Abstract
To identify mutations in the retinoschisin (RS1) gene in families with X-linked retinoschisis (XLRS). Twenty families with XLRS were enrolled in this study. All six coding exons and adjacent intronic regions of RS1 were amplified by polymerase chain reaction (PCR). The nucleotide sequences of the amplicons were determined by Sanger sequencing. Ten hemizygous mutations in RS1 were detected in patients from 14 of the 20 families. Four of the ten mutations were novel, including c:176G>A (p:Cys59Tyr) in exon 3, c:531T>G (p:Tyr177X), c:607C>G (p:Pro203Ala) and c:668G>A (p:Cys223Tyr) in exon 6. These four novel mutations were not present in 176 normal individuals. The remaining six were recurrent mutations, including c:214G>A (p:Glu72Lys), c:304C>T (p:Arg102Trp), c:436G>A (p:Glu146Lys), c:544C>T (p:Arg182Cys), c:599G>A (p:Arg200His) and c:644A>T (p:Glu215Val). Our study expanded the mutation spectrum of RS1 and enriches our understanding of the molecular basis of XLRS.
Keywords: mutations, RS1 gene, retinoschisis
Introduction
X-linked retinoschisis (XLRS, MIM 312700) is a hereditary retinal disease characterized by a splitting of the neurosensory retina, with a prevalence of 1:5,000 to 1:25,000 males worldwide (1). Typical fundus changes include radiating cysteic maculopathy in most cases and peripheral retinoschisis in half of the cases (2). However, the disease has a high degree of phenotypic variability (3–6), in which genetic testing is of value in confirming the diagnosis (4).
XLRS accounts for most congenital retinoschisis (2,7) and is due to mutations in the retinoschisin gene (RS1, OMIM 312700) localized on Xp22.13 (8,9). The encoded protein, retinoschisin, is secreted from photoreceptors and bipolar cells as a functional homo-octameric complex that is thought to play a role in cellular adhesion and cell-to-cell interaction (10).
Gene transference to mouse models of X-linked juvenile retinoschisis, which suggest gene replacement may be a possible future therapy for patients (11–13). Genetic diagnosis is the basis for gene transference in the future. Therefore, we have to fully understand the molecular basis of XLRS. To date, more than 160 different RS1 mutations have been identified in patients with XLRS (http://www.dmd.nl/rs), including small intragenic deletions, nonsense and missense mutations, frame shift insertions and deletions, and splice site mutations. However, there are still some RS1 mutations that remain unknown.
In this study, we analyzed the coding exons and the adjacent regions of RS1 in patients from 20 unrelated Chinese families with XLRS. Ten hemizygous mutations, including 4 novel mutations, were detected in 14 families.
Subjects and methods
Probands with XLRS from 20 unrelated families were enrolled in this study. Written informed consent was obtained from the participating individuals or their guardians prior to the collection of clinical data and genomic samples. This study was approved by the Internal Review Board of the Zhongshan Ophthalmic Center.
Mutation detection
Genomic DNA was prepared from venous leukocytes. Six pairs of primers (Table I) were used to amplify the six coding exons and the adjacent intronic sequence of RS1 (NCBI human genome build 37.2, NG_008659.1 for genomic DNA, NM_000330.3 for mRNA, and NP_000321.1 for protein). Touchdown polymerase chain reaction (PCR) was performed with decreasing 0.5°C per cycle from 64°C for the first 15 cycles then down to 57°C (the annealing temperature) for the remaining 21 cycles. GC buffer was used. DNA sequences of the amplicons were identified with ABI BigDye Terminator cycle sequencing kit version 3.1 (Applied Biosystems, Foster City, CA) on an ABI 3130 Genetic Analyzer (Applied Biosystems). Sequencing results and consensus sequences from the NCBI human genome database were compared by using the SeqMan II program of the Lasergene package (DNA Star, Inc., Madison, WI) and then aligned to identify variations. Each variation was confirmed by bidirectional sequencing. Mutation description followed the recommendation of the Human Genomic Variation Society (HGVS). Variations detected in patients were further evaluated in controls by sequencing 176 normal individuals.
Table I.
Primers used for the amplification and sequencing of RS1.
| Exon | Direction | Primer sequence (5′-3′) | Size of amplified fragment (bp) | Annealing temperature (°C) |
|---|---|---|---|---|
| 1 | F | GGTTAACTTGATGGGGCTCA | 374 | 57 |
| R | AACTGGAAAGCCATCCACAC | |||
| 2 | F | TCTATTTCACTTTTCCATGTAACGA | 243 | 57 |
| R | ACCATGCCCAGCCAAAATA | |||
| 3 | F | GACGATGCATAAGGACTGAGTG | 296 | 57 |
| R | AGCGTTCAGGGGGTTAATTC | |||
| 4 | F | GCAAAGCAGATGGGTTTGTT | 359 | 57 |
| R | CCACCACGCCAGTTAATTTT | |||
| 5 | F | CAGGGGGCTCTTTGGATG | 389 | 57 |
| R | ACAGAGGGCAGTGACAGGAG | |||
| 6 | F | CACCCGCAAACTGCTTTAAC | 384 | 57 |
| R | TGCGAAATATAGCCCTGTCC |
GC buffer was used in all amplifications. F, indicates the forward sequence; R, indicates the reverse sequence.
The Sorting Intolerant From Tolerant (SIFT) program and the Polymorphism Phenotyping (PolyPhen-2) were used to predict whether an amino acid substitution was likely to affect the protein function (14,15).
Results
Mutation analysis
Ten hemizygous mutations in RS1 were detected in patients from 14 of the 20 families with retinoschisis (Table II and Fig. 1), including c:176G>A (p:Cys59Tyr) in exon 3, c:214G>A (p:Glu72Lys) and c:304C>T (p:Arg102Trp) in exon 4, c:436G>A (p:Glu146Lys) in exon 5, c.531T>G (p:Tyr177X), c:544C>T (p:Arg182Cys), c:599G>A (p:Arg200His), c:607C>G (p:Pro203Ala), c:644A>T (p:Glu215Val) and c:668G>A (p:Cys223Tyr) in exon 6. Of the 10, the c:176G>A, c:531T>G, c:607C>G and c:668G>A were novel. These novel mutations occurred in highly conserved regions (Fig. 2) and were predicted to be pathogenic (Table II). They were absent in 176 normal individuals.
Table II.
The mutations of the RS1 gene in XLRS.
| Computational prediction | Frequency | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
|||||||||
| Exon | Patient ID | Nucleotide change | Amino acid change | Blosum62 | PolyPhen | SIFT | Patients | Controls | Note | Ref |
| 3 | QT42, QT335 | c:176G>A | p:Cys59Tyr | 9→-2 | 0.996 | 0 | 2/20 | 0/176 | Novel | |
| 4 | QT221, QT232, QT653 | c:214G>A | p:Glu72Lys | 5→1 | 0.998 | 0 | 3/20 | Reported | (19) | |
| 4 | MD15 | c:304C>T | p:Arg102Trp | 5→-3 | 1 | 0 | 1/20 | Reported | (20) | |
| 5 | RP6 | c:436G>A | p:Glu146Lys | 5→1 | 0.961 | 0.17 | 1/20 | Reported | (21) | |
| 6 | MD30 | c:531T>G | p:Tyr177X | 1/20 | 0/176 | Novel | ||||
| 6 | QT417, QT212 | c:544C>T | p:Arg182Cys | 5→-3 | 1 | 0.01 | 2/20 | Reported | (22) | |
| 6 | QT848 | c:599G>A | p:Arg200His | 5→0 | 1 | 0 | 1/20 | Reported | (23) | |
| 6 | QT911 | c:607C>G | p:Pro203Ala | 7→-1 | 1 | 0.13 | 1/20 | 0/176 | Novel | |
| 6 | QT219 | c:644A>T | p:Glu215Val | 5→-3 | 1 | 0 | 1/20 | Reported | (31) | |
| 6 | QT758 | c:668G>A | p:Cys223Tyr | 9→-2 | 0.996 | 0.01 | 1/20 | 0/176 | Novel | |
All mutations are hemizygous.
Figure 1.
Sequence chromatography. Four novel sequence changes detected in the probands with RS are shown (left column) compared with corresponding normal sequences (right column).
Figure 2.
Protein sequence alignment of six RS1 orthologs. The regions with the novel p.C59Y and p.P203A mutations are highly conserved, C223Y is comparatively conserved.
All 10 probands with hemizygous RS1 mutations (the clinical data of 4 probands were not available) had clinical symptoms and signs of retinoschisis (Table III). The four probands with novel mutations showed macular and peripheral retinoschisis.
Table III.
Clinical information on individuals with RS1 variations.
| Mutations | Age (years) | BCVA | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
|
|
|
|||||||||||
| Patient ID | Nucleotide | Protein | Exam | Onset | Family history | OD | OS | Macular change | Peripheral change | Retinal hole | Strabismus | OCT | ERG(b/a) |
| QT042 | 176G>A | Cys59Tyr | N/A | N/A | No | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| QT335 | 176G>A | Cys59Tyr | 11 | 6 | No | 0.4 | 0.2 | mRS | pRS | No | No | RS | N/A |
| QT221 | 214G>A | Glu72Lys | 19 | EC | Yes | 0.1 | 0.2 | mRS | PD | No | No | N/A | N/A |
| QT232 | 214G>A | Glu72Lys | 18 | 8 | No | 0.4 | 0.2 | mRS | Degenenation | No | No | N/A | N/A |
| QT653 | 214G>A | Glu72Lys | 5 | 3 | No | 0.3 | 0.7 | mRS | pRS | Yes | No | N/A | Reduced |
| MD015 | 304C>T | Arg102Trp | N/A | 7 | No | 0.2 | 0.3 | PD, FRB | No | No | No | N/A | N/A |
| RP006 | 436G>A | Glu146Lys | 5 | 4 | No | FC | 0.03 | PD, FRB | No | No | No | N/A | Reduced |
| MD030 | 531T>G | Tyr177X | 6 | 5 | No | 0.3 | FC | mRS | pRS | No | Yes | N/A | Reduced |
| QT212 | 544C>T | Arg182Cys | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| QT417 | 544C>T | Arg182Cys | 12 | EC | No | 0.3 | 0.03 | No | pRS | Yes | No | N/A | N/A |
| QT848 | 599G>A | Arg200His | 21 | EC | No | 0.6 | 0.4 | mRS | No | No | No | N/A | Reduced |
| QT911 | 607C>G | Pro203Ala | 22 | EC | No | 0.2 | 0.4 | mRS | pRS | No | Yes | N/A | N/A |
| QT219 | 644A>T | Glu215Val | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A | N/A |
| QT758 | 668G>A | Cys223Tyr | 9 | 6 | No | 0.4 | 0.3 | mRS | pRS | Yes | No | RS | N/A |
BCVA, best-corrected visual acuity; mRS, macular retinoschisis; pRS, peripheral retinoschisis; RS retinoschisis; EC, early childhood; N/A, not available; PD, pigmental disorder; FRB, foveal reflex was blunted; FC, figure counting; ERG(b/a), the ratio of b wave amplitude to a wave amplitude.
Discussion
In this study, ten different hemizygous mutations in RS1 were identified in 14 families with XLRS. These mutations are predicted to be pathogenic. All patients with mutations demonstrated typical signs of XLRS. The ten mutations affected different domains of retinoschisin, including the RS1 domain (1 mutation), discoidin domain (8 mutations) and C-terminal segment (1 mutation). These mutations were not randomly distributed over the gene (Fig. 3) because 80% of mutations were clustered in the discoidin domain (16). The two novel mutations, Tyr177X and Pro203Ala in the discoidin domain, may cause a shorter retinoschisin form or protein misfolding (13). The cysteine mutations in the RS1 domain (Cys59Tyr) and C-terminal segment (Cys223Tyr) may cause failure of the discoidin domain to assemble into a normal multisubunit complex (17,18).
Figure 3.
Distribution of the mutations detected a linear diagram of RS1 showing the organization of retinoschisin into domains and segments.
Most of RS1 mutation loci were hot mutation spots, while the Cys59, Glu72, Arg102, Glu146, Arg182, Arg200, Pro203, Glu215 and Cys223 could be substituted by 1–2 other kinds of amino acids and be reported more frequently (19–30). However, the mutations in the present study also differed from those reported previously. The RS1 mutations accounts for 70% of the Chinese retinoschisis (14/20) cases in our study. The Cys59Tyr, Tyr177X, Pro203Ala, Glu215Val and Cys223Tyr mutations only are present in the Chinese population (31), and the Cys59Tyr mutation was more common (10% frequency in our retinoschisis cases). The Glu72Lys mutation is the most common among Chinese (15%) as well as other populations (19,32), while another very common mutation, Pro192Ser (33), which was reported from people of different ethnic backgrounds was not found. We do not know whether the spectrum and frequency of RS1 gene in the Chinese is different from others. Our study contributes to the current state of knowledge.
In summary, we identified ten mutations in 14 of 20 families with XLRS. Our results expand the mutation spectrum of RS1 that might enrich our understanding of the molecular basis of XLRS in the Chinese population.
Acknowledgements
The authors thank all of the patients and controls subjects for their participation. This study was supported by the Open Research Fund Program of State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-Sen University, and in part by grant 30725044 from the National Science Fund for Distinguished Young Scholars.
References
- 1. MacDonald IM, Sasi R. Molecular genetics of inherited eye disorders. Clin Invest Med. 1994;17:474–498. [PubMed] [Google Scholar]
- 2. Sikkink SK, Biswas S, Parry NR, Stanga PE, Trump D. X-linked retinoschisis: an update. J Med Genet. 2007;44:225–232. doi: 10.1136/jmg.2006.047340. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Apushkin MA, Fishman GA, Rajagopalan AS. Fundus findings and longitudinal study of visual acuity loss in patients with X-linked retinoschisis. Retina. 2005;25:612–618. doi: 10.1097/00006982-200507000-00012. [DOI] [PubMed] [Google Scholar]
- 4. Tantri A, Vrabec TR, Cu-Unjieng A, Frost A, Annesley WH, Jr, Donoso LA. X-linked retinoschisis: a clinical and molecular genetic review. Surv Ophthalmol. 2004;49:214–230. doi: 10.1016/j.survophthal.2003.12.007. [DOI] [PubMed] [Google Scholar]
- 5. Shukla D, Rajendran A, Gibbs D, Suganthalakshmi B, Zhang K, Sundaresan P. Unusual manifestations of X-linked retinoschisis: clinical profile and diagnostic evaluation. Am J Ophthalmol. 2007;144:419–423. doi: 10.1016/j.ajo.2007.05.016. [DOI] [PubMed] [Google Scholar]
- 6. Kim JE, Ruttum MS, Koeberl MJ, Hassemer EL, Sidjanin DJ. Genetic and clinical evaluation of juvenile retinoschisis. J AAPOS. 2009;13:215–217. doi: 10.1016/j.jaapos.2008.11.005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Sauer CG, Gehrig A, Warneke-Wittstock R, et al. Positional cloning of the gene associated with X-linked juvenile retinoschisis. Nat Genet. 1997;17:164–170. doi: 10.1038/ng1097-164. [DOI] [PubMed] [Google Scholar]
- 8. Mendoza-Londono R, Hiriyanna KT, Bingham EL, et al. A Colombian family with X-linked juvenile retinoschisis with three affected females finding of a frameshift mutation. Ophthalmic Genet. 1999;20:37–43. doi: 10.1076/opge.20.1.37.2299. [DOI] [PubMed] [Google Scholar]
- 9. Huopaniemi L, Rantala A, Tahvanainen E, de la Chapelle A, Alitalo T. Linkage disequilibrium and physical mapping of X-linked juvenile retinoschisis. Am J Hum Genet. 1997;60:1139–1149. [PMC free article] [PubMed] [Google Scholar]
- 10. Besch D, Rudolph G. Genetic diseases of the eye. Klin Monbl Augenheilkd. 2005;222:955–971. doi: 10.1055/s-2005-858714. (In German) [DOI] [PubMed] [Google Scholar]
- 11. Min SH, Molday LL, Seeliger MW, et al. Prolonged recovery of retinal structure/function after gene therapy in an Rs1h-deficient mouse model of X-linked juvenile retinoschisis. Mol Ther. 2005;12:644–651. doi: 10.1016/j.ymthe.2005.06.002. [DOI] [PubMed] [Google Scholar]
- 12. Dyka FM, Molday RS. Coexpression and interaction of wild-type and missense RS1 mutants associated with X-linked retinoschisis: its relevance to gene therapy. Invest Ophthalmol Vis Sci. 2007;48:2491–2497. doi: 10.1167/iovs.06-1465. [DOI] [PubMed] [Google Scholar]
- 13. Molday RS. Focus on molecules: retinoschisin (RS1) Exp Eye Res. 2007;84:227–228. doi: 10.1016/j.exer.2005.12.013. [DOI] [PubMed] [Google Scholar]
- 14. Ng PC, Henikoff S. Predicting deleterious amino acid substitutions. Genome Res. 2001;11:863–874. doi: 10.1101/gr.176601. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Sunyaev S, Ramensky V, Koch I, Lathe W, III, Kondrashov AS, Bork P. Prediction of deleterious human alleles. Hum Mol Genet. 2001;10:591–597. doi: 10.1093/hmg/10.6.591. [DOI] [PubMed] [Google Scholar]
- 16. Molday LL, Hicks D, Sauer CG, Weber BH, Molday RS. Expression of X-linked retinoschisis protein RS1 in photoreceptor and bipolar cells. Invest Ophthalmol Vis Sci. 2001;42:816–825. [PubMed] [Google Scholar]
- 17. Wu WW, Wong JP, Kast J, Molday RS. RS1, a discoidin domain-containing retinal cell adhesion protein associated with X-linked retinoschisis, exists as a novel disulfide-linked octamer. J Biol Chem. 2005;280:10721–10730. doi: 10.1074/jbc.M413117200. [DOI] [PubMed] [Google Scholar]
- 18. Wu WW, Molday RS. Defective discoidin domain structure, subunit assembly, and endoplasmic reticulum processing of retinoschisin are primary mechanisms responsible for X-linked retinoschisis. J Biol Chem. 2003;278:28139–28146. doi: 10.1074/jbc.M302464200. [DOI] [PubMed] [Google Scholar]
- 19. Hotta Y, Fujiki K, Hayakawa M, et al. Japanese juvenile retinoschisis is caused by mutations of the XLRS1 gene. Hum Genet. 1998;103:142–144. doi: 10.1007/pl00008705. [DOI] [PubMed] [Google Scholar]
- 20. Dodds JA, Srivastava AK, Holden KR. Unusual phenotypic expression of an XLRS1 mutation in X-linked juvenile retinoschisis. J Child Neurol. 2006;21:331–333. doi: 10.1177/08830738060210041901. [DOI] [PubMed] [Google Scholar]
- 21. Khan NW, Jamison JA, Kemp JA, Sieving PA. Analysis of photoreceptor function and inner retinal activity in juvenile X-linked retinoschisis. Vision Res. 2001;41:3931–3942. doi: 10.1016/s0042-6989(01)00188-2. [DOI] [PubMed] [Google Scholar]
- 22. Mashima Y, Shinoda K, Ishida S, et al. Identification of four novel mutations of the XLRS1 gene in Japanese patients with X-linked juvenile retinoschisis. Mutation in brief no 234. Online Hum Mutat. 1999;13:338. doi: 10.1002/(SICI)1098-1004(1999)13:4<338::AID-HUMU16>3.0.CO;2-0. [DOI] [PubMed] [Google Scholar]
- 23. Lledo B, Ten J, Rodriguez-Arnedo D, Llacer J, Bernabeu R. Preimplantation genetic diagnosis of X-linked retinoschisis. Reprod Biomed Online. 2008;16:886–892. doi: 10.1016/s1472-6483(10)60157-5. [DOI] [PubMed] [Google Scholar]
- 24. Tuvdendorj D, Isashiki Y, Ohba N, Sonoda S, Izumo S. Two Japanese patients with mutations in the XLRS1 gene. Retina. 2002;22:354–357. doi: 10.1097/00006982-200206000-00017. [DOI] [PubMed] [Google Scholar]
- 25. Inoue Y, Yamamoto S, Inoue T, et al. Two novel point mutations of the XLRS1 gene in patients with X-linked juvenile retinoschisis. Am J Ophthalmol. 2002;134:622–624. doi: 10.1016/s0002-9394(02)01592-1. [DOI] [PubMed] [Google Scholar]
- 26. Simonelli F, Cennamo G, Ziviello C, et al. Clinical features of X linked juvenile retinoschisis associated with new mutations in the XLRS1 gene in Italian families. Br J Ophthalmol. 2003;87:1130–1134. doi: 10.1136/bjo.87.9.1130. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Walia S, Fishman GA, Molday RS, et al. Relation of response to treatment with dorzolamide in X-linked retinoschisis to the mechanism of functional loss in retinoschisin. Am J Ophthalmol. 2009;147:111–115. doi: 10.1016/j.ajo.2008.07.041. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Wang T, Zhou A, Waters CT, O’Connor E, Read RJ, Trump D. Molecular pathology of X linked retinoschisis: mutations interfere with retinoschisin secretion and oligomerisation. Br J Ophthalmol. 2006;90:81–86. doi: 10.1136/bjo.2005.078048. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Dyka FM, Wu WW, Pfeifer TA, Molday LL, Grigliatti TA, Molday RS. Characterization and purification of the discoidin domain-containing protein retinoschisin and its interaction with galactose. Biochemistry. 2008;47:9098–9106. doi: 10.1021/bi800938g. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Ma X, Li X, Wang L. Novel XLRS1 gene mutations cause X-linked juvenile retinoschisis in Chinese families. Jpn J Ophthalmol. 2008;52:48–51. doi: 10.1007/s10384-007-0488-4. [DOI] [PubMed] [Google Scholar]
- 31. Zeng M, Yi C, Guo X, et al. Identification of novel mutations in the XLRS1 gene in Chinese patients with X-linked juvenile retinoschisis. Curr Eye Res. 2007;32:685–691. doi: 10.1080/02713680701486410. [DOI] [PubMed] [Google Scholar]
- 32. Lesch B, Szabo V, Kanya M, et al. Clinical and genetic findings in Hungarian patients with X-linked juvenile retinoschisis. Mol Vis. 2008;14:2321–2332. [PMC free article] [PubMed] [Google Scholar]
- 33. Eksandh LC, Ponjavic V, Ayyagari R, et al. Phenotypic expression of juvenile X-linked retinoschisis in Swedish families with different mutations in the XLRS1 gene. Arch Ophthalmol. 2000;118:1098–1104. doi: 10.1001/archopht.118.8.1098. [DOI] [PubMed] [Google Scholar]