RNA from the sperm of two reproductively normal stallions was used for next generation sequencing (NGS) on the ABI SOLiD 4 platform at Cofactor Genomics (ST. Louis, MO, USA).-Total RNA (500 ng) was directly used for SOLiD single-end RNA sequencing fragment library construction according to the ABI protocol (http://www.cofactorgenomics.com/faq) [92]. First strand cDNA was directly generated from total RNA using 4 µL of random hexamers (ABI) and SuperScript II Reverse Transcription Kit (Invitrogen) in a 30 µL final volume, following the manufacturer's instructions. The second strand cDNA was generated using 10 µL of 5× second strand buffer (500 mM Tris-HCl, pH 7.8; 50 mM MgCl2; 10 mM DTT), 30 nmol dNTPs; 2 U of RNase H, and 50 U of DNA Pol I (Invitrogen), and incubated at 16 °C for 2.5 h. The double-stranded DNA (dsDNA) was purified with QIAquick PCR purification kit (Qiagen) and the concentration was quantified. From each sample, ∼100–200 ng of cDNA was fragmented using Covaris S2 System (Covaris, Inc.). Sequencing libraries were generated with SOLiD Fragment Library Construction Kit (ABI) as described elsewhere [92]. Briefly, fragmented cDNA was end-repaired with Polishing Enzyme 1 and End Polishing Enzyme 2 (ABI); adapter ligated with SOLiD P1 and P2 adaptors, size selected for 200 to 230 bp on a SOLiD Library Size Selection gel, followed by nick translation and PCR amplification using Library PCR Primers 1 and 2 and Platinum PCR Amplification Mix. Amplified libraries were column purified, quantified using the SOLiD Library TaqMan Quantitation Kit, and applied on ABI SOLiD sequencer at a concentration of 10 ng per lane.
RNA sequence analysis and annotation
The 50 bp single-end SOLiD raw reads were directly aligned with the horse reference sequence EcuCab2 [42] using ABI aligner software (NovoalignCS version 1.00.09, http://www.novocraft.com/) which uses multiple indexes in the reference genome, identifies candidate alignment locations for each primary read, and scores alignment locations using the Needleman-Wunsch algorithm [93]. The alignment parameters allowed the minimum number of 30 good quality bases for a read (l = 30); the highest alignment score acceptable for the best alignment was 140 (t = 140), whereas a default threshold was calculated from read length and genome size such that an alignment to a non-repeat should have a quality higher than 30; the number of alignments recorded for a read during the iterative search process, i.e., the number of alignments with score equal to the best alignment was 10 (e = 10). If a read was unaligned, it was shortened by 1 base and tried again. Alignments in repetitive sequences were discarded by removing reads with multiple similarly scoring alignments. The single highest-scoring alignment for each raw read was mapped. Sequence alignment and alignment clustering to define expressed loci and perform linear normalization across the two sperm RNA samples was carried out with a software package EXpression analysis Pipeline, EXP (Cofactor Genomics).
Gene expression level or average coverage (AC) was calculated by normalizing each sample to the fewest reads and directly comparing different loci. Expression level of a transcript was estimated from the number of reads that mapped to that transcript. The variability present in sequencing depths in different samples was taken care of by the use of two biological replicates. Sequencing depth at each locus and differences in gene expression (AC) between the two sperm samples were calculated using log (base2) ratio, thus showing the association between the two samples. Some differences in alignment of data in biological replicates were likely due to sequencing errors and chance alignments which is a significant problem for short reads and low alignment scores [46]. To combat the high false-positive rate, we focused on a high-quality subset of the data consisting of sequence variants supported by different independent reads. Sequencing reads were computationally categorized according to their AC and chromosomal location. This categorization was conducted comparatively with respect to a present horse genome draft sequence assembly, and normalized count of the number of mapped position was calculated. This count served as a proxy for the transcripts with true abundance in the sample. Expression directories were divided into four categories according to the sum of AC values: very high–AC≥100; high −10<AC<100; medium −1≤AC≤10, and low AC<1. Loci with low expression in both sperm samples were removed from further analysis because they represented the least compelling evidence of expression. Genomic locations of all mapped transcripts were retrieved using Python VS 2.66 script.
Structural annotation of genes for all sequence tags with AC≥1 was conducted in two categories: i) a homology-based approach with the human genome (AgBase GOanna; http://agbase.msstate. edu/cgi-bin/tools/GOanna.cgi) and ii) direct annotation with the horse genome using the Enhanced Read Analysis of Gene Expression (ERANGE) with a ±20 kb window for recognized chromosomal locations. Matches were categorized as: F–falling within gene boundaries; P–partially falling within gene boundaries, and A–adjacent, falling into extended gene boundaries within the expanded ERANGE window. Annotated genes were functionally analyzed and clustered for GO terms in DAVID Bioinformatics Resources (http://david.abcc.ncifcrf.gov/) with medium classification stringency for all parameters.
Supporting Information
Scatter plots of qRT-PCR statistics for DE genes in sperm and testes by microarray analysis (see also Fig. 3 ). A Sperm up-regulated genes: a. PAD16, p-value 0.025063716, Fold change -17.74531191(sperm), 5.757703597 (testis); b. DNAJC16B, p-value 0.000370874, Fold change -59.55886046 (sperm), 1.329895004 (testis); c. DCDC2, p-value 0.009505038, Fold change -41.79889717 (sperm), 1.054235336 (testis); d. CTTN, p-value 0.025377064, Fold change -114.2727567 (sperm), 17.61968043 (testis); e. REEP6, p-value 5.65337E-05, Fold change -858.1806418 (sperm), 5.757703597 (testis); f. ARID5B, p-value 0.029703844, Fold change -2.675065645 (sperm), 0.370649473 (testis); g. ATG12, p-value 0.079897582, Fold change -4.477059424 (sperm), 0.693040106 (testes); B Sperm down-regulated genes: a. GSTA1, p-value 0.008611828, Fold change -0.427023 (sperm), 8.3 (testes); b. DYNTL1, p-value 0.028173, Fold change -0.777409 (sperm), 2.95 (testes); c. SPA17, p-value 0.016193, Fold change -0.569896 (sperm), 1.75 (testes); d. CTTN, p-value 3.3E-05, Fold change -0.24142 (sperm), 4.14.
(TIF)
Sperm RNA quality check. A Bioanalyzer analysis showing that mature sperm is devoid of intact ribosomal 18S and 28S RNA; B RT-PCR with sperm and testis specific PRM2 (left) and sperm-negative PTPRC.
(TIF)
Gene Ontology classifications and terms for 3,319 sperm transcripts by microarray analysis. This table contains GO analysis statistics for all annotated genes that were expressed in sperm by microarray analysis. The GO categories i) Biological process, ii) Molecular function, and iii) Cellular component are shown on separate spreadsheets; Count-number of genes associated with this gene set; Percentage-genes associated with this gene set/total number of query genes; P -value-modified Fisher Exact P-value; Genes-the list of genes from query set that are annotated to this gene set.
(XLS)
Most significant (p<0.001) GO terms for sperm transcripts identified by microarray analysis (count-number of genes associated with this gene set).
(DOCX)
Gene Ontology classifications and terms for 165 sperm-enriched transcripts by microarray analysis. This table lists GO analysis statistics for the sperm-enriched genes. The GO categories i) Biological process, ii) Molecular function, and iii) Cellular component are shown on separate spreadsheets; Count-number of genes associated with this gene set; Percentage-genes associated with this gene set/total number of query genes; P -value-modified Fisher Exact P-value; Genes-the list of genes from query set that are annotated to this gene set.
(XLSX)
Differentially expressed genes (n = 155) between the sperm and the testes. A list of the 60 sperm up-regulated and 95 sperm down-regulated genes, their NCBI and RefSeq accession numbers, logFC-log2 fold change in expression between sperm and testes; AveExpr-average log2-expression level of that gene across red-green channels, and P-value; NULL–no annotation; #NA = unknown.
(XLS)
Mapped RNA sequence tags (n = 19,257) from the sperm of the two stallions. The table presents the following information for each mapped sequence tag: i) genomic location, ii) average coverage in sperm 1 (AC1) and sperm 2 (AC2), and iii) log2 ratios between AC1 and AC2. Columns at the left are sorted by AC1 and columns at the right by AC2. Mapped tags with AC≥1 are shaded grey.
(XLS)
List of the 136 genes from RNA-seq data with structural annotations both in the horse and the human genome.
(DOCX)
The 82 sperm micro RNAs discovered by RNA-Seq.
(DOCX)
Correspondence of the RNA-Seq data with the current NCBI gene models for PKM2 , CRISP3 , TNP2 and PRM1 .
(DOCX)
Alignment and coverage statistics for RNA-seq reads in the horse genome.
(XLSX)
Acknowledgments
The authors thank Drs. Jarret Glasscock, Ryan Richt and Matt Hickenbotham from Cofactor Genomics for unfailing support and constructive discussions.
Funding Statement
This study was supported by grants from American Quarter Horse Association, USDA grant 2006-04801 and CVMBS LINK Endowment for Equine Genomics. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Krawetz SA (2005) Paternal contribution: new insights and future challenges. Nat Rev Genet 6: 633–642. [DOI] [PubMed] [Google Scholar]
- 2. Galeraud-Denis I, Lambard S, Carreau S (2007) Relationship between chromatin organization, mRNAs profile and human male gamete quality. Asian J Androl 9: 587–592. [DOI] [PubMed] [Google Scholar]
- 3. Betlach CJ, Erickson RP (1973) A unique RNA species from maturing mouse spermatozoa. Nature 242: 114–115. [DOI] [PubMed] [Google Scholar]
- 4. Paul J, Duerksen JD (1975) Chromatin-associated RNA content of heterochromatin and euchromatin. Mol Cell Biochem 9: 9–16. [DOI] [PubMed] [Google Scholar]
- 5. Pessot CA, Brito M, Figueroa J, Concha, II, Yanez A, et al. (1989) Presence of RNA in the sperm nucleus. Biochem Biophys Res Commun 158: 272–278. [DOI] [PubMed] [Google Scholar]
- 6. Ostermeier GC, Dix DJ, Miller D, Khatri P, Krawetz SA (2002) Spermatozoal RNA profiles of normal fertile men. Lancet 360: 772–777. [DOI] [PubMed] [Google Scholar]
- 7. Ostermeier GC, Goodrich RJ, Diamond MP, Dix DJ, Krawetz SA (2005) Toward using stable spermatozoal RNAs for prognostic assessment of male factor fertility. Fertil Steril 83: 1687–1694. [DOI] [PubMed] [Google Scholar]
- 8. Ostermeier GC, Goodrich RJ, Moldenhauer JS, Diamond MP, Krawetz SA (2005) A suite of novel human spermatozoal RNAs. J Androl 26: 70–74. [PubMed] [Google Scholar]
- 9. Carreau S, Lambard S, Said L, Saad A, Galeraud-Denis I (2007) RNA dynamics of fertile and infertile spermatozoa. Biochem Soc Trans 35: 634–636. [DOI] [PubMed] [Google Scholar]
- 10. Dadoune JP (2009) Spermatozoal RNAs: what about their functions? Microsc Res Tech 72: 536–551. [DOI] [PubMed] [Google Scholar]
- 11. Hamatani T (2012) Human spermatozoal RNAs. Fertility and sterility 97: 275–281. [DOI] [PubMed] [Google Scholar]
- 12. McIver SC, Roman SD, Nixon B, McLaughlin EA (2012) miRNA and mammalian male germ cells. Hum Reprod Update 18: 44–59. [DOI] [PubMed] [Google Scholar]
- 13. He Z, Kokkinaki M, Pant D, Gallicano GI, Dym M (2009) Small RNA molecules in the regulation of spermatogenesis. Reproduction 137: 901–911. [DOI] [PubMed] [Google Scholar]
- 14. Lee TL, Xiao A, Rennert OM (2012) Identification of novel long noncoding RNA transcripts in male germ cells. Methods Mol Biol 825: 105–114. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Hammoud SS, Nix DA, Zhang H, Purwar J, Carrell DT, et al. (2009) Distinctive chromatin in human sperm packages genes for embryo development. Nature 460: 473–478. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Spadafora C (2008) Sperm-mediated 'reverse' gene transfer: a role of reverse transcriptase in the generation of new genetic information. Hum Reprod 23: 735–740. [DOI] [PubMed] [Google Scholar]
- 17. Gur Y, Breitbart H (2006) Mammalian sperm translate nuclear-encoded proteins by mitochondrial-type ribosomes. Genes Dev 20: 411–416. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Gur Y, Breitbart H (2007) Protein translation in mammalian sperm. Soc Reprod Fertil Suppl 65391–397. [PubMed] [Google Scholar]
- 19. Gur Y, Breitbart H (2008) Protein synthesis in sperm: dialog between mitochondria and cytoplasm. Mol Cell Endocrinol 282: 45–55. [DOI] [PubMed] [Google Scholar]
- 20. Cuzin F, Rassoulzadegan M (2010) Non-Mendelian epigenetic heredity: gametic RNAs as epigenetic regulators and transgenerational signals. Essays in biochemistry 48: 101–106. [DOI] [PubMed] [Google Scholar]
- 21. Daxinger L, Whitelaw E (2012) Understanding transgenerational epigenetic inheritance via the gametes in mammals. Nat Rev Genet 13: 153–162. [DOI] [PubMed] [Google Scholar]
- 22. Rassoulzadegan M, Grandjean V, Gounon P, Vincent S, Gillot I, et al. (2006) RNA-mediated non-mendelian inheritance of an epigenetic change in the mouse. Nature 441: 469–474. [DOI] [PubMed] [Google Scholar]
- 23. Kempisty B, Antosik P, Bukowska D, Jackowska M, Lianeri M, et al. (2008) Analysis of selected transcript levels in porcine spermatozoa, oocytes, zygotes and two-cell stage embryos. Reprod Fertil Dev 20: 513–518. [DOI] [PubMed] [Google Scholar]
- 24. Yao CJ, Xu WJ, Gong XL, Zhou Y, Yan ZQ, et al. (2010) The role of Dby mRNA in early development of male mouse zygotes. Asian journal of andrology 12: 567–577. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Boerke A, Dieleman SJ, Gadella BM (2007) A possible role for sperm RNA in early embryo development. Theriogenology 68 Suppl 1: S147–155. [DOI] [PubMed] [Google Scholar]
- 26. Platts AE, Dix DJ, Chemes HE, Thompson KE, Goodrich R, et al. (2007) Success and failure in human spermatogenesis as revealed by teratozoospermic RNAs. Hum Mol Genet 16: 763–773. [DOI] [PubMed] [Google Scholar]
- 27. Aoki VW, Liu L, Jones KP, Hatasaka HH, Gibson M, et al. (2006) Sperm protamine 1/protamine 2 ratios are related to in vitro fertilization pregnancy rates and predictive of fertilization ability. Fertil Steril 86: 1408–1415. [DOI] [PubMed] [Google Scholar]
- 28. Nguyen MT, Delaney DP, Kolon TF (2008) Gene expression alterations in cryptorchid males using spermatozoal microarray analysis. Fertil Steril [DOI] [PubMed] [Google Scholar]
- 29. Bissonnette N, Levesque-Sergerie JP, Thibault C, Boissonneault G (2009) Spermatozoal transcriptome profiling for bull sperm motility: a potential tool to evaluate semen quality. Reproduction 138: 65–80. [DOI] [PubMed] [Google Scholar]
- 30. Avendano C, Franchi A, Jones E, Oehninger S (2009) Pregnancy-specific {beta}-1-glycoprotein 1 and human leukocyte antigen-E mRNA in human sperm: differential expression in fertile and infertile men and evidence of a possible functional role during early development. Hum Reprod 24: 270–277. [DOI] [PubMed] [Google Scholar]
- 31. Garrido N, Martinez-Conejero JA, Jauregui J, Horcajadas JA, Simon C, et al. (2009) Microarray analysis in sperm from fertile and infertile men without basic sperm analysis abnormalities reveals a significantly different transcriptome. Fertil Steril 91: 1307–1310. [DOI] [PubMed] [Google Scholar]
- 32. Gilbert I, Bissonnette N, Boissonneault G, Vallee M, Robert C (2007) A molecular analysis of the population of mRNA in bovine spermatozoa. Reproduction 133: 1073–1086. [DOI] [PubMed] [Google Scholar]
- 33. Lalancette C, Thibault C, Bachand I, Caron N, Bissonnette N (2008) Transcriptome analysis of bull semen with extreme nonreturn rate: use of suppression-subtractive hybridization to identify functional markers for fertility. Biol Reprod 78: 618–635. [DOI] [PubMed] [Google Scholar]
- 34. Feugang JM, Rodriguez-Osorio N, Kaya A, Wang H, Page G, et al. (2010) Transcriptome analysis of bull spermatozoa: implications for male fertility. Reprod Biomed Online 21: 312–324. [DOI] [PubMed] [Google Scholar]
- 35. Yang CC, Lin YS, Hsu CC, Wu SC, Lin EC, et al. (2009) Identification and sequencing of remnant messenger RNAs found in domestic swine (Sus scrofa) fresh ejaculated spermatozoa. Anim Reprod Sci 113: 143–155. [DOI] [PubMed] [Google Scholar]
- 36. Yang CC, Lin YS, Hsu CC, Tsai MH, Wu SC, et al. (2010) Seasonal effect on sperm messenger RNA profile of domestic swine (Sus Scrofa). Animal reproduction science 119: 76–84. [DOI] [PubMed] [Google Scholar]
- 37. Sudderth AK, Das PJ, Varner DD, Raudsepp T (2010) Determination of optimal semen processing methods for total RNA isolation and sperm genomic analysis. Animal Reproduction Science 121S: S149–S150. [Google Scholar]
- 38. Das PJ, Vishnoi M, Kachroo P, Wang J, Love CC, et al. (2010) Expression microarray profiling of sperm and testis mRNA of reproductively normal stallions. Animal Reproduction Science 121S S175 [Google Scholar]
- 39. Colenbrander B, Gadella BM, Stout TA (2003) The predictive value of semen analysis in the evaluation of stallion fertility. Reprod Domest Anim 38: 305–311. [DOI] [PubMed] [Google Scholar]
- 40. Blanchard TL, Varner DD (1997) Evaluation breeding soundness in stallions. 5. Predicting potential fertility. Vet Med Sept 815–818. [Google Scholar]
- 41. Woods J, Rigby S, Brinsko S, Stephens R, Varner D, et al. (2000) Effect of intrauterine treatment with prostaglandin E2 prior to insemination of mares in the uterine horn or body. Theriogenology 53: 1827–1836. [DOI] [PubMed] [Google Scholar]
- 42. Wade CM, Giulotto E, Sigurdsson S, Zoli M, Gnerre S, et al. (2009) Genome sequence, comparative analysis, and population genetics of the domestic horse. Science 326: 865–867. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 43. Edgar R, Domrachev M, Lash AE (2002) Gene Expression Omnibus: NCBI gene expression and hybridization array data repository. Nucleic Acids Res 30: 207–210. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 44. Barrett T, Troup DB, Wilhite SE, Ledoux P, Evangelista C, et al. (2011) NCBI GEO: archive for functional genomics data sets--10 years on. Nucleic acids research 39: D1005–1010. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 45. Xu X, Arnason U (1994) The complete mitochondrial DNA sequence of the horse, Equus caballus: extensive heteroplasmy of the control region. Gene 148: 357–362. [DOI] [PubMed] [Google Scholar]
- 46. Rumble SM, Lacroute P, Dalca AV, Fiume M, Sidow A, et al. (2009) SHRiMP: accurate mapping of short color-space reads. PLoS Comput Biol 5: e1000386. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 47. Mortazavi A, Williams BA, McCue K, Schaeffer L, Wold B (2008) Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nat Methods 5: 621–628. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 48. Martins RP, Krawetz SA (2007) Nuclear organization of the protamine locus. Soc Reprod Fertil Suppl 641–12. [DOI] [PubMed] [Google Scholar]
- 49. Choudhary SK, Wykes SM, Kramer JA, Mohamed AN, Koppitch F, et al. (1995) A haploid expressed gene cluster exists as a single chromatin domain in human sperm. J Biol Chem 270: 8755–8762. [DOI] [PubMed] [Google Scholar]
- 50. Bright LA, Burgess SC, Chowdhary B, Swiderski CE, McCarthy FM (2009) Structural and functional-annotation of an equine whole genome oligoarray. BMC Bioinformatics 10 Suppl 11: S8. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Paria N, Raudsepp T, Pearks Wilkerson AJ, O'Brien PC, Ferguson-Smith MA, et al. (2011) A gene catalogue of the euchromatic male-specific region of the horse Y chromosome: comparison with human and other mammals. PLoS One 6: e21374. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 52. Kumar A, Lee CM, Reddy EP (2003) c-Myc is essential but not sufficient for c-Myb-mediated block of granulocytic differentiation. J Biol Chem 278: 11480–11488. [DOI] [PubMed] [Google Scholar]
- 53. Chiang MH, Steuerwald N, Lambert H, Main EK, Steinleitner A (1994) Detection of human leukocyte antigen class I messenger ribonucleic acid transcripts in human spermatozoa via reverse transcription-polymerase chain reaction. Fertility and sterility 61: 276–280. [PubMed] [Google Scholar]
- 54. Garcia-Herrero S, Garrido N, Martinez-Conejero JA, Remohi J, Pellicer A, et al. (2011) Differential transcriptomic profile in spermatozoa achieving pregnancy or not via ICSI. Reproductive biomedicine online 22: 25–36. [DOI] [PubMed] [Google Scholar]
- 55. Srivastava J, Premi S, Kumar S, Ali S (2009) Expressional dynamics of minisatellite 33.15 tagged spermatozoal transcriptome in Bubalus bubalis. BMC Genomics 10: 303. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 56. Johnson GD, Sendler E, Lalancette C, Hauser R, Diamond MP, et al. (2011) Cleavage of rRNA ensures translational cessation in sperm at fertilization. Mol Hum Reprod 17: 721–726. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 57. Kawano M, Kawaji H, Grandjean V, Kiani J, Rassoulzadegan M (2012) Novel small noncoding RNAs in mouse spermatozoa, zygotes and early embryos. PLoS One 7: e44542. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 58. Wang Z, Gerstein M, Snyder M (2009) RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet 10: 57–63. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 59. Coleman SJ, Zeng Z, Wang K, Luo S, Khrebtukova I, et al. (2010) Structural annotation of equine protein-coding genes determined by mRNA sequencing. Anim Genet 41 Suppl 2: 121–130. [DOI] [PubMed] [Google Scholar]
- 60. Ostermeier GC, Dix DJ, Krawetz SA (2002) A bioinformatic strategy to rapidly characterize cDNA libraries. Bioinformatics 18: 949–952. [DOI] [PubMed] [Google Scholar]
- 61. Samplaski MK, Agarwal A, Sharma R, Sabanegh E (2010) New generation of diagnostic tests for infertility: review of specialized semen tests. Int J Urol 17: 839–847. [DOI] [PubMed] [Google Scholar]
- 62. Moore GD, Kopf GS, Schultz RM (1993) Complete mouse egg activation in the absence of sperm by stimulation of an exogenous G protein-coupled receptor. Dev Biol 159: 669–678. [DOI] [PubMed] [Google Scholar]
- 63. Etkovitz N, Tirosh Y, Chazan R, Jaldety Y, Daniel L, et al. (2009) Bovine sperm acrosome reaction induced by G-protein-coupled receptor agonists is mediated by epidermal growth factor receptor transactivation. Dev Biol 334: 447–457. [DOI] [PubMed] [Google Scholar]
- 64. Teves ME, Guidobaldi HA, Unates DR, Sanchez R, Miska W, et al. (2009) Molecular mechanism for human sperm chemotaxis mediated by progesterone. PLoS One 4: e8211. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65. Florman HM, Jungnickel MK, Sutton KA (2007) What can we learn about fertilization from cystic fibrosis? Proc Natl Acad Sci U S A 104: 11123–11124. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 66. Florman HM, Jungnickel MK, Sutton KA (2008) Regulating the acrosome reaction. Int J Dev Biol 52: 503–510. [DOI] [PubMed] [Google Scholar]
- 67. Saxena DK, Oh-Oka T, Kadomatsu K, Muramatsu T, Toshimori K (2002) Behaviour of a sperm surface transmembrane glycoprotein basigin during epididymal maturation and its role in fertilization in mice. Reproduction 123: 435–444. [DOI] [PubMed] [Google Scholar]
- 68. Spehr M, Schwane K, Riffell JA, Zimmer RK, Hatt H (2006) Odorant receptors and olfactory-like signaling mechanisms in mammalian sperm. Mol Cell Endocrinol 250: 128–136. [DOI] [PubMed] [Google Scholar]
- 69. Imai T, Sakano H (2008) Odorant receptor-mediated signaling in the mouse. Curr Opin Neurobiol 18: 251–260. [DOI] [PubMed] [Google Scholar]
- 70. Yao C, Wang Z, Zhou Y, Xu W, Li Q, et al. (2010) A study of Y chromosome gene mRNA in human ejaculated spermatozoa. Mol Reprod Dev 77: 158–166. [DOI] [PubMed] [Google Scholar]
- 71. Skaletsky H, Kuroda-Kawaguchi T, Minx PJ, Cordum HS, Hillier L, et al. (2003) The male-specific region of the human Y chromosome is a mosaic of discrete sequence classes. Nature 423: 825–837. [DOI] [PubMed] [Google Scholar]
- 72. Miller D, Ostermeier GC (2006) Spermatozoal RNA: Why is it there and what does it do? Gynecol Obstet Fertil 34: 840–846. [DOI] [PubMed] [Google Scholar]
- 73.Das PJ, Paria N, Gustafson-Seabury A, Vishnoi M, Chaki SP, et al. (2010) Total RNA isolation from stallion sperm and testis biopsies. Theriogenology 74: 1099–1106, 1106e1091––1092. [DOI] [PubMed]
- 74. Zhou M, Wang Q, Sun J, Li X, Xu L, et al. (2009) In silico detection and characteristics of novel microRNA genes in the Equus caballus genome using an integrated ab initio and comparative genomic approach. Genomics 94: 125–131. [DOI] [PubMed] [Google Scholar]
- 75. Krawetz SA, Kruger A, Lalancette C, Tagett R, Anton E, et al. (2011) A survey of small RNAs in human sperm. Hum Reprod 26: 3401–3412. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 76. Curry E, Ellis SE, Pratt SL (2009) Detection of porcine sperm microRNAs using a heterologous microRNA microarray and reverse transcriptase polymerase chain reaction. Mol Reprod Dev 76: 218–219. [DOI] [PubMed] [Google Scholar]
- 77. Liu WM, Pang RT, Chiu PC, Wong BP, Lao K, et al. (2012) Sperm-borne microRNA-34c is required for the first cleavage division in mouse. Proc Natl Acad Sci U S A 109: 490–494. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 78. Peng H, Shi J, Zhang Y, Zhang H, Liao S, et al. (2012) A novel class of tRNA-derived small RNAs extremely enriched in mature mouse sperm. Cell Res 22: 1609–1612. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 79. Grandjean V, Gounon P, Wagner N, Martin L, Wagner KD, et al. (2009) The miR-124-Sox9 paramutation: RNA-mediated epigenetic control of embryonic and adult growth. Development 136: 3647–3655. [DOI] [PubMed] [Google Scholar]
- 80. Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, et al. (2012) Birth and expression evolution of mammalian microRNA genes. Genome Res [DOI] [PMC free article] [PubMed] [Google Scholar]
- 81. Mercer TR, Dinger ME, Mattick JS (2009) Long non-coding RNAs: insights into functions. Nat Rev Genet 10: 155–159. [DOI] [PubMed] [Google Scholar]
- 82. Grunewald S, Paasch U, Glander HJ, Anderegg U (2005) Mature human spermatozoa do not transcribe novel RNA. Andrologia 37: 69–71. [DOI] [PubMed] [Google Scholar]
- 83. Ostermeier GC, Miller D, Huntriss JD, Diamond MP, Krawetz SA (2004) Reproductive biology: delivering spermatozoan RNA to the oocyte. Nature 429: 154. [DOI] [PubMed] [Google Scholar]
- 84. Pittoggi C, Beraldi R, Sciamanna I, Barberi L, Giordano R, et al. (2006) Generation of biologically active retro-genes upon interaction of mouse spermatozoa with exogenous DNA. Mol Reprod Dev 73: 1239–1246. [DOI] [PubMed] [Google Scholar]
- 85. Zhao C, Guo XJ, Shi ZH, Wang FQ, Huang XY, et al. (2009) Role of translation by mitochondrial-type ribosomes during sperm capacitation: an analysis based on a proteomic approach. Proteomics 9: 1385–1399. [DOI] [PubMed] [Google Scholar]
- 86. Puri D, Dhawan J, Mishra RK (2010) The paternal hidden agenda: Epigenetic inheritance through sperm chromatin. Epigenetics 5: 386–391. [DOI] [PubMed] [Google Scholar]
- 87. Varner DD (2008) Developments in stallion semen evaluation. Theriogenology 70: 448–462. [DOI] [PubMed] [Google Scholar]
- 88. Varner DD, Blanchard TL, Brinsko SP, Love CC, Taylor TS, et al. (2000) Techniques for evaluating selected reproductive disorders of stallions. Anim Reprod Sci 60–61: 493–509. [DOI] [PubMed] [Google Scholar]
- 89. Chomczynski P, Mackey K (1995) Short technical reports. Modification of the TRI reagent procedure for isolation of RNA from polysaccharide- and proteoglycan-rich sources. Biotechniques 19: 942–945. [PubMed] [Google Scholar]
- 90. Smyth GK, Speed T (2003) Normalization of cDNA microarray data. Methods 31: 265–273. [DOI] [PubMed] [Google Scholar]
- 91. Rozen S, Skaletsky H (2000) Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 132: 365–386. [DOI] [PubMed] [Google Scholar]
- 92. Tang F, Barbacioru C, Wang Y, Nordman E, Lee C, et al. (2009) mRNA-Seq whole-transcriptome analysis of a single cell. Nature methods 6: 377–382. [DOI] [PubMed] [Google Scholar]
- 93. Needleman SB, Wunsch CD (1970) A general method applicable to the search for similarities in the amino acid sequence of two proteins. J Mol Biol 48: 443–453. [DOI] [PubMed] [Google Scholar]
- 94. Saengsoi W, Shia WY, Shyu CL, Wu JT, Warinrak C, et al. (2011) Detection of matrix metalloproteinase (MMP)-2 and MMP-9 in canine seminal plasma. Anim Reprod Sci 127: 114–119. [DOI] [PubMed] [Google Scholar]
- 95. Zhao M, Shirley CR, Yu YE, Mohapatra B, Zhang Y, et al. (2001) Targeted disruption of the transition protein 2 gene affects sperm chromatin structure and reduces fertility in mice. Mol Cell Biol 21: 7243–7255. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 96. Bench GS, Friz AM, Corzett MH, Morse DH, Balhorn R (1996) DNA and total protamine masses in individual sperm from fertile mammalian subjects. Cytometry 23: 263–271. [DOI] [PubMed] [Google Scholar]
- 97. Peddinti D, Nanduri B, Kaya A, Feugang JM, Burgess SC, et al. (2008) Comprehensive proteomic analysis of bovine spermatozoa of varying fertility rates and identification of biomarkers associated with fertility. BMC Syst Biol 2: 19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 98. Kameshwari DB, Bhande S, Sundaram CS, Kota V, Siva AB, et al. (2010) Glucose-regulated protein precursor (GRP78) and tumor rejection antigen (GP96) are unique to hamster caput epididymal spermatozoa. Asian J Androl 12: 344–355. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 99. Feugang JM, Kaya A, Page GP, Chen L, Mehta T, et al. (2009) Two-stage genome-wide association study identifies integrin beta 5 as having potential role in bull fertility. BMC Genomics 10: 176. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 100. Paillisson A, Dade S, Callebaut I, Bontoux M, Dalbies-Tran R, et al. (2005) Identification, characterization and metagenome analysis of oocyte-specific genes organized in clusters in the mouse genome. BMC Genomics 6: 76. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 101. Bader M, Arama E, Steller H (2010) A novel F-box protein is required for caspase activation during cellular remodeling in Drosophila. Development 137: 1679–1688. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 102. Cavalcanti MC, Steilmann C, Failing K, Bergmann M, Kliesch S, et al. (2011) Apoptotic gene expression in potentially fertile and subfertile men. Mol Hum Reprod 17: 415–420. [DOI] [PubMed] [Google Scholar]
- 103. Arangasamy A, Kasimanickam VR, DeJarnette JM, Kasimanickam RK (2011) Association of CRISP2, CCT8, PEBP1 mRNA abundance in sperm and sire conception rate in Holstein bulls. Theriogenology 76: 570–577. [DOI] [PubMed] [Google Scholar]
- 104. Neuhaus EM, Mashukova A, Barbour J, Wolters D, Hatt H (2006) Novel function of beta-arrestin2 in the nucleus of mature spermatozoa. J Cell Sci 119: 3047–3056. [DOI] [PubMed] [Google Scholar]
- 105. Coates JC (2003) Armadillo repeat proteins: beyond the animal kingdom. Trends Cell Biol 13: 463–471. [DOI] [PubMed] [Google Scholar]
- 106. Boyer A, Yeh JR, Zhang X, Paquet M, Gaudin A, et al. (2012) CTNNB1 signaling in sertoli cells downregulates spermatogonial stem cell activity via WNT4. PLoS One 7: e29764. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 107. Yamazaki K, Adachi T, Sato K, Yanagisawa Y, Fukata H, et al. (2006) Identification and characterization of novel and unknown mouse epididymis-specific genes by complementary DNA microarray technology. Biol Reprod 75: 462–468. [DOI] [PubMed] [Google Scholar]
- 108. Fujita K, Shimazaki N, Ohta Y, Kubota T, Ibe S, et al. (2003) Terminal deoxynucleotidyltransferase forms a ternary complex with a novel chromatin remodeling protein with 82 kDa and core histone. Genes Cells 8: 559–571. [DOI] [PubMed] [Google Scholar]
- 109. Huber C, Martensson A, Bokoch GM, Nemazee D, Gavin AL (2008) FGD2, a CDC42-specific exchange factor expressed by antigen-presenting cells, localizes to early endosomes and active membrane ruffles. J Biol Chem 283: 34002–34012. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 110. Cao XG, Kou CZ, Zhao YP, Gao CL, Zhu C, et al. (2010) Overexpression of LYRM1 induces mitochondrial impairment in 3T3-L1 adipocytes. Mol Genet Metab 101: 395–399. [DOI] [PubMed] [Google Scholar]
- 111. Johnson AR, Craciunescu CN, Guo Z, Teng YW, Thresher RJ, et al. (2010) Deletion of murine choline dehydrogenase results in diminished sperm motility. Faseb J 24: 2752–2761. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 112.Dun MD, Aitken RJ, Nixon B (2012) The role of molecular chaperones in spermatogenesis and the post-testicular maturation of mammalian spermatozoa. Hum Reprod Update. [DOI] [PubMed]
- 113. Miranda-Vizuete A, Ljung J, Damdimopoulos AE, Gustafsson JA, Oko R, et al. (2001) Characterization of Sptrx, a novel member of the thioredoxin family specifically expressed in human spermatozoa. J Biol Chem 276: 31567–31574. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Scatter plots of qRT-PCR statistics for DE genes in sperm and testes by microarray analysis (see also Fig. 3 ). A Sperm up-regulated genes: a. PAD16, p-value 0.025063716, Fold change -17.74531191(sperm), 5.757703597 (testis); b. DNAJC16B, p-value 0.000370874, Fold change -59.55886046 (sperm), 1.329895004 (testis); c. DCDC2, p-value 0.009505038, Fold change -41.79889717 (sperm), 1.054235336 (testis); d. CTTN, p-value 0.025377064, Fold change -114.2727567 (sperm), 17.61968043 (testis); e. REEP6, p-value 5.65337E-05, Fold change -858.1806418 (sperm), 5.757703597 (testis); f. ARID5B, p-value 0.029703844, Fold change -2.675065645 (sperm), 0.370649473 (testis); g. ATG12, p-value 0.079897582, Fold change -4.477059424 (sperm), 0.693040106 (testes); B Sperm down-regulated genes: a. GSTA1, p-value 0.008611828, Fold change -0.427023 (sperm), 8.3 (testes); b. DYNTL1, p-value 0.028173, Fold change -0.777409 (sperm), 2.95 (testes); c. SPA17, p-value 0.016193, Fold change -0.569896 (sperm), 1.75 (testes); d. CTTN, p-value 3.3E-05, Fold change -0.24142 (sperm), 4.14.
(TIF)
Sperm RNA quality check. A Bioanalyzer analysis showing that mature sperm is devoid of intact ribosomal 18S and 28S RNA; B RT-PCR with sperm and testis specific PRM2 (left) and sperm-negative PTPRC.
(TIF)
Gene Ontology classifications and terms for 3,319 sperm transcripts by microarray analysis. This table contains GO analysis statistics for all annotated genes that were expressed in sperm by microarray analysis. The GO categories i) Biological process, ii) Molecular function, and iii) Cellular component are shown on separate spreadsheets; Count-number of genes associated with this gene set; Percentage-genes associated with this gene set/total number of query genes; P -value-modified Fisher Exact P-value; Genes-the list of genes from query set that are annotated to this gene set.
(XLS)
Most significant (p<0.001) GO terms for sperm transcripts identified by microarray analysis (count-number of genes associated with this gene set).
(DOCX)
Gene Ontology classifications and terms for 165 sperm-enriched transcripts by microarray analysis. This table lists GO analysis statistics for the sperm-enriched genes. The GO categories i) Biological process, ii) Molecular function, and iii) Cellular component are shown on separate spreadsheets; Count-number of genes associated with this gene set; Percentage-genes associated with this gene set/total number of query genes; P -value-modified Fisher Exact P-value; Genes-the list of genes from query set that are annotated to this gene set.
(XLSX)
Differentially expressed genes (n = 155) between the sperm and the testes. A list of the 60 sperm up-regulated and 95 sperm down-regulated genes, their NCBI and RefSeq accession numbers, logFC-log2 fold change in expression between sperm and testes; AveExpr-average log2-expression level of that gene across red-green channels, and P-value; NULL–no annotation; #NA = unknown.
(XLS)
Mapped RNA sequence tags (n = 19,257) from the sperm of the two stallions. The table presents the following information for each mapped sequence tag: i) genomic location, ii) average coverage in sperm 1 (AC1) and sperm 2 (AC2), and iii) log2 ratios between AC1 and AC2. Columns at the left are sorted by AC1 and columns at the right by AC2. Mapped tags with AC≥1 are shaded grey.
(XLS)
List of the 136 genes from RNA-seq data with structural annotations both in the horse and the human genome.
(DOCX)
The 82 sperm micro RNAs discovered by RNA-Seq.
(DOCX)
Correspondence of the RNA-Seq data with the current NCBI gene models for PKM2 , CRISP3 , TNP2 and PRM1 .
(DOCX)
Alignment and coverage statistics for RNA-seq reads in the horse genome.
(XLSX)




