Skip to main content
Viral Immunology logoLink to Viral Immunology
. 2013 Feb;26(1):40–48. doi: 10.1089/vim.2012.0043

Phylogenetic Analysis of Isolated HCV Strains from Tunisian Hemodialysis Patients

Fatma Houissa Kchouk 1, Yousr Gorgi 1,, Lamjed Bouslama 2, Imen Sfar 1, Rym Ayari 1, Hacene Khiri 3, Phillipe Halfon 3, Houda Aouadi 1, Saloua Jendoubi Ayed 1, Khaled Ayed 1, Taieb Ben Abdallah 1
PMCID: PMC3578366  PMID: 23374151

Abstract

The present study describes the strains of hepatitis C virus (HCV) isolated from Tunisian hemodialysis patients. Thirty-three HCV strains isolated from different dialysis centers in Tunis City were amplified by RT-PCR in a region of the NS5b gene, genotyped by sequencing, and compared to international sequences by phylogenetic analysis. The phylogenetic tree showed that 16 HCV isolates have been identified as subtype 4k (48.5%), 7 as unspecified HCV-4 subtype (21.2%), 5 as subtype 4a et 1b (each 15.2%). The analysis of this tree revealed that the HCV-1b strains were closely related to Anglo-Saxon and European isolates, while the HCV-4 isolates are genetically similar to Egyptian and African strains. Phylogenic analysis of 33 Tunisian isolates with international HCV strains on a region of the NS5b gene demonstrated that the subtype 4k submerged the Tunis city and a new subtype of HCV4 seems to be suspect in this area.

Introduction

Hepatitis C virus (HCV) is considered as the major causative agent of post-transfusion hepatitis throughout the world. Chronic HCV infection can lead to permanent liver damage, cirrhosis, and eventually hepatocellular carcinoma. Hemodialysis patients are recognized as a group at increased risk of HCV infection (34,35).

HCV is an enveloped single-stranded, positive-sense RNA virus. It belongs to the flaviviridae family. The genome of this virus is characterized by a high degree of variability due to the poor fidelity to the viral RNA-dependent RNA polymerase and the lack of genome repair mechanisms (2). Analysis of the NS5b region encoding the viral RNA polymerase from a wide range of HCV isolates led to the classification of HCV into six major genotypes and more than 70 subtypes (6,40).

Several epidemiological studies have shown that the HCV genotypes have a particular geographic distribution throughout the world and certain genotypes predominate in certain areas. Genotypes 1, 2, and 3 are distributed almost worldwide (25). Genotype 4 has been reported to be the most prevalent genotype in northern and central Africa, Middle East, and Egypt (7,19,37). Genotype 5 was found in South Africa and genotype 6 was especially located in South East Asia (32). In Tunisia, a sero-molecular-epidemiologic national inquest of HCV infection from hemodialysis patients was done in 2002 in the Charles Nicolle Hospital laboratory (3). This study showed that genotype 1b is the most prevalent (70.8%), followed by genotype 4 (21.2%). The regional distribution of genotype 4 was variable with predilection in the Tunis region (18.8%). The phylogenetic analysis of HCV genotype 4 has not been treated previously in Tunisian studies. This work is a first report that has focused on phylogenetic analysis of hepatitis C virus genotype 4 isolates from hemodialysis patients in the Tunis city and this by comparing 33 isolates, which were selected from isolates of genotype HCV4 determined by Inno LiPA test during the national survey, with international HCV strains in a phylogenetic approach.

Materials and Methods

Patients and isolates

Thirty-three HCV strains were isolated from hemodialyzed patients in 21 dialysis centers in Tunis City (named A to X). The F unit is the only public center of the Charles Nicolle Hospital. It represents the basal center from which the majority of patients will be dispatched to their respective loco-regional private dialysis units. The number that follows the alphabetical letter indicates the patient number in the center. The 33 Tunisian HCV strains were labelled “T” (Tunisia), followed by a number (Table 1). Data obtained from each patient included age at diagnosis, gender, duration on hemodialysis, initial nephropathy, and possible risk factors for HCV (such as transfusion and/or surgery) were completed retrospectively at the hemodialysis centers (Table 2). All patients were negative for hepatitis B surface antigen (HBsAg) and human immunodeficiency virus (HIV). The HCV viral load was identified by HCV Real-TM Quant (Sacace, Biotechnologies) and revealed an average of 21489,667±42592,528 copies/mL in patients of this study. The use of recombinant erythropoietin to treat anemia due to renal failure was observed in one patient (S1). The notion of a stay abroad before dialysis treatment of end stage renal disease was identified in one patient (G1) in Saudi Arabia. None of the patients had received treatment for HCV infection before entering the study. In these hemodialysis units and during all the period of their dialysis, all the patients were tested for ALT levels (once/year). Thirty among 33 studied patients (91%) had normal levels of ALT (range: 5–55 U/L; mean: 46.89 U/L), and in 3/33 cases the cytolysis ranged from 1.5 to 3 times the normal of ALT with mean levels at 82.05 U/L.

Table 1.

Name, Accession Number, and Subtype of Tunisian HCV Strains Isolated from Infected Hemodialyzed Patients and Risk Factors

Name of center Isolate Accession number Gender ALT Genotype Risk factors Year of onset of HCV infection
A1 T1 AJ581499 M N 4k Yes (Tr+S) 1997
C1 T2 AJ581489 M N 4 Yes (Tr) 1997
E1 T3 JX457320 M N 4 Yes (S) 1998
F1 T4 AJ581506 F N 4k Yes (Tr) 1998
F2 T5 AJ581508 M N 4k Yes (Tr) 2000
D1 T7 AJ581503 F N 4k Yes (Tr+S) 2002
F4 T8 AJ581490 M N 4 No 2002
F5 T9 AJ581500 M N 4k Yes (Tr) 1995
B1 T11 AJ581510 M N 4k No 1996
F7 T13 JX457321 M N 4k No 2002
F8 T14 AJ581498 F N 4k No 2002
H1 T15 JX457322 M N 4 No 2002
K1 T17 AJ581501 F 2xN 4k Yes (S) 1995
L1 T18 JX457323 M N 1b Unknown 2002
G1 T19 AJ581493 M N 4 Stay abroad 2002
L2 T20 JX457324 M N 1b Unknown 2002
L3 T21 AJ581483 F N 4a Unknown 2002
G2 T22 JX457325 M N 1b Unknown 2002
M1 T23 AJ581509 F N 4k Unknown 2002
M2 T24 AJ581488 F N 4a Yes (Tr) 1998
I1 T25 JX457326 M N 1b No 2000
I2 T26 JX457327 F N 1b Yes (Tr+S) 2002
N1 T27 AJ581487 M N 4a No 2002
P1 T28 AJ581496 M N 4k Yes (Tr+S) 2000
P2 T29 AJ581484 M N 4a Yes (Tr+S) 1997
R1 T30 AJ581507 F N 4k Yes (Tr+S) 1989
R2 T31 JX457328 M N 4k Yes (Tr) 1989
S1 T33 AJ581497 F 3xN 4k Yes (Tr) 2000
T1 T34 AJ581504 F N 4k No 2002
U2 T36 AJ581491 M 1,5xN 4 Yes (Tr+S) 1998
V1 T37 AJ581494 M N 4 Yes (Tr+S) 1999
V2 T38 AJ581502 M N 4k Yes (Tr+S) 1991
X1 T39 AJ581485 F N 4a Yes (Tr) 2002

n, number; N, normal; S, surgery; Tr, transfusion.

Table 2.

Clinical and Epidemiological Characteristics of the HCV Infected Patients

Gender
Sex ratio (Male/Female) 21/12
Mean age (years±SD) 45.41±10.66
Hemodialysis average duration (months) 130.03±64.14
Discovery of the HCV infection n (%)
• Before admission 16 (48.5)
• In the center 17 (51.5)
Mean seroconversion/beginning dialysis in patients infected in the center (months) 83 (range 2–235)
Initial nephropathy (%)
• Unspecified chronic nephropathy 26.37
• Vascular nephropathy 18.93
• Glomerulonephritis 15.46
• Tubulointerstitial nephropathy 14.30
• Diabetic nephropathy 13.73
• Others 11.21
Risk factors: n (%)
• Yes (Transfusions and/or Surgery) 19 (57.6)
•  A stay abroad 1 (3)
•  No 8 (24.2)
•  Unknown 5 (15.2)

All patients had given informed consent, and the study was approved by the local ethics committee.

HCV typing with INNO-LiPA

The 33 Tunisian HCV isolates were typed by using the reverse hybridization line probe assay (INNO-LiPA assay; Immunogenetics, Belgium) according to the manufacturer's protocol.

RNA extraction and RT-PCR of NS5b region

RNA was extracted from patient serum by RNA columns (QIA amp viral RNA kit; QIAGEN) according to the manufacturer's instructions. Extracted RNA (12 μL) was transcribed for 90 min at 42°C using 0.2 mM of each dNTP, 20 pmol of random hexamers, 1x AMV buffer, 25 U RNasin, and 10 U of the RT AMV enzyme (Promega, USA) in a final volume of 25 μL.

The reaction volume of PCR was 50 μL containing 10 μL of cDNA, 0.2 mM of each dNTP, 1.5 mM of MgCl2, 0.5 U of Taq polymerase (Promega, USA) and 10 μM of each primer. Primer sequences (G4-980 and G4-981) (39) used are summarized in Table 3. The PCR programme is as follows: initial denaturation at 95°C for 15 min, 10 cycles of denaturation at 94°C for 40 sec, annealing at 50°C for 30 sec, and elongation at 72°C for 1 min; followed immediately by 35 cycles at 94°C for 30 sec, 50°C for 30 sec, and 72°C for 1 min per cycle. The final elongation step was at 72°C for 10 min. The PCR products (420 bp) were migrated on agarose gel (2%) and visualized under UV light.

Table 3.

Primers Used for the PCR and Sequencing of NS5b of HCV Genes

G4-980 5’ TGGGGTTCCCGTATGATACCCGCTGCTTTG 3’
G4-981 5’ TTCACGGAGGCTATGACCAGGTACTCCGCC 3’
ASN1121 5’ GAGGCTATGACBAGRTAYTCNGC 3’

Purification and sequencing

The amplified products were purified using QIAquick Gel extraction kit and were sequenced in the NS5b region of the viral genome by using ASN1121 primer (28).Cycle sequencing was undertaken using Cy5.0/Cy5.5 Dye Primer Cycle Sequencing, according to the manufacturer's instruction. The product was analyzed on an automatic TOWER MICROGene Clipper™ sequencer.

Phylogenetic analysis

Genetic similarities to the 33 HCV were identified with the BLAST program. Twenty-three international sequences from GenBank database (Table 4) were selected and aligned with the Tunisian isolates by using Clustal program W2.0 (23). Distances between sequences were determined with the DNA dist program (Kimura two-parameter model) of the PHYLIP package (20). The phylogenetic tree was constructed with the neighbour-joining algorithm (38) using the Mega 4 program (22).

Table 4.

Name, Accession Number, Subtype, and Origin Country of HCV Strains Published in GenBank

Accession number Name Origin country Subtype Linked Work
DQ911165 HCpEG012 EGY 4o (1)
DQ911179 EG052 EGY 4o (1)
AY548728 HCCEG018 EGY 4o (1)
AY548721 HCCEG008 EGY 4o (1)
DQ911203 EG084 EGY 4a (1)
AB103455 South1617 EGY 4a (43)
AB103441 Central49 EGY 4a (43)
AB103452 NorthWest A21 EGY 4a (43)
EF694502 VC3246 EGY 4a Unpublished
AF271814 2113 EGY 4o (37)
AF271815 2153 EGY 4o (37)
FJ872307 TLS11-4k FRA 4k Unpublished
GU054480 FrBd2007 FRA 4k (1)
EU155307 HCV-1b/US/BID-V353/2002 USA 1b Unpublished
FJ024277 HCV-1b/US/BID-V1711/2007 USA 1b Unpublished
EU710290 79537873D2 AUS 1b (14)
AJ291294 FrSSD174 BUR 4k (28)
AY632237 13986 CAM 4k Unpublished
HQ908348 AD312 GER 1b Unpublished
FJ538072 HCVGR1b19 GRE 1b Unpublished
HM106908 1569 IRE 1b (27)
EU710318 7G74R527S4 UK 1b (14)
GU590501 Case1-M4 SPA 1b (36)

AUS, Australia; BUR, Burundi; CAM, Cameroon; EGY, Egypt; FRA, France; GER, Germany; GRE, Greece; IRE, Ireland; SPA, Spain; TUN, Tunisia; UK, United Kingdom; USA, United States of America.

Nucleotide sequence accession number

The nucleotide sequences accession number of the 33 Tunisian strains and the 23 selected international HVC sequences are shown in Tables 1 and 4, respectively (1,13,26,32,33,38).

Results

HCV typing by INNO-LIPA

The 33 Tunisian HCV isolates were identified as HCV-4 by INNO-LiPA assay.

Epidemiological characteristics

As summarized in Tables 1 and 2, blood transfusion and/or surgery were identified as the most frequent risk factors in 19/33 (57.6%) of patients. Eight (24.2%) had no risk factor, and in 5 cases, the factors were unknown. Three patients with risk factors (R1, R2, and V2) were infected prior to 1995 during which the test screening for anti-HCV among blood donors was introduced in Tunisia country. In addition, the patient G1 had worked in Saudi Arabia prior to dialysis and was infected on admission by the strain T19 (HCV-4).

Phylogenetic analysis

The 33 isolates were previously typed by INNO-LiPA hybridization as HCV-4. The phylogenetic analysis of these strains performed in a partial region of the NS5b gene by comparing to the most genetically closed international sequences (23 sequences according to BLAST data) highlighted 5 clusters constituted of 4 subtypes (1b, 4a, 4k, 4o) and unspecified HCV-4 subtype (Fig. 1). Among the 33 Tunisian isolates, 16 were 4k (48.5%), 7 were unspecified HCV-4 (21.2%), and 5 were 4a and 1b (15.2% each). Among the 7 unspecified HCV-4 strains, one (T2) seems to be 4o subtype because it belongs to a cluster comprising exclusively HCV-4o Egyptian strains, while the 6 other unspecified HCV-4 strains (T3, T8, T15, T19, T36,and T37) cluster with 4o in a separate arm of the tree. In order to know the subtype of these isolates, a phylogenic analysis of these 7 unspecified HCV-4 isolates with 40 international HCV4 strains (Table 5), including all of the 19 assigned subtypes of genotype 4 in NS5b gene region, was done. The tree revealed that these isolates did not match any known subtype HCV4 but they are weakly related to isolates HCV4o (Fig. 2). Calculation of similarity between the HCV4 unspecified sequence and the 40 different sequences of HCV4 subtype showed similarity below to 90% (Table 6).

FIG. 1.

FIG. 1.

Phylogenetic tree of 33 Tunisian isolates and 23 international HCV strains on a region of the NS5b gene (nucleotides 8317 to 8581) designed by imputing the aligned sequences into the MEGA 4 program and constructed using the neighbour-joining algorithm. Genetic distances were calculated with the Kimura-2 parameter model with a transition/transversion ratio of 2.0, and the reliability of the tree was determined by bootstrap analysis with 1000 pseudo replicate data sets. For each strain, the county of isolation and the genotype/subtype are indicated in parenthesis. The bootstrap values are represented at the tree nodes, only those >50% are shown. The scale for the genetic distance is also represented. The countries are mentioned according to the following abbreviations: AUS, Australia; BUR, Burundi; CAM, Camaroon; EGY, Egypt; FRA, France; GER, Germany; GRE, Greece, IRE, Ireland; SPA, Spain; TUN, Tunisia; UK, United Kingdom; USA, United States of America.

Table 5.

Name, Accession Number, Subtype, and Origin Country of HCV Strains Published in HCV LOS ALAMOS DATABASE

Accession number Name Origin country Subtype Linked Work
Y11604 ED43 EGY 4a (7)
AF271812 1803 EGY 4a (37)
AF271803 2130 EGY 4a (37)
L29602 GB116 GAB 4c (42)
L29605 GB215 GAB 4c (42)
AJ291290 FrSSD164 FRA 4d (28)
D86538 SD008 JAP 4d (45)
L29590 CAM600 CAM 4e (42)
L29626 GB809-3-1 GAB 4e (42)
L29593 G22 CAM 4f (42)
AJ291250 FrSSD36 FRA 4f (28)
L29618 GB549 GAB 4g (42)
AJ291249 FrSSD35 FRA 4h (28)
FJ872307 TLS11-4k FRA 4k Unpublished
AJ291294 FrSSD174 BUR 4k (28)
D86534 SD002 JAP 4l (45)
AF271816 2116 EGY 4l (37)
D86543 SD035 JAP 4m (45)
AF271813 1797 EGY 4m (37)
EF116138 QC264 CA 4b (29)
GU049363 HCV_P_245 PT 4b (21)
AY434135 QC97 CA 4n (29)
JN203153 Eg16 EGY 4n Unpublished
AF271814 2113 EGY 4o (37)
AF271815 2153 EGY 4o (37)
AY434108 QC59 CA 4o (29)
AY743113 G4MP163 FRA 4o (33)
AJ291285 FrSSD158 FRA 4p (28)
AY434150 QC139 CA 4p (29)
AY434126 QC86 CA 4q (29)
HQ385883 ZADGM4188 S. AF 4q Unpublished
AY743098 G4MP076 FRA 4r (33)
EF116098 QC92 CA 4r (29)
AJ291284 FrSSD136 FRA 4r (28)
AY706997 QC85 CA 4t (29)
AY257072 98CM1458 CAM 4t (31)
EF694398 CT1039 EGY 4u Unpublished
EF694431 VC1176 EGY 4u Unpublished
HQ537008 CYHCV048 CY 4v (9)
HQ537009 CYHCV073 CY 4v (9)

BUR, Burundi; CA, Canada; CAM, Cameroon; CY, Cyprus; EGY, Egypt; FRA, France; GAB, Gabon; JAP, Japan; PT, Portugal; S.AF, South Africa.

FIG. 2.

FIG. 2.

Phylogenetic tree of 7 unspecified HCV-4 isolates and 40 international HCV4 strains, including all assigned subtypes of genotype 4, on a region of the NS5b gene (nucleotides 8317 to 8581) designed by imputing the aligned sequences into the MEGA 4 program and constructed using the neighbor-joining algorithm. Genetic distances were calculated with the Kimura-2 parameter model with a transition/transversion ration of 2.0, and the reliability of the tree was determined by bootstrap analysis with 1000 pseudo replicate data sets. For each strain, the country of isolation and the genotype/subtype are indicated in parentheses. The bootstrap values are represented at the tree nodes, only those >50% are shown. The scale for the genetic distance is also represented. The countries are mentioned according to the following abbreviations: BUR, Burundi; CA, Canada; CAM, Camaroon; CY, Cyprus; EGY, Egypt; FRA, France; GAB, Gabon, JAP, Japan; PT, Portugal; S.AF, South Africa.

Table 6.

The Percentage of Homology Between HCV4 Unspecified Sequences and International Reference Sequences Belonging to Nineteen Known Subtypes HCV4

Sequence T3 T15 T2 T8 T19 T36 T37
ED43(EGY/4a) 0,822 0,822 0,796 0,823 0,824 0,841 0,83
1803(EGY/4a) 0,856 0,864 0,818 0,849 0,861 0,86 0,841
2130(EGY/4a) 0,833 0,837 0,815 0,845 0,85 0,849 0,833
GB116(GAB/4c) 0,811 0,811 0,796 0,808 0,835 0,826 0,803
GB215(GAB/4c) 0,815 0,811 0,807 0,815 0,82 0,83 0,8
FrSSD164(FRA/4d) 0,833 0,845 0,784 0,838 0,861 0,849 0,849
SD008(JAP/4d) 0,845 0,856 0,818 0,86 0,876 0,86 0,864
CAM600(CAM/4e) 0,833 0,837 0,811 0,838 0,843 0,833 0,864
GB809-3-1(GAB/4e) 0,83 0,841 0,818 0,849 0,847 0,845 0,837
G22(CAM/4f) 0,815 0,811 0,796 0,812 0,82 0,818 0,811
FrSSD36(FRA/4f) 0,792 0,815 0,784 0,819 0,817 0,83 0,788
GB549(GAB/4g) 0,796 0,803 0,754 0,8 0,798 0,803 0,796
FrSSD35(FRA/4h) 0,811 0,811 0,792 0,823 0,82 0,815 0,815
4kFrSSD174(BUR/4k) 0,818 0,83 0,788 0,827 0,817 0,818 0,822
TLS11-4k(FRA/4k) 0,815 0,833 0,8 0,83 0,82 0,83 0,818
SD002(JAP/4l) 0,822 0,807 0,815 0,815 0,817 0,818 0,841
2116(EGY/4l) 0,822 0,807 0,811 0,812 0,824 0,818 0,841
SD035(JAP/4m) 0,826 0,833 0,822 0,838 0,843 0,845 0,833
1797(EGY/4m) 0,849 0,833 0,83 0,842 0,839 0,845 0,841
QC264(CA/4b) 0,796 0,788 0,769 0,774 0,794 0,773 0,796
HCV_P_245(PT/4b) 0,784 0,781 0,781 0,793 0,794 0,788 0,773
QC97(CA/4n) 0,826 0,83 0,826 0,834 0,843 0,852 0,845
Eg16(EGY/4n) 0,841 0,849 0,822 0,845 0,854 0,871 0,837
2113(EGY/4o) 0,89 0,886 0,905 0,883 0,891 0,898 0,898
QC59(CA/4o) 0,875 0,867 0,905 0,864 0,873 0,879 0,875
G4MP163(FRA/4o) 0,883 0,864 0,898 0,864 0,861 0,867 0,871
2153(EGY/4o) 0,879 0,879 0,943 0,879 0,873 0,89 0,883
FrSSD158(FRA/4p) 0,818 0,83 0,796 0,834 0,843 0,833 0,822
QC139(CA/4p) 0,837 0,849 0,818 0,853 0,854 0,852 0,841
QC86(CA/4q) 0,803 0,803 0,788 0,804 0,805 0,811 0,811
ZADGM4188(S.AF/4q) 0,822 0,815 0,811 0,815 0,824 0,822 0,837
G4MP076(FRA/4r) 0,8 0,796 0,781 0,812 0,802 0,807 0,811
QC92(CA/4r) 0,83 0,845 0,807 0,849 0,843 0,845 0,845
FrSSD136(FRA/4r) 0,826 0,833 0,8 0,845 0,839 0,845 0,833
QC85(CA/4t) 0,803 0,8 0,781 0,804 0,809 0,807 0,8
98CM1458(CAM/4t) 0,796 0,784 0,769 0,781 0,772 0,784 0,777
CT1039(EGY/4u) 0,815 0,807 0,815 0,815 0,828 0,83 0,841
VC1176(EGY/4u) 0,803 0,781 0,788 0,785 0,794 0,788 0,83
CYHCV048(CY/4v) 0,833 0,822 0,826 0,83 0,839 0,833 0,83
CYHCV073(CY/4v) 0,83 0,811 0,822 0,819 0,835 0,822 0,833

In the same way, the 5 HCV-4a Tunisian isolates are genetically close to Egyptian strains. On the HCV subtype 4k, T11, T23, and T38 isolates are genetically similar to French, Burundi, and Cameroonian strains, and T28 to French strains. The other HCV-4k Tunisian isolates do not have a strong closely related strain.

The cluster 1b includes five Tunisian strains. T18, T20, and T26 seem to have a relationship with European strains (Germany, Greece, and Spain), and T22 and T25 are closely related to Anglo-Saxon strains (UK, USA, Ireland, and Australia).

Discussion

Hemodialysis patients are one of the high risk groups for hepatitis, especially HCV infection (30,34,35). In Tunisian dialysis patients, the prevalence of infection varies from 43% before 1995 (17) to 19.07% in 2002 (3), and this infection was correlated with a history of blood transfusions and with a long-term hemodialysis. Hepatitis C viral infection varies widely among dialysis units all over the world (34). This variation is due to several factors such as blood transfusion, intravenous drug users (IVDU), and lapses of universal precautionary measures. In Tunisia, epidemiological and previous phylogenetic studies conducted on both healthy and HCV infected subjects, reported a large predominance of genotype 1b (4,10,12,26). Few epidemiological studies have focused on HCV-4 infection in Tunisia.

Several molecular methods have been used for genotype HCV; nucleotide sequencing of a phylogenetically informative region remains the gold standard (5,16).

In this study, the genotyping was done in the first time for the same samples by reverse line probe assay (LiPA; INNO-LiPA HCV II; Innogenetics) of the 5’UTR, and in the second time by sequencing of the DNA of the NS5b region. The results by the two techniques are concordant for 28/33 of cases (84.8%). However, for the other 5 isolates (15.2%) typed genotype 4 by INNO-LiPA, their direct sequencing in the NS5b region identified a genotype 1b. This discordant result is confirmed by the sequencing of these 5 isolates in the constant region 5′UTR. These results corroborate those of Scott et al. (41) who reported that, while most assays target the highly conserved 5’ noncoding region of the HCV genome, mutations can occur in this region leading to misclassification of HCV genotypes in 5%–8% of cases. Similarly, the study of Chen et al. (8) showed that the reverse line probe assay LiPA was not heterogeneous enough for use in determination of HCV subtype and cannot be used for differentiation of HCV genotypes 1a and 1b.

The HCV genotype 4 has 19 assigned subtypes (a-h and k-u) (24). This genotype is highly prevalent in the Middle East (Teheran, Yemen, Kuwait, Iraq, and Saudi Arabia) and in Africa, particularly in Egypt due to the use of unsterile equipment during mass treatment of the population with parenteral antischistosomal therapy from the 1920s to the 1980s(7,13,15,18). HCV-4 has recently spread in several Western countries, especially in Europe (28,33) and North America, due to the variations in population structure, immigration, and routes of transmission, particularly among IVDU populations, who represent the main reservoir for HCV in Europe. In this study, phylogenetic analysis revealed the presence of three different clusters of HCV4. The most prevalent subtype of HCV-4 circulating among the dialysis centers in Tunis region, were 4k. In fact, the subtype 4k submerged the Tunis city. The analysis of these strains according to their original dialysis unit seems to indicate that the F public dialysis center could be the source of contamination. So, all patients whose strains belonged to cluster 4k passed through the F public center for a mean hemodialysis duration ranging from a few months to several years before joining their respective private center. Even if most Tunisian HCV-4k isolates were unknown, three of them seem to be related with African strains (Burundi and Cameroon), although these strains are close to French strains. Since human exchanges between Tunisia and these two African countries are rare, the most likely hypothesis is that these strains were transmitted by people traveling between Africa and France.

A second cluster grouped only 15.2% of the strains identified as HCV-4a that are related to the sequences described in Egypt, where a high prevalence of HCV-4 has been described and approximately 63% of Egyptian isolates belong to HCV-4a (1,43). These results corroborate those reported by Djebbi et al. (11).

The third cluster contains one isolate that is strongly related to Egyptian strain HCV4o, and six others isolates weakly related to HCV4o strains. These isolates appear to represent a new subtype. They should be analyzed in another region of the viral genome, especially in the hyper variable region E1/E2 which, according to many authors, would best reflect the full extent of subtype variations present in the infected individuals (16) or better yet by sequencing the whole genome (24,44).

In conclusion, this study showed that blood transfusions are common major risk factors of infection, especially concerning the HCV contamination in hemodialysis units. The analysis of the phylogenetic tree revealed, as previously reported, that the HCV-1b strains were closely related to Anglo-Saxon and European isolates, while the HCV-4 isolates are genetically similar to Egyptian and African strains. The HCV4k is the most prevalent subtype of HCV-4 circulating among the dialysis centers in the Tunis region, and a new subtype of HCV4 seems to be suspect in this city.

Acknowledgments

This study was supported by a grant from the Tunisian Kidney Transplantation Research Fund (LR03SP01) and MEDIS Laboratory. We thank all the medical staff and technicians of dialysis centers who agreed to participate in this study. We are grateful to Professors Alain Goudeau and Catherine Gaudy, University François Rabelais, Microbiology Laboratory, Tours (France) for our initiation to the phylogenetic analysis methods for the study of the HCV diversity.

Author Disclosure Statement

No benefits in any form have been received or will be received from commercial party related directly or indirectly to the subject of this article.

References

  • 1.Abdel-Hamid M. El-Daly M. Molnegren V, et al. Genetic diversity in hepatitis C virus in Egypt and possible association with hepatocellular carcinoma. J Gen Virol. 2007;88:1526–1531. doi: 10.1099/vir.0.82626-0. [DOI] [PubMed] [Google Scholar]
  • 2.Ashfaq UA. Javed T. Rehman S. Nawaz Z. Riazuddin S. An overview of HCV molecular biology, replication and immune responses. Virol J. 2011;8:161–170. doi: 10.1186/1743-422X-8-161. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Ayed K. Gorgi Y. Ben Abdallah T, et al. Hepatitis C virus infection in hemodialysis patients from Tunisia: National survey by serological and molecular methods. Transplant Proc. 2003;35:2573–2575. doi: 10.1016/j.transproceed.2003.09.005. [DOI] [PubMed] [Google Scholar]
  • 4.Ben Moussa M. Barguellil Ben Moussa M. Barguellil F. Bouziani A. Amor A. Comparison of two hepatitis C virus typing assays in a Tunisian population. Ann Biol Clin. 2003;61:234–238. [PubMed] [Google Scholar]
  • 5.Bruguera M. Saiz JC. Franco S, et al. Outbreak of nosocomial hepatitis C infection resolved by genetic analysis of HCV RNA. J Clin Microbiol. 2002;40:4363–4366. doi: 10.1128/JCM.40.11.4363-4366.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Bukh J. Miller RH. Purcell RH. Genetic heterogeneity of hepatitis C virus : Quasispecies and genotypes. Semin Liver Dis. 1995;15:41–63. doi: 10.1055/s-2007-1007262. [DOI] [PubMed] [Google Scholar]
  • 7.Chamberlain RW. Chamberlain RW. Adams N. Saeed AA. Simmonds P. Elliott RM. Complete nucleotide sequence of a type 4 hepatitis C virus variant, the predominant genotype in the Middle East. J Gen Virol. 1997;78:1341–1347. doi: 10.1099/0022-1317-78-6-1341. [DOI] [PubMed] [Google Scholar]
  • 8.Chen Z. Weck KE. Hepatitis C virus genotyping: Interrogation of the 5’ untranslated region cannot accurately distinguish genotypes 1a and 1b. J Clin Microbiol. 2002;40:3127–3134. doi: 10.1128/JCM.40.9.3127-3134.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Demetriou VL. Kostrikis LG. Near-full genome characterization of unclassified hepatitis C virus strains relating to genotypes 1 and 4. J Med Virol. 2011;83:2119–2127. doi: 10.1002/jmv.22237. [DOI] [PubMed] [Google Scholar]
  • 10.Djebbi A. Triki H. Bahri O, et al. Genotypes of hepatitis C virus circulating in Tunisia. Epidemiol Infect. 2003;130:501–505. doi: 10.1017/s095026880300846x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Djebbi A. Mejri S. Thiers V. Triki H. Phylogenetic analysis of hepatitis C virus isolates from Tunisian patients. Eur J Epidemiol. 2004;19:555–562. doi: 10.1023/b:ejep.0000032348.83087.01. [DOI] [PubMed] [Google Scholar]
  • 12.Djebbi A. Bahri O. Langar H. Sadraoui A. Mejri S. Triki H. Genetic variability of genotype 1 hepatitis C virus isolates from Tunisian haemophiliacs. New Microbiol. 2008;31:473–480. [PubMed] [Google Scholar]
  • 13.Frank C. Mohamed MK. Strickland GT, et al. The role of parenteral antischistosomal therapy in the spread of hepatitis C virus in Egypt. Lancet. 2000;355:887–891. doi: 10.1016/s0140-6736(99)06527-7. [DOI] [PubMed] [Google Scholar]
  • 14.Gaudieri S. Rauch A. Pfafferott K, et al. Hepatitis C virus drug resistance and immune-driven adaptations: Relevance to new antiviral therapy. Hepatology. 2009;49:1069–1082. doi: 10.1002/hep.22773. [DOI] [PubMed] [Google Scholar]
  • 15.Genovese D. Dettori S. Argentini C, et al. Molecular epidemiology of hepatitis C virus genotype 4 isolates in Egypt and analysis of the variability of envelope proteins E1 and E2 in patients with chronic hepatitis. J Clin Microbiol. 2005;43:1902–1909. doi: 10.1128/JCM.43.4.1902-1909.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Halfon P. Roubicek C. Gerolami V, et al. Use of phylogenetic analysis of hepatitis C virus (HCV) hypervariable region 1 sequences to trace on outbreak of HCV in autodialysis unit. J Clin Microbiol. 2002;40:1541–1545. doi: 10.1128/JCM.40.4.1541-1545.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Hmida S. Mojaat N. Chaouachi E. Mahjoub T. Abid S. Boukef K. HCV antibodies in hemodialyzed patients in Tunisia. Pathol Biol. 1995;43:581–583. [PubMed] [Google Scholar]
  • 18.Kamal SM. Nasser IA. Hepatitis C genotype 4: What we know and what we don't yet know. Hepatology. 2008;47:1371–1383. doi: 10.1002/hep.22127. [DOI] [PubMed] [Google Scholar]
  • 19.Khattab MA. Ferenci P. Hadziyannis SJ, et al. Management of hepatitis C virus genotype 4: Recommandations of an international expert panel. J Hepatol. 2011;54:1250–1262. doi: 10.1016/j.jhep.2010.11.016. [DOI] [PubMed] [Google Scholar]
  • 20.Kimura M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol. 1980;16:111–120. doi: 10.1007/BF01731581. [DOI] [PubMed] [Google Scholar]
  • 21.Koletzki D. Dumont S. Vermeiren H. Fevery B. De Smet P. Stuyver LJ. Development and evaluation of an automated hepatitis C virus NS5B sequence-based subtyping assay. Clin Chem Lab Med. 2010;48:1095–1102. doi: 10.1515/CCLM.2010.236. [DOI] [PubMed] [Google Scholar]
  • 22.Kumar S. Tamura K. Jakobsen IB. Nei M. MEGA2: Molecular evolutionary genetics analysis software. Bioinformatics. 2001;17:1244–1245. doi: 10.1093/bioinformatics/17.12.1244. [DOI] [PubMed] [Google Scholar]
  • 23.Larkin MA. Blackshields G. Brown NP, et al. Clustal W and Clustal X version 2.0. Bioinformatics. 2007;23:2947–2948. doi: 10.1093/bioinformatics/btm404. [DOI] [PubMed] [Google Scholar]
  • 24.Li C. Lu L. Wu X, et al. Complete genomic sequences for hepatitis C virus subtypes 4b, 4c, 4d, 4g, 4k, 4l, 4m, 4n, 4o, 4p, 4q, 4r, and 4t. J Gen Virol. 2009;90:1820–1826. doi: 10.1099/vir.0.010330-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.McOmish F. Yap PL. Dow BC, et al. Geographical distribution of hepatitis C virus genotypes in blood donors: An international collaborative survey. J Clin Microbiol. 1994;32:884–892. doi: 10.1128/jcm.32.4.884-892.1994. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Mejri S. Salah AB. Triki H. Alaya NB. Djebbi A. Dellagi K. Contrasting patterns of hepatitis C virus infection in two regions from Tunisia. J Med Virol. 2005;76:185–193. doi: 10.1002/jmv.20342. [DOI] [PubMed] [Google Scholar]
  • 27.Merani S. Petrovic D. James I, et al. Effect of immune pressure on hepatitis C virus evolution: Insights from a single-source outbreak. Hepatology. 2011;53:396–405. doi: 10.1002/hep.24076. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Morice Y. Roulot D. Grando V, et al. Phylogenetic analyses confirm the high prevalence of hepatitis C virus (HCV) type 4 in the Seine-Saint-Denis district (France) and indicate seven different HCV-4 subtypes linked to two different epidemiological patterns. J Gen Virol. 2001;82:1001–1012. doi: 10.1099/0022-1317-82-5-1001. [DOI] [PubMed] [Google Scholar]
  • 29.Murphy DG. Willems B. Deschenes M. Hilzenrat N. Mousseau R. Sabbah S. Use of sequence analysis of the NS5B region for routine genotyping of hepatitis C virus with reference to C/E1 and 5′ untranslated region sequences. J Clin Microbiol. 2007;45:1102–1112. doi: 10.1128/JCM.02366-06. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Natov SN. Pereira BJ. Hepatitis C virus in chronic dialysis patients. Minerva Urol Nefrol. 2005;57:175–197. [PubMed] [Google Scholar]
  • 31.Ndjomou J. Pybus OG. Matz B. Phylogenetic analysis of hepatitis C virus isolates indicates a unique pattern of endemic infection in Cameroon. J Gen Virol. 2003;84:2333–2341. doi: 10.1099/vir.0.19240-0. [DOI] [PubMed] [Google Scholar]
  • 32.Nguyen MH. Keeffe EB. Prevalence and treatment of hepatitis C virus genotypes 4, 5, and 6. Clin Gastroenterol Hepatol. 2005;3:S97–S101. doi: 10.1016/s1542-3565(05)00711-1. [DOI] [PubMed] [Google Scholar]
  • 33.Nicot F. Legrand-Abravanel F. Sandres-Saune K, et al. Heterogeneity of hepatitis C virus genotype 4 strains circulating in south-western France. J Gen Virol. 2005;86:107–114. doi: 10.1099/vir.0.80409-0. [DOI] [PubMed] [Google Scholar]
  • 34.Patel PR. Thompson ND. Kallen AJ. Arduino MJ. Epidemiology, surveillance, and prevention of hepatitis C virus infections in hemodialysis patients. Am J Kidney Dis. 2010;56:371–378. doi: 10.1053/j.ajkd.2010.01.025. [DOI] [PubMed] [Google Scholar]
  • 35.Rahnavardi M. Hosseini Moghaddam SM. Alavian SM. Hepatitis C in hemodialysis patients: Current global magnitude, natural history, diagnostic difficulties, and preventive measures. Am J Nephrol. 2008;28:628–640. doi: 10.1159/000117573. [DOI] [PubMed] [Google Scholar]
  • 36.Ramirez S. Perez-del-Pulgar S. Carrion JA, et al. Hepatitis C virus superinfection of liver grafts: A detailed analysis of early exclusion of non-dominant virus strains. J Gen Virol. 2010;91:1183–1188. doi: 10.1099/vir.0.018929-0. [DOI] [PubMed] [Google Scholar]
  • 37.Ray SC. Ray SC. Arthur RR. Carella A. Bukh J. Thomas DL. Genetic epidemiology of hepatitis C virus throughout Egypt. J Infect Dis. 2000;182:698–707. doi: 10.1086/315786. [DOI] [PubMed] [Google Scholar]
  • 38.Saitou N. Nei M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol Biol Evol. 1987;4:406–425. doi: 10.1093/oxfordjournals.molbev.a040454. [DOI] [PubMed] [Google Scholar]
  • 39.Sandres-Saune K. Deny P. Pasquier C. Thibaut V. Duverlie G. Izopet J. Determining hepatitis C genotype by analyzing the sequence of the NS5b region. J Virol Methods. 2003;109:187–193. doi: 10.1016/s0166-0934(03)00070-3. [DOI] [PubMed] [Google Scholar]
  • 40.Schreier E. Roggendorf M. Driesel G. Höhne M. Viazov S. Genotypes of hepatitis C virus isolates from different parts of the world. Arch Virol Suppl. 1996;11:185–193. doi: 10.1007/978-3-7091-7482-1_16. [DOI] [PubMed] [Google Scholar]
  • 41.Scott JD. Gretch DR. Molecular diagnostics of hepatitis C virus infection. JAMA. 2007;297:724–732. doi: 10.1001/jama.297.7.724. [DOI] [PubMed] [Google Scholar]
  • 42.Stuyver L. van Arnhem W. Wyseur A. Hernandez F. Delaporte E. Maertens G. Classification of hepatitis C viruses based on phylogenetic analysis of the envelope 1 and nonstructural 5B regions and identification of five additional subtypes. Proc Natl Acad Sci USA. 1994;91:10134–10138. doi: 10.1073/pnas.91.21.10134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Tanaka Y. Agha S. Saudy N, et al. Exponential spread of hepatitis C virus genotype 4a in Egypt. J Mol Evol. 2004;58:191–195. doi: 10.1007/s00239-003-2541-3. [DOI] [PubMed] [Google Scholar]
  • 44.Timm J. Neukamm M. Kuntzen T, et al. Characterization of full-length hepatitis C virus genotype 4 sequences. J Virol Hepat. 2007;14:330–337. doi: 10.1111/j.1365-2893.2006.00792.x. [DOI] [PubMed] [Google Scholar]
  • 45.Tokita H. Okamoto H. Iizuka H. Kishimoto J. Tsuda F. Miyakawa Y. Mayumi M. The entire nucleotide sequences of three hepatitis C virus isolates in genetic groups 7–9 and comparison with those in the other eight genetic groups. J Gen Virol. 1998;8:1847–1857. doi: 10.1099/0022-1317-79-8-1847. [DOI] [PubMed] [Google Scholar]

Articles from Viral Immunology are provided here courtesy of SAGE Publications

RESOURCES