Skip to main content
NCBI home page
The Journal of Physiology logoLink to The Journal of Physiology
. 2012 Oct 29;591(Pt 2):559–570. doi: 10.1113/jphysiol.2012.241679

Effects of in vivo injury on the neuromuscular junction in healthy and dystrophic muscles

Stephen JP Pratt 1, Sameer B Shah 2, Christopher W Ward 3, Mario P Inacio 4, Joseph P Stains 1, Richard M Lovering 1
PMCID: PMC3577526  PMID: 23109110

Abstract

The most common and severe form of muscular dystrophy is Duchenne muscular dystrophy (DMD), a disorder caused by the absence of dystrophin, a structural protein found on the cytoplasmic surface of the sarcolemma of striated muscle fibres. Considerable attention has been dedicated to studying myofibre damage and muscle plasticity, but there is little information to determine if damage from contraction-induced injury occurs at or near the nerve terminal axon. We used α-bungarotoxin to compare neuromuscular junction (NMJ) morphology in healthy (wild-type, WT) and dystrophic (mdx) mouse quadriceps muscles and evaluated transcript levels of the post-synaptic muscle-specific kinase signalling complex. Our focus was to study changes in NMJs after injury induced with an established in vivo animal injury model. Neuromuscular transmission, electromyography (EMG), and NMJ morphology were assessed 24 h after injury. In non-injured muscle, muscle-specific kinase expression was significantly decreased in mdx compared to WT. Injury resulted in a significant loss of maximal torque in WT (39 ± 6%) and mdx (76 ± 8%) quadriceps, but significant changes in NMJ morphology, neuromuscular transmission and EMG data were found only in mdx following injury. Compared with WT mice, motor end-plates of mdx mice demonstrated less continuous morphology, more disperse acetylcholine receptor aggregates and increased number of individual acetylcholine receptor clusters, an effect that was exacerbated following injury. Neuromuscular transmission failure increased and the EMG measures decreased after injury in mdx mice only. The data show that eccentric contraction-induced injury causes morphological and functional changes to the NMJs in mdx skeletal muscle, which may play a role in excitation–contraction coupling failure and progression of the dystrophic process.

Key points

  • Strength loss induced by lengthening contractions is typically attributed to damaged force-bearing structures within skeletal muscle. Muscle lacking the structural protein dystrophin, as in Duchenne muscular dystrophy, is particularly susceptible to contraction-induced injury.

  • We tested the hypothesis that changes in neuromuscular junctions (NMJs) contribute to strength loss following lengthening contractions in wild-type and in dystrophic skeletal muscle.

  • NMJs in dystrophic (mdx) mice, the murine model of Duchenne muscular dystrophy, show discontinuous and dispersed motor end-plate morphology. Following lengthening contractions, mdx quadriceps muscles show a greater loss in force, increased neuromuscular transmission failure and decreased electromyographic measures compared to wild-type.

  • Consistent with NMJ disruption as a mechanism contributing to this force loss, only mdx showed increased motor end-plate discontinuity and dispersion of acetylcholine receptor aggregates.

  • Our results indicate that the NMJ in mdx muscle is particularly susceptible to damage, and might play a role in the exacerbated response to injury in dystrophic muscles.

Introduction

The area of synaptic contact between a motor neuron and its target muscle fibre is the neuromuscular junction (NMJ). This synapse occurs at a specialized area of the sarcolemma called the end-plate. The ‘pretzel-shape’ of a typical end-plate results from several twisting branches of the motor neuron (Fig. 1A). The distal aspect of each branch is enlarged and these expansions form the terminal synaptic boutons, which contain synaptic vesicles filled with the neurotransmitter acetylcholine (ACh). Boutons are located over stabilizing invaginations called junctional folds (Wilson & Deschenes, 2005), where high-density clusters of ACh receptors (AChRs) reside (Fig. 1B). When released into the synaptic cleft, ACh binds to its post-synaptic receptors, causing an end-plate potential, which continues along the muscle fibre as an action potential. Several studies indicate that NMJ morphology is altered in dystrophic skeletal muscle (Lyons & Slater, 1991; Shiao et al. 2004; Banks et al. 2009); here we studied whether or not mechanical stress further alters the NMJ structure and function in dystrophic muscle.

Figure 1. Structure of the neuromuscular junction (NMJ).

Figure 1

Open in a new tab

A, flat plane projection of a Z-stacked confocal image of a non-injured wild-type (WT) NMJ in the quadriceps muscle. The terminal neuron is labelled with antibodies against neurofilament (red) and the motor end-plate is stained with α-bungarotoxin (green). Scale bar, 10 μm. B, electron microscopy image showing ultrastructure of neuromuscular synapse. Scale bar, 500 nm. C, structure of the MuSK signalling complex is shown in the schematic. Activation of this complex by neuronal Agrin drives AChR clustering. D, constituents of the MuSK complex were examined by qRT-PCR. Interestingly, MuSK was the only constituent that showed significant differences between WT and mdx. All data are presented as mean ± SD.*P < 0.05. mdx, mice lacking dystrophin; WT, wild-type.

Accumulating evidence has made it clear that the NMJ in mature skeletal muscle is not a fixed permanent structure (Fambrough, 1979; Fambrough et al. 1979), but instead is continually remodelling, thereby possessing a large degree of functional plasticity (Ferre et al. 1987). The morphology and physiology of the NMJ can display alterations in synaptic organization due to exercise (Saxton et al. 1995; Fahim, 1997; Wilson & Deschenes, 2005), inactivity (Prakash et al. 1995, 1999; Sieck et al. 2012), denervation (Labovitz et al. 1984; Xu & Salpeter, 1997), ageing (Robbins, 1992; Elkerdany & Fahim, 1993; Jang & Van Remmen, 2011), crushing of the nerve/muscle (Santo et al. 2003; Kawabuchi et al. 2011) or the absence of associated proteins (Kong & Anderson, 1999; Adams et al. 2000; Banks et al. 2009; Chipman et al. 2010; Kulakowski et al. 2011). Ultrastructural changes in the NMJ have been documented following muscle disuse and denervation. Phenotypes include reduced end-plate area, fewer and more shallow folds, and dispersed AChRs (Brown et al. 1982; Labovitz et al. 1984). In addition, the densities and distribution of boutons change, primarily due to increased axonal branching. Following nerve injury, branches of a severed axon will simply regenerate and reform their original synapses (Nguyen et al. 2002). Alternately, axons may sprout several new branches within a matter of hours through collateral pathways that result in motor end-plate reinnervation (Kawabuchi et al. 2011).

The most common and severe form of muscular dystrophy is Duchenne muscular dystrophy (DMD), a disorder caused by the absence of dystrophin, a structural protein found on the cytoplasmic surface of the sarcolemma. The mdx mouse lacks dystrophin and has been used as a model for DMD for years; it is still considered a suitable mouse model for DMD (Willmann et al. 2009). Dystrophin is not required for NMJ formation, but is required for end-plate maintenance (Kong & Anderson, 1999) and likely for end-plate remodelling in regenerating fibres. Mdx mice show NMJ fragmentation in adult muscle fibres and excessive nerve sprouting compared to wild-type (WT) mice (Marques et al. 2007). Electron microscopy studies indicate a loss in the number and depth of synaptic folds of the motor end-plate in mdx muscles (Lyons & Slater, 1991; Banks et al. 2009). Patients with DMD, as well as the mdx murine model, have increased susceptibility to injury compared to their non-dystrophic counterparts. The increased force loss after injury is hypothesized to be due to structural weakness of the cytoskeleton or changes in signalling secondary to the loss of dystrophin (Lovering et al. 2009b); however, we still do not have a thorough understanding for this increased susceptibility to injury. We seek to better elucidate the cellular mechanisms that underpin the dystrophic phenotype. Focusing on the NMJ as a contributor to functional deficits after injury represents a paradigm shift from more prevalent myocentric perspectives on injury. The purpose of this study was to compare NMJ morphology and function in healthy and dystrophic muscles after a controlled injury induced by lengthening (eccentric) contractions.

Methods

Animals

We used age-matched and gender-matched control mice (WT) and mdx mice (lacking dystrophin) from the C57BL/10ScSnJ strain. A total of 42 mice were used (approximately 2–3 months old; body weight = 29 ± 3 g for WT and 36 ± 2 g for mdx). All experimental procedures were approved by the University of Maryland Institutional Animal Care and Use Committee.

Quantitative RT-PCR

For RT-PCR detection of NMJ related transcripts, three WT and three mdx quadriceps muscles were snap frozen and then homogenized in Trizol reagent (Invitrogen, Carlsbad, CA, USA) and total RNA was extracted according to the manufacturer's instructions. Subsequently, RNA was reverse transcribed, and quantitative real-time PCR was carried out with an ABI 7300 Sequence Detection System (Applied Biosystems, Foster City, CA, USA) using SYBR green, as described previously (Niger et al. 2010). Relative expression was determined by comparison to the ‘house-keeping’ genes, GAPDH and HPRT, using the geNorm software (v3.5, Ghent University Hospital, Ghent, Belgium). Transcripts for the multi-protein signalling complex responsible for AChR clustering [neuronal Agrin; low-density lipoprotein receptor-related protein 4 (LRP4); downstream-of-tyrosine-kinase-7 (Dok7), muscle-specific kinase (MuSK); and Rapsyn were assessed (Fig. 1C)]. The primer sets used for PCR amplification, were: MuSK-F, TGAGAACTGCCCCTTGGAACT and MuSK-R GGGTCTATCAGCAGGCAGCTT; Agrin-F, CCTCAACTTGGACACGAAGCT and Agrin-R AGGCCGATGCCCACAGA; Dok7-F, TCTCCCAGACCCGAGTTCTG and Dok7-R, TCTAGCTGCAGGGCTTCCA; LRP4-F, GGACTGCACGTCAGCTATGC and LRP-R, CGCGATCACCAACAAAATCA; Rapsyn-F, ACGAGTGCGTGGAGGAGACT and Rapsyn-R, TGTTCCTCTCCCCGATGGA; HPRT-F, AGCAGTACAGCCCCAAAATGG and HPRT-R, AACAAAGTCTGGCCTGTATCCAA; GAPDH-F, CGTGTTCCTACCCCCAATGT and GAPDH-R, TGTCATCATACTTGGCAGGTTTCT.

Muscle injury

Quadriceps injury induced by maximal lengthening contractions was performed in vivo as described (Stone et al. 2007; Pratt et al. 2011). With the animal anaesthetized with isoflurane and placed in a supine position, the thigh was stabilized and the ankle was secured on to a lever arm (Fig. 2A). The axis of the knee was aligned with the axis of the stepper motor (model T8904, NMB Technologies, Chatsworth, CA, USA) and a torque sensor (QWFK-8M, Sensotec, Columbus, OH, USA) to measure torque in Newton-millimetres (Nmm). The femoral nerve was stimulated via subcutaneous needle electrodes (J05 Needle Electrode Needles, 36BTP, Jari Electrode Supply, Gilroy, CA, USA). The proper electrode position was determined by a series of isometric twitches and by observing isolated knee extension in the anaesthetized animal. A custom program based on commercial software (Labview version 8.5, National Instruments, Austin, TX, USA) was used to synchronize contractile activation and the onset of forced knee flexion. Injury resulted from 15 forced lengthenings (knee flexion) superimposed on to maximal quadriceps contractions through a 40–100 deg arc of motion (with full knee extension considered 0 deg) spaced 1 min apart. This range of motion is similar to one used in human studies (Paulsen et al. 2010). Loss in maximal isometric torque was measured 5 min after the last lengthening contraction. Sham procedures (contractions without lengthening, or passive lengthening without contractions, both with knee immobilized) have been performed (Pratt et al. 2011).

Figure 2. Apparatus used to induce injury.

Figure 2

Open in a new tab

A, to produce the injury, the femur was stabilized and the ankle attached to a motor-driven lever arm. The femoral nerve was used to stimulate the quadriceps supramaximally (causing knee extension, blue arrow) while the lever arm forced the knee joint into flexion (blue arrow). To complete one repetition, the quadriceps was stimulated for 200 ms to induce a peak isometric contraction before lengthening by the lever arm. B, representative trace recordings of torque for the first and final repetition, from wild-type (WT) mice and mice lacking dystrophin (mdx). C, lengthening contractions resulted in a significant loss of maximal isometric torque for both WT and mdx mice; however, mdx mice showed a significantly greater loss in torque (76 ± 8%) compared to WT (39 ± 6%). All data are presented as mean ± SD, P < 0.05. * indicates statistical significance from respective non-injured quadriceps; †indicates statistical significance from injured WT quadriceps.

Assessment of neuromuscular transmission failure

To assess NMJ function, we compared in situ contractile characteristics in eight WT and eight mdx injured quadriceps to the non-injured side 24 h after injury. The contractile function of isolated quadriceps muscle was measured as described (Stone et al. 2007). The patella tendon was released and secured in a custom-made metal clamp and attached to a load cell (FT03; Grass instruments, West Warwick, RI, USA) using a suture tie (4.0 coated Vicryl). The load cell was mounted to a micromanipulator (Kite Manipulator; World Precision Instruments, Sarasota, FL, USA) so that the quadriceps could be adjusted to resting length. The femur and pelvis were stabilized in a custom-made rig and the femoral nerve was used to stimulate the quadriceps, as described previously (Pratt et al. 2011). Muscle length was adjusted to obtain maximal isometric twitch force in response to 1 ms monophasic rectangular pulses (Lo). Tetanic force (achieved by a train duration of 300 ms with 1 ms square pulses at 75 Hz) was recorded, and the signal from the load cell was fed via a DC amplifier (model P122; Grass Instruments) to an analog-to-digital board using acquisition software (PolyVIEW version 2.1; Grass Instruments). The extent of neuromuscular transmission failure was assessed as previously described (Aldrich et al. 1986; Prakash et al. 1999; Ollivier-Lanvin et al. 2009; Sieck et al. 2012). The femoral nerve was stimulated (0.2 ms pulses in 40 Hz in 330 ms duration trains every 1 s for 2 min) and every 15 s, a single 40 Hz, 330 ms duration train was applied to the muscle using plate electrodes. The relative contribution of neuromuscular transmission failure to muscle fatigue was estimated as: (NF − MF)/(1 − MF), where NF is a percentage decrement in force during repetitive nerve stimulation and MF is the percentage force decrement during direct muscle stimulation.

Electromyography

Data from six WT and six mdx anaesthetized mice, 24 h after injury, were collected using a Telemyo DTS electromyography (EMG) system (Noraxon, Scottsdale, AZ, USA). EMG recordings were obtained using 27-gauge, Teflon-coated, monopolar needle electrodes (J05 Needle Electrode Needles, 36BTP, Jari Electrode Supply) and a reference electrode. These electrodes were applied to the mid-point between the hip joint and the patella, and to the erector spinae muscles respectively. Repeated femoral nerve stimulation was used to assess neuromuscular transmission. Each mouse received three twitch (1 ms) and three tetanic (300 ms train) bilateral stimulations (injured and non-injured quadriceps). Data were processed using a series of filtering procedures consisting of a band-pass filter (10–500 Hz), a full-wave rectification and a low-pass Butterworth (fourth order) 6 Hz filter to eliminate possible movement artefacts.

Assessment of neuromuscular junction morphology

We used four WT and four mdx mice to assess NMJ morphology 24 h after injury. Animals were perfusion-fixed through the left ventricle with 4% paraformaldehyde and knees were immobilized with a custom-designed splint to minimize any differences in muscle length that could occur with knee movement during perfusion. Quadriceps muscles were dissected and stored in fixative until stained with α-bungarotoxin conjugated to Alexa-594 (Molecular Probes B13423, Eugene, OR, USA). Digital images of NMJs from whole-mount tissue preparations were obtained with a Zeiss 510 confocal laser-scanning microscope with pinhole set at 1.0 Airy unit. A total of 140 NMJs were collected (39 WT non-injured; 41 WT injured; 28 mdx non-injured; 32 mdx injured). A maximum intensity flat plane projection was made from Z-stacked images in Image J software (NIH) to account for the depth of the NMJ. Only NMJs in a complete en face view were selected for analysis. After background was subtracted and noise despeckled, a Gaussian Blur filter with σ = 2.00 was applied. Binary images (Fig. 3, processed) were then generated from which total stained area and total stained perimeter was quantified. Total area and total perimeter were quantified using tracing tools for the total NMJ end-plate. The dispersion index was calculated as ((total stained area/total area) × 100), describing NMJ density. Images were then skeletonized (Fig. 3) and a histogram describing the connectivity for each pixel were generated using the BinaryConnectivity.class Image J plugin (http://www.dentistry.bham.ac.uk/landinig/software/soft-ware.html). Histogram bins correspond to the number of neighbouring pixels for each pixel. One neighbour implies a terminal pixel, two neighbours imply a pixel along a single branch, and three or more neighbours indicate that a pixel exists at a branch node. Thus, discontinuities (terminal pixel) or branching (3+ neighbours) may be quantified within the motor end-plate. The number of clusters within individual NMJs were counted using unprocessed images (Kong & Anderson, 1999).

Figure 3. Representative images of injured and non-injured neuromuscular junctions (NMJs).

Figure 3

Open in a new tab

A total of 140 NMJs from quadriceps whole-mount preparations were stained with α-bungarotoxin, Z-stacked and analysed. Shown are representative confocal images of NMJs in normal (WT) and dystrophic (mdx) quadriceps before and after lengthening contractions: A, WT; B, WT-injured; C, mdx; D, mdx-injured. Similar to the force data, WT mice showed little to no change in NMJ morphology after injury. Non-injured mdx muscle showed a non-continuous, punctate pattern in NMJ morphology compared to non-injured and injured WT muscles; however, mdx motor end-plates showed significantly exacerbated morphological changes after injury, in particular, less dense aggregates, increased discontinuity and greater number of separate ACh clusters within total end-plate area (see Results). Scale bar, 10 μm. All data were measured from processed binary images generated in Image J (NIH) software. Pixel positions of skeletonized images were used in quantifying discontinuity and branching patterns using a binary connectivity plugin.

Statistical analysis

Independent variables collected for muscle injury, neuromuscular transmission failure, and NMJ morphology measurements were analysed by single factor analysis of variance (ANOVA, SigmaStat, San Rafael, CA, USA). A Holm–Sidak post hoc analysis was performed to determine where significant differences had occurred. Significance was set at P < 0.05.

Results

NMJ morphology differs between WT and mdx muscles, even without injury, in a variety of hindlimb and forelimb muscles (Lyons & Slater, 1991; Kong & Anderson, 1999; Santo et al. 2003; Banks et al. 2009). Here we confirm such differences in WT and mdx NMJ morphology in the quadriceps (Fig. 3). In addition, we interrogated the gene expression levels of N-Agrin, MuSK, LRP4, Dok7 and Rapsyn, all within the signalling complex responsible for AChR clustering (Fig. 1C). The only significant difference between non-injured WT and mdx muscles was a decrease in MuSK mRNA (P= 0.01) in mdx mice (Fig. 1D).

Functional analysis of the uninjured quadriceps in the WT and mdx mice revealed a similar mean peak torque of 58.9 ± 14 Nmm and 49.2 ± 14 Nmm, respectively (Fig. 2C). Mdx ankle (tibialis anterior) and respiratory (diaphragm) muscles have previously been shown to be more susceptible to injury than WT muscles (Brussee et al. 1997; Petrof, 1998; DelloRusso et al. 2001). Here we used eccentric injury of the quadriceps muscles and show a significant loss of pre-injury, maximal torque in both WT and mdx mice following an equal number of lengthening contractions. However, the mdx quadriceps were significantly more susceptible to 15 lengthening contractions, resulting in a 76 ± 8% loss of torque compared to a 39 ± 6% loss of torque in WT muscles (Fig. 2C). To the best of our knowledge, this is the first report confirming increased susceptibility to injury after lengthening contractions in the mdx quadriceps.

Figure 3 provides representative images of NMJs (motor end-plates) from WT and mdx quadriceps muscles before and after injury. WT NMJs show a typical continuous aggregate of AChRs and after injury, no significant change in morphology. Based on a discontinuity index and number of clusters per NMJ, AChRs in mdx mice are more discontinuous and punctate than in WT mice, consistent with findings of Marques et al. (2007) (Fig. 3C and Table 1). However, after lengthening contractions, AChRs in mdx mice show a significantly altered morphology (Fig. 3D), indicated by less dense aggregates (Table 1, dispersion index), increased discontinuity and greater number of separate AChR clusters within total end-plate area (Table 1).

Table 1.

Morphological characteristics of the neuromuscular junction

WT WT injured mdx mdx injured
TSA 314.5 ± 17.2 300.7 ± 21.9 455.2 ± 20.9*† 398.4 ± 16.9*†
TSP 252.8 ± 11.6 235.9 ± 16.4 368.0 ± 18.2*† 388.2 ± 16.5*†
TA 639.9 ± 36.6 587.9 ± 49.5 930.8 ± 50.7*† 1254.4 ± 55.0*†‡
TP 108.3 ± 3.2 103.3 ± 5.5 137.4 ± 4.4*† 153.5 ± 5.0*†‡
Dl 49.9 ± 0.8 52.4 ± 1.1 49.8 ± 1.1 32.2 ± 0.9*†‡
Discontinuity 19.1 ± 1.4 20.5 ± 2.0 39.0 ± 3.0*† 54.8 ± 3.9*†‡
No. of branching 51.3 ± 4.6 53.6 ± 5.1 96.8 ± 6.9*† 70.2 ± 6.5†
No. of clusters 2.3 ± 0.3 2.1 ± 0.2 7.5 ± 0.6*† 16.7 ± 1.0*†‡
Open in a new tab

Data are derived from mouse quadriceps muscles. DI, dispersion index; mdx, mice lacking dystrophin; TA, total area; TP, total perimeter; TSA, total stained area; TSP, total stained perimeter; WT, wild-type. DI was calculated as (TSA/TA) × 100 and describes density of acetylcholine receptors. Discontinuity expresses the lack of continuous acetylcholine receptors and was determined by calculating the abundance of terminal pixels in skeletonized images. Number of branching shows the frequency of motor end-plate branching and was determined by calculating the abundance of pixels at a branch node in skeletonized images. Number of clusters was calculated by counting the number of separate acetylcholine receptor aggregates within an individual motor end-plate. See methods for details.

*

Significantly different to WT.

†

Significantly different to WT-injured.

‡

Significantly different to mdx. All data are presented as mean ± SD, P < 0.05.

Effective neurotransmission should depend on tight packing of postsynaptic AChRs into AChR clusters (Ghazanfari et al. 2011). To determine if there were functional changes in muscle performance that paralleled the morphological changes at the NMJ, we employed techniques for estimating the extent of neuromuscular transmission failure during repetitive nerve stimulation (Fig. 4), which have been described previously (Prakash et al. 1999; Ollivier-Lanvin et al. 2009; Sieck et al. 2012). NMJs in injured WT quadriceps showed no difference in transmission failure (8 ± 4%) compared to uninjured (8 ± 2%). NMJs in mdx mice trended toward greater transmission failure (11 ± 0.2%) than NMJs in WT mice, but only significant changes were seen after injury, when the NMJs in injured mdx quadriceps showed a marked increase in neuromuscular transmission failure (26 ± 6%).

Figure 4. Neuromuscular transmission failure.

Figure 4

Open in a new tab

A, representative data from contractile assay to assess NMJ transmission failure. Nerve stimulation: the femoral nerve was stimulated every second for 2 min with a 330 ms duration maximum tetanic contraction. Muscle stimulation: with electrodes placed directly over the muscle, a maximum tetanic contraction was superimposed on to the protocol every 15 s. B, the relative contribution of neuromuscular transmission failure (NTF) to muscle fatigue was estimated as: (NF − MF)/(1 − MF), where NF is a percentage decrement in force during repetitive nerve stimulation and MF is the percentage force decrement during direct muscle stimulation. WT-injured quadriceps (8 ± 4) showed no difference in NTF compared to controls (WT non-injured, 8 ± 2). Mdx non-injured quadriceps tended toward a slightly higher NTF (11 ± 0.2) from that of WT; however, after injury, mdx quadriceps showed a significant increase in NTF (26 ± 6). All data are presented as mean ± SD, P < 0.05.

We also assessed functional changes using EMG. Although the histological, biochemical and contractile properties are well documented, less is known about EMG properties of muscle from mdx mice. Because the muscles were maximally recruited via electrical stimulation of the motor nerve, any observed decrement in the EMG root mean square (RMS) could be interpreted as failure of the NMJ (Warren et al. 1999). There were several differences between WT and mdx even before injury; the RMS and peak amplitude were reduced in mdx compared to WT (Fig. 5A and Table 2). As predicted from the morphological and transmission failure data, only the mdx showed significant changes in EMG parameters after injury, with further reduction in RMS and peak amplitude for tetanic contractions (Fig. 5B).

Figure 5. Effects of injury on electromyography (EMG).

Figure 5

Open in a new tab

A, representative EMG curves for tetanic contraction in wild-type (WT) and dystrophic (mdx) mice, before and after injury. B, percentage change in EMG characteristics after injury. Data are derived from mouse quadriceps muscles. PA, peak amplitude; RMS, root mean square. *Indicates significance compared to WT. All data are presented as mean ± SEM, P < 0.05.

Table 2.

Electromyographic characteristics of healthy and dystrophic quadriceps

WT mdx
Twitch contraction RMS 71.81 ± 8.52 25.61 ± 1.49*
PA (μV) 316.32 ± 33.47 114.43 ± 5.40*
TTP (s) 0.64 ± 0.21 0.39 ± 0.08
Tetanic contraction RMS 482.46 ± 42.79 197.40 ± 9.96*
PA (μV) 1251.87 ± 109.17 532.31 ± 22.96*
TTP (s) 0.36 ± 0.03 0.33 ± 0.03
Open in a new tab

Data are derived from non-injured mouse quadriceps muscles during twitch (1 ms) and maximum tetanic (300 ms) contractions. mdx, mice lacking dystrophin; PA, peak amplitude; RMS, root mean square; TTP, time (from activation onset) to peak; WT, wild-type.

*

Significantly different to WT. All data are presented as mean ± SEM, P < 0.05.

Discussion

Most of the strength loss induced by eccentric contractions is typically attributed to damage to, or loss of, force-bearing structures within the muscle. High force lengthening contractions are associated with muscle damage, especially in dystrophic muscles. The genetic basis for DMD has been determined (Hoffman et al. 1987; Wagner, 2002; Lovering et al. 2005; McNally & Pytel, 2007), but the mechanisms responsible for the decrease in muscle-specific force and increased susceptibility to injury are still being clarified. A mechanical model (Bloch & Gonzalez-Serratos, 2003; Batchelor & Winder, 2006) suggests that the absence of dystrophin results in a mechanical weakness of either the sarcolemma or the cytoskeletal–sarcolemmal interface (Judge et al. 2006). The increase in myofibre damage observed secondary to stress, such as after lengthening (‘eccentric’) contractions, supports the concept of mechanical instability as the initial cause of symptoms associated with dystrophic skeletal muscle (Petrof et al. 1993). No one finding can account for changes in contractility after injury, but in an attempt to understand mechanisms underlying force loss, considerable attention has been dedicated to myofibre damage.

In this work, we examined another potential contributor to the altered function in dystrophic muscle. Excitation–contraction coupling (EC coupling) is a process by which neural activation results in a muscle contraction. Ingalls et al. (1998) argue that EC coupling failure is a major contributor toward force loss after eccentric contractions (Warren et al. 2001) and confirm this hypothesis in experiments where they ‘bypassed’ EC coupling pharmacologically, showing that much of the force loss after eccentric injury is due to a disruption in EC coupling. Although many studies have identified mechanisms contributing to abnormalities in EC coupling after lengthening contractions (Hollingworth et al. 1990; Ingalls et al. 1998; Takekura et al. 2001; Warren et al. 2001), the NMJ has received less focus than the structures associated with the Ca2+ release channels. The notion of disrupted EC coupling led us to consider another potential cause that contributes to loss of force after injury or in dystrophic muscle, i.e. altered NMJ morphology.

MuSK is a transmembrane tyrosine kinase crucial for forming and maintaining the NMJ and activation of the MuSK complex that drives AChR clustering (Burden, 2011; Ghazanfari et al. 2011). MuSK plays a central co-ordinating role in the formation of the NMJ during embryonic development and development of new AChRs (Kummer et al. 2006; Ghazanfari et al. 2011). MuSK inactivation at the NMJ of adult muscle is known to cause a reduction in AChR density and change in the gross synaptic arborization of the end-plate, which can lead to the complete loss of AChRs and disappearance of the synaptic structure (Hesser et al. 2006). MuSK levels differ between various adult skeletal muscles, which may correlate with muscle-specific differences in response to Agrin (Punga et al. 2011). We assessed transcripts for the multi-protein MuSK signalling complex responsible for AChR clustering (Agrin, LRP4, Dok7, MuSK and Rapsyn) in WT and mdx mice. Interestingly, the only significant difference between WT and mdx was a decrease in MuSK. This is, to the best of our knowledge, the first report of decreased MuSK transcription in mdx muscle. As MuSK plays a critical role in the aggregation, or clustering, of NMJs, it is conceivable that this reduction directly contributes to the altered morphology of mdx NMJs and is therefore a potential therapeutic target.

Our in vivo injury model has been described in detail to examine leg muscle (Lovering et al. 2007, 2009a, 2011a, b). We recently modified the model to examine thigh muscles (Pratt et al. 2011) and report here comparisons between WT and mdx quadriceps muscles. Mdx mice show a significantly greater loss in force compared to WT, despite an identical injury protocol to the quadriceps using a minimal number of lengthening contractions (Fig. 2). This is consistent with earlier studies on mdx tibialis anterior muscles (DelloRusso et al. 2001). The moderate loss of maximal tetanic force after injury in WT quadriceps reflects the mild change in WT NMJ morphology (Fig. 3). We confirm earlier findings of abnormal NMJ morphology in mdx mice and for the first time report here that the NMJ in mdx mice is more susceptible to disruption with contraction-induced muscle injury.

Bidirectional communication between muscle fibres and motor neurons is extremely important for maintenance of the neuromuscular apparatus (Grinnell, 1995). Effective neurotransmission depends upon the tight packing of post-synaptic AChRs. The absence of dystrophin causes NMJ fragmentation, but dystrophin (Kong & Anderson, 1999) is not required for the formation and clustering of AChRs. Synaptic transmission becomes more variable with age in the mdx mouse model of DMD (Carlson & Roshek, 2001; Kawabuchi et al. 2011), which could provide one explanation why, despite the consistent lack of dystrophin, mdx skeletal muscle generates less specific force and becomes more susceptible to damage with age (Chan et al. 2007). Motor end-plate fragmentation is typical in adult dystrophic mice and, although some have suggested that the altered morphology is secondary to destabilization of the sarcolemma and cytoskeleton in mdx muscle (Banks et al. 2009), others suggest that the disrupted morphology is the consequence of myofibre degeneration and regeneration (Minatel et al. 2001; Li et al. 2011). Our results suggest that low levels of MuSK contribute to the initial altered morphology, but further disruption shortly after injury suggests a mechanical susceptibility of the NMJ.

Our injury protocol resulted in loss of force in both WT and mdx quadriceps, but only mdx mice showed significant changes after injury in NMJ morphology, neuromuscular transmission and EMG. The EMG data showed changes between WT and mdx even before injury. This was not surprising, as changes in EMG are measurable in patients with various muscular dystrophies, including DMD (Frascarelli et al. 1988; Priez et al. 1992; Derry et al. 2012). Carter et al. (1992) have reported no impaired EMG characteristics in mdx mice, but a later study found significant EMG abnormalities in all age groups of mdx compared to WT mice (Han et al. 2006). Both of these murine studies used leg muscles (gastrocnemius, soleus and tibialis anterior). Here, similar to the findings with morphology and neuromuscular transmission, only the mdx showed a significant change in EMG after injury. Although other factors, such as sarcolemmal damage, could contribute to this result, together with our other findings, it supports our hypothesis of altered NMJ function after injury. Proximal muscles are affected earlier and to a greater extent in DMD (Cros et al. 1989; Mathur et al. 2010) and a similar pattern of increased damage in more proximal muscles has been documented in young mdx mice (Muntoni et al. 1993). This might be one reason why we find changes in EMG in muscles of the mdx mouse when others did not (Carter et al. 1992).

In summary, our findings suggest a role for the NMJ in the loss of functional performance after skeletal muscle injury in mdx mice. The data show that changes in force, NMJ morphology, neuromuscular fatigue, and EMG are all altered after injury in the mdx quadriceps when compared to WT. This current work is only a snapshot in time. To date, studies that have examined synaptic changes (after denervation, for example) have used 24 h as the earliest time point (Bowen et al. 1998; Magnusson et al. 2001; Guerra et al. 2005). We do not know if the altered NMJ morphology after injury is due to mechanical disruption, degradation or represents remodelling of AChRs before the measured time point of 24 h, or if changes are even greater after this time point. Future work is needed to systematically study constituents of the MuSK signalling complex in the quadriceps and additional mdx muscles, and to follow the morphology and function of the NMJ immediately after injury and throughout recovery.

Acknowledgments

This work was supported by grants to R.M.L. from the National Institutes of Health (K01AR053235 and 1R01AR059179).

Glossary

DMD

Duchenne muscular dystrophy

NMJ

neuromuscular junction

WT

wild-type

Author contributions

The studies were performed in the Department of Orthopaedics at the University of Maryland School of Medicine. Concept & design by R.M.L., S.B.S. and S.J.P; collection, analysis & interpretation of data by all authors; drafting and revising the manuscript by S.J.P, S.B.S., C.W.W. and R.M.L. All authors approved the final manuscript.

References

  1. Adams ME, Kramarcy N, Krall SP, Rossi SG, Rotundo RL, Sealock R, Froehner SC. Absence of alpha-syntrophin leads to structurally aberrant neuromuscular synapses deficient in utrophin. J Cell Biol. 2000;150:1385–1398. doi: 10.1083/jcb.150.6.1385. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Aldrich TK, Shander A, Chaudhry I, Nagashima H. Fatigue of isolated rat diaphragm: role of impaired neuromuscular transmission. J Appl Physiol. 1986;61:1077–1083. doi: 10.1152/jappl.1986.61.3.1077. [DOI] [PubMed] [Google Scholar]
  3. Banks GB, Chamberlain JS, Froehner SC. Truncated dystrophins can influence neuromuscular synapse structure. Mol Cell Neurosci. 2009;40:433–441. doi: 10.1016/j.mcn.2008.12.011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Batchelor CL, Winder SJ. Sparks, signals and shock absorbers: how dystrophin loss causes muscular dystrophy. Trends Cell Biol. 2006;16:198–205. doi: 10.1016/j.tcb.2006.02.001. [DOI] [PubMed] [Google Scholar]
  5. Bloch RJ, Gonzalez-Serratos H. Lateral force transmission across costameres in skeletal muscle. Exerc Sport Sci Rev. 2003;31:73–78. doi: 10.1097/00003677-200304000-00004. [DOI] [PubMed] [Google Scholar]
  6. Bowen DC, Park JS, Bodine S, Stark JL, Valenzuela DM, Stitt TN, Yancopoulos GD, Lindsay RM, Glass DJ, DiStefano PS. Localization and regulation of MuSK at the neuromuscular junction. Dev Biol. 1998;199:309–319. doi: 10.1006/dbio.1998.8936. [DOI] [PubMed] [Google Scholar]
  7. Brown MC, Hopkins WG, Keynes RJ. Importance of pathway formation for nodal sprout production in partly denervated muscles. Brain Res. 1982;243:345–349. doi: 10.1016/0006-8993(82)90258-x. [DOI] [PubMed] [Google Scholar]
  8. Brussee V, Tardif F, Tremblay JP. Muscle fibers of mdx mice are more vulnerable to exercise than those of normal mice. Neuromuscul Disord. 1997;7:487–492. doi: 10.1016/s0960-8966(97)00115-6. [DOI] [PubMed] [Google Scholar]
  9. Burden SJ. SnapShot: neuromuscular junction. Cell. 2011;144:826. doi: 10.1016/j.cell.2011.02.037. [DOI] [PubMed] [Google Scholar]
  10. Carlson CG, Roshek DM. Adult dystrophic (mdx) endplates exhibit reduced quantal size and enhanced quantal variation. Pflugers Arch. 2001;442:369–375. doi: 10.1007/s004240100561. [DOI] [PubMed] [Google Scholar]
  11. Carter GT, Longley KJ, Entrikin RK. Electromyographic and nerve conduction studies in the mdx mouse. Am J Phys Med Rehabil. 1992;71:2–5. doi: 10.1097/00002060-199202000-00002. [DOI] [PubMed] [Google Scholar]
  12. Chan S, Head SI, Morley JW. Branched fibers in dystrophic mdx muscle are associated with a loss of force following lengthening contractions. Am J Physiol Cell Physiol. 2007;293:C985–C992. doi: 10.1152/ajpcell.00128.2007. [DOI] [PubMed] [Google Scholar]
  13. Chipman PH, Franz CK, Nelson A, Schachner M, Rafuse VF. Neural cell adhesion molecule is required for stability of reinnervated neuromuscular junctions. Eur J Neurosci. 2010;31:238–249. doi: 10.1111/j.1460-9568.2009.07049.x. [DOI] [PubMed] [Google Scholar]
  14. Cros D, Harnden P, Pellissier JF, Serratrice G. Muscle hypertrophy in Duchenne muscular dystrophy. A pathological and morphometric study. J Neurol. 1989;236:43–47. doi: 10.1007/BF00314217. [DOI] [PubMed] [Google Scholar]
  15. DelloRusso C, Crawford RW, Chamberlain JS, Brooks SV. Tibialis anterior muscles in mdx mice are highly susceptible to contraction-induced injury. J Muscle Res Cell Motil. 2001;22:467–475. doi: 10.1023/a:1014587918367. [DOI] [PubMed] [Google Scholar]
  16. Derry KL, Venance SL, Doherty TJ. Decomposition-based quantitative electromyography in the evaluation of muscular dystrophy severity. Muscle Nerve. 2012;45:507–513. doi: 10.1002/mus.22341. [DOI] [PubMed] [Google Scholar]
  17. Elkerdany MK, Fahim MA. Age changes in neuromuscular junctions of masseter muscle. Anat Rec. 1993;237:291–295. doi: 10.1002/ar.1092370215. [DOI] [PubMed] [Google Scholar]
  18. Fahim MA. Endurance exercise modulates neuromuscular junction of C57BL/6NNia aging mice. J Appl Physiol. 1997;83:59–66. doi: 10.1152/jappl.1997.83.1.59. [DOI] [PubMed] [Google Scholar]
  19. Fambrough DM. Control of acetylcholine receptors in skeletal muscle. Physiol Rev. 1979;59:165–227. doi: 10.1152/physrev.1979.59.1.165. [DOI] [PubMed] [Google Scholar]
  20. Fambrough DM, Devreotes PN, Gardner JM, Card DJ. The life history of acetylcholine receptors. Prog Brain Res. 1979;49:325–334. doi: 10.1016/S0079-6123(08)64644-0. [DOI] [PubMed] [Google Scholar]
  21. Ferre J, Mayayo E, Brunet R. Morphometric study of the neuromuscular synapses in the adult rat with special reference to the remodelling concept. Biol Cell. 1987;60:133–144. doi: 10.1111/j.1768-322x.1987.tb00553.x. [DOI] [PubMed] [Google Scholar]
  22. Frascarelli M, Rocchi L, Feola I. EMG computerized analysis of localized fatigue in Duchenne muscular dystrophy. Muscle Nerve. 1988;11:757–761. doi: 10.1002/mus.880110712. [DOI] [PubMed] [Google Scholar]
  23. Ghazanfari N, Fernandez KJ, Murata Y, Morsch M, Ngo ST, Reddel SW, Noakes PG, Phillips WD. Muscle specific kinase: organiser of synaptic membrane domains. Int J Biochem Cell Biol. 2011;43:295–298. doi: 10.1016/j.biocel.2010.10.008. [DOI] [PubMed] [Google Scholar]
  24. Grinnell AD. Dynamics of nerve-muscle interaction in developing and mature neuromuscular junctions. Physiol Rev. 1995;75:789–834. doi: 10.1152/physrev.1995.75.4.789. [DOI] [PubMed] [Google Scholar]
  25. Guerra M, Cartaud A, Cartaud J, Legay C. Acetylcholinesterase and molecular interactions at the neuromuscular junction. Chem Biol Interact. 2005;157–158:57–61. doi: 10.1016/j.cbi.2005.10.110. [DOI] [PubMed] [Google Scholar]
  26. Han JJ, Carter GT, Ra JJ, Abresch RT, Chamberlain JS, Robinson LR. Electromyographic studies in mdx and wild-type C57 mice. Muscle Nerve. 2006;33:208–214. doi: 10.1002/mus.20455. [DOI] [PubMed] [Google Scholar]
  27. Hesser BA, Henschel O, Witzemann V. Synapse disassembly and formation of new synapses in postnatal muscle upon conditional inactivation of MuSK. Mol Cell Neurosci. 2006;31:470–480. doi: 10.1016/j.mcn.2005.10.020. [DOI] [PubMed] [Google Scholar]
  28. Hoffman EP, Brown RH, Jr, Kunkel LM. Dystrophin: the protein product of the Duchenne muscular dystrophy locus. Cell. 1987;51:919–928. doi: 10.1016/0092-8674(87)90579-4. [DOI] [PubMed] [Google Scholar]
  29. Hollingworth S, Marshall MW, Robson E. Excitation contraction coupling in normal and mdx mice. Muscle Nerve. 1990;13:16–20. doi: 10.1002/mus.880130105. [DOI] [PubMed] [Google Scholar]
  30. Ingalls CP, Warren GL, Williams JH, Ward CW, Armstrong RB. E-C coupling failure in mouse EDL muscle after in vivo eccentric contractions. J Appl Physiol. 1998;85:58–67. doi: 10.1152/jappl.1998.85.1.58. [DOI] [PubMed] [Google Scholar]
  31. Jang YC, Van Remmen H. Age-associated alterations of the neuromuscular junction. Exp Gerontol. 2011;46:193–198. doi: 10.1016/j.exger.2010.08.029. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Judge LM, Haraguchiln M, Chamberlain JS. Dissecting the signalling and mechanical functions of the dystrophin-glycoprotein complex. J Cell Sci. 2006;119:1537–1546. doi: 10.1242/jcs.02857. [DOI] [PubMed] [Google Scholar]
  33. Kawabuchi M, Tan H, Wang S. Age affects reciprocal cellular interactions in neuromuscular synapses following peripheral nerve injury. Ageing Res Rev. 2011;10:43–53. doi: 10.1016/j.arr.2010.10.003. [DOI] [PubMed] [Google Scholar]
  34. Kong J, Anderson JE. Dystrophin is required for organizing large acetylcholine receptor aggregates. Brain Res. 1999;839:298–304. doi: 10.1016/s0006-8993(99)01737-0. [DOI] [PubMed] [Google Scholar]
  35. Kulakowski SA, Parker SD, Personius KE. Reduced TrkB expression results in precocious age-like changes in neuromuscular structure, neurotransmission, and muscle function. J Appl Physiol. 2011;111:844–852. doi: 10.1152/japplphysiol.00070.2011. [DOI] [PubMed] [Google Scholar]
  36. Kummer TT, Misgeld T, Sanes JR. Assembly of the postsynaptic membrane at the neuromuscular junction: paradigm lost. Curr Opin Neurobiol. 2006;16:74–82. doi: 10.1016/j.conb.2005.12.003. [DOI] [PubMed] [Google Scholar]
  37. Labovitz SS, Robbins N, Fahim MA. Endplate topography of denervated and disused rat neuromuscular junctions: comparison by scanning and light microscopy. Neuroscience. 1984;11:963–971. doi: 10.1016/0306-4522(84)90207-0. [DOI] [PubMed] [Google Scholar]
  38. Li Y, Lee Y, Thompson WJ. Changes in aging mouse neuromuscular junctions are explained by degeneration and regeneration of muscle fibre segments at the synapse. J Neurosci. 2011;31:14 910–14 919. doi: 10.1523/JNEUROSCI.3590-11.2011. [DOI] [PMC free article] [PubMed] [Google Scholar]
  39. Lovering RM, Porter NC, Bloch RJ. The muscular dystrophies: from genes to therapies. Phys Ther. 2005;85:1372–1388. [PMC free article] [PubMed] [Google Scholar]
  40. Lovering RM, Roche JA, Bloch RJ, De Deyne PG. Recovery of function in skeletal muscle following 2 different contraction-induced injuries. Arch Phys Med Rehabil. 2007;88:617–625. doi: 10.1016/j.apmr.2007.02.010. [DOI] [PubMed] [Google Scholar]
  41. Lovering RM, McMillan AB, Gullapalli RP. Location of myofiber damage in skeletal muscle after lengthening contractions. Muscle Nerve. 2009a;40:589–594. doi: 10.1002/mus.21389. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Lovering RM, Michaelson L, Ward CW. Malformed mdx myofibers have normal cytoskeletal architecture yet altered EC coupling and stress-induced Ca2+ signalling. Am J Physiol Cell Physiol. 2009b;297:C571–C580. doi: 10.1152/ajpcell.00087.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  43. Lovering RM, O’Neill A, Muriel JM, Prosser BL, Strong J, Bloch RJ. Physiology, structure, and susceptibility to injury of skeletal muscle in mice lacking keratin 19-based and desmin-based intermediate filaments. Am J Physiol Cell Physiol. 2011a;300:C803–C813. doi: 10.1152/ajpcell.00394.2010. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Lovering RM, Roche JA, Goodall MH, Clark BB, McMillan A. An in vivo rodent model of contraction-induced injury and non-invasive monitoring of recovery. J Vis Exp. 2011b;11(51) doi: 10.3791/2782. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Lyons PR, Slater CR. Structure and function of the neuromuscular junction in young adult mdx mice. J Neurocytol. 1991;20:969–981. doi: 10.1007/BF01187915. [DOI] [PubMed] [Google Scholar]
  46. Magnusson C, Hogklint L, Libelius R, Tagerud S. Expression of mRNA for plasminogen activators and protease nexin-1 in innervated and denervated mouse skeletal muscle. J Neurosci Res. 2001;66:457–463. doi: 10.1002/jnr.10000. [DOI] [PubMed] [Google Scholar]
  47. Marques MJ, Taniguti AP, Minatel E, Neto HS. Nerve terminal contributes to acetylcholine receptor organization at the dystrophic neuromuscular junction of mdx mice. Anat Rec (Hoboken) 2007;290:181–187. doi: 10.1002/ar.20421. [DOI] [PubMed] [Google Scholar]
  48. Mathur S, Lott DJ, Senesac C, Germain SA, Vohra RS, Sweeney HL, Walter GA, Vandenborne K. Age-related differences in lower-limb muscle cross-sectional area and torque production in boys with Duchenne muscular dystrophy. Arch Phys Med Rehabil. 2010;91:1051–1058. doi: 10.1016/j.apmr.2010.03.024. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. McNally EM, Pytel P. Muscle diseases: the muscular dystrophies. Annu Rev Pathol. 2007;2:87–109. doi: 10.1146/annurev.pathol.2.010506.091936. [DOI] [PubMed] [Google Scholar]
  50. Minatel E, Santo NH, Marques MJ. Acetylcholine receptors and neuronal nitric oxide synthase distribution at the neuromuscular junction of regenerated muscle fibers. Muscle Nerve. 2001;24:410–416. doi: 10.1002/1097-4598(200103)24:3<410::aid-mus1014>3.0.co;2-0. [DOI] [PubMed] [Google Scholar]
  51. Muntoni F, Mateddu A, Marchei F, Clerk A, Serra G. Muscular weakness in the mdx mouse. J Neurol Sci. 1993;120:71–77. doi: 10.1016/0022-510x(93)90027-v. [DOI] [PubMed] [Google Scholar]
  52. Nguyen QT, Sanes JR, Lichtman JW. Pre-existing pathways promote precise projection patterns. Nat Neurosci. 2002;5:861–867. doi: 10.1038/nn905. [DOI] [PubMed] [Google Scholar]
  53. Niger C, Howell FD, Stains JP. Interleukin-1beta increases gap junctional communication among synovial fibroblasts via the extracellular-signal-regulated kinase pathway. Biol Cell. 2010;102:37–49. doi: 10.1042/BC20090056. [DOI] [PMC free article] [PubMed] [Google Scholar]
  54. Ollivier-Lanvin K, Lemay MA, Tessler A, Burns AS. Neuromuscular transmission failure and muscle fatigue in ankle muscles of the adult rat after spinal cord injury. J Appl Physiol. 2009;107:1190–1194. doi: 10.1152/japplphysiol.00282.2009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  55. Paulsen G, Crameri R, Benestad HB, Fjeld JG, Morkrid L, Hallen J, Raastad T. Time course of leukocyte accumulation in human muscle after eccentric exercise. Med Sci Sports Exerc. 2010;42:75–85. doi: 10.1249/MSS.0b013e3181ac7adb. [DOI] [PubMed] [Google Scholar]
  56. Petrof BJ. The molecular basis of activity-induced muscle injury in Duchenne muscular dystrophy. Mol Cell Biochem. 1998;179:111–123. doi: 10.1023/a:1006812004945. [DOI] [PubMed] [Google Scholar]
  57. Petrof BJ, Shrager JB, Stedman HH, Kelly AM, Sweeney HL. Dystrophin protects the sarcolemma from stresses developed during muscle contraction. Proc Natl Acad Sci U S A. 1993;90:3710–3714. doi: 10.1073/pnas.90.8.3710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Prakash YS, Zhan WZ, Miyata H, Sieck GC. Adaptations of diaphragm neuromuscular junction following inactivity. Acta Anat (Basel) 1995;154:147–161. doi: 10.1159/000147762. [DOI] [PubMed] [Google Scholar]
  59. Prakash YS, Miyata H, Zhan WZ, Sieck GC. Inactivity-induced remodeling of neuromuscular junctions in rat diaphragmatic muscle. Muscle Nerve. 1999;22:307–319. doi: 10.1002/(sici)1097-4598(199903)22:3<307::aid-mus3>3.0.co;2-m. [DOI] [PubMed] [Google Scholar]
  60. Pratt SJ, Lawlor MW, Shah SB, Lovering RM. An in vivo rodent model of contraction-induced injury in the quadriceps muscle. Injury. 2011 doi: 10.1016/j.injury.2011.09.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Priez A, Duchene J, Goubel F. Duchenne muscular dystrophy quantification: a multivariate analysis of surface EMG. Med Biol Eng Comput. 1992;30:283–291. doi: 10.1007/BF02446966. [DOI] [PubMed] [Google Scholar]
  62. Punga AR, Maj M, Lin S, Meinen S, Ruegg MA. MuSK levels differ between adult skeletal muscles and influence postsynaptic plasticity. Eur J Neurosci. 2011;33:890–898. doi: 10.1111/j.1460-9568.2010.07569.x. [DOI] [PubMed] [Google Scholar]
  63. Robbins N. Compensatory plasticity of aging at the neuromuscular junction 10. Exp Gerontol. 1992;27:75–81. doi: 10.1016/0531-5565(92)90030-4. [DOI] [PubMed] [Google Scholar]
  64. Santo NH, Martins AJ, Minatel E, Marques MJ. Axonal sprouting in mdx mice and its relevance to cell and gene mediated therapies for Duchenne muscular dystrophy. Neurosci Lett. 2003;343:67–69. doi: 10.1016/s0304-3940(03)00220-9. [DOI] [PubMed] [Google Scholar]
  65. Saxton JM, Clarkson PM, James R, Miles M, Westerfer M, Clark S, Donnelly AE. Neuromuscular dysfunction following eccentric exercise. Med Sci Sports Exerc. 1995;27:1185–1193. [PubMed] [Google Scholar]
  66. Shiao T, Fond A, Deng B, Wehling-Henricks M, Adams ME, Froehner SC, Tidball JG. Defects in neuromuscular junction structure in dystrophic muscle are corrected by expression of a NOS transgene in dystrophin-deficient muscles, but not in muscles lacking alpha- and beta1-syntrophins. Hum Mol Genet. 2004;13:1873–1884. doi: 10.1093/hmg/ddh204. [DOI] [PubMed] [Google Scholar]
  67. Sieck DC, Zhan WZ, Fang YH, Ermilov LG, Sieck GC, Mantilla CB. Structure-activity relationships in rodent diaphragm muscle fibers vs. neuromuscular junctions. Respir Physiol Neurobiol. 2012;180:88–96. doi: 10.1016/j.resp.2011.10.015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  68. Stone MR, O’Neill A, Lovering RM, Strong J, Resneck WG, Reed PW, Toivola DM, Ursitti JA, Omary MB, Bloch RJ. Absence of keratin 19 in mice causes skeletal myopathy with mitochondrial and sarcolemmal reorganization. J Cell Sci. 2007;120:3999–4008. doi: 10.1242/jcs.009241. [DOI] [PMC free article] [PubMed] [Google Scholar]
  69. Takekura H, Fujinami N, Nishizawa T, Ogasawara H, Kasuga N. Eccentric exercise-induced morphological changes in the membrane systems involved in excitation-contraction coupling in rat skeletal muscle. J Physiol. 2001;533:571–583. doi: 10.1111/j.1469-7793.2001.0571a.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  70. Wagner KR. Genetic diseases of muscle. Neurol Clin. 2002;20:645–678. doi: 10.1016/s0733-8619(02)00002-6. [DOI] [PubMed] [Google Scholar]
  71. Warren GL, Ingalls CP, Shah SJ, Armstrong RB. Uncoupling of in vivo torque production from EMG in mouse muscles injured by eccentric contractions. J Physiol. 1999;515:609–619. doi: 10.1111/j.1469-7793.1999.609ac.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  72. Warren GL, Ingalls CP, Lowe DA, Armstrong RB. Excitation-contraction uncoupling: major role in contraction-induced muscle injury. Exerc Sport Sci Rev. 2001;29:82–87. doi: 10.1097/00003677-200104000-00008. [DOI] [PubMed] [Google Scholar]
  73. Willmann R, Possekel S, Dubach-Powell J, Meier T, Ruegg MA. Mammalian animal models for Duchenne muscular dystrophy. Neuromuscul Disord. 2009;19:241–249. doi: 10.1016/j.nmd.2008.11.015. [DOI] [PubMed] [Google Scholar]
  74. Wilson MH, Deschenes MR. The neuromuscular junction: anatomical features and adaptations to various forms of increased, or decreased neuromuscular activity. Int J Neurosci. 2005;115:803–828. doi: 10.1080/00207450590882172. [DOI] [PubMed] [Google Scholar]
  75. Xu R, Salpeter MM. Acetylcholine receptors in innervated muscles of dystrophic mdx mice degrade as after denervation. J Neurosci. 1997;17:8194–8200. doi: 10.1523/JNEUROSCI.17-21-08194.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Journal of Physiology are provided here courtesy of The Physiological Society

RESOURCES