Skip to main content
NCBI home page
Springer logoLink to Springer
. 2012 Aug 19;5(1):63–67. doi: 10.1007/s12686-012-9734-2

Development of microsatellite markers in Robinsonia (Asteraceae) an endemic genus of the Juan Fernández Archipelago, Chile

Koji Takayama 1,✉, Patricio López Sepúlveda 1, Gudrun Kohl 1, Johannes Novak 2, Tod F Stuessy 1
PMCID: PMC3579811  PMID: 23450224

Abstract

Ten microsatellite markers were developed for Robinsonia (Asteraceae), a genus endemic to the Juan Fernández Archipelago, Chile. Polymorphisms of these markers were tested using one population each of R. evenia, R. gayana, and R. gracilis. The number of alleles for these markers ranged from 2 to 17 per locus, and expected heterozygosity ranged from 0 to 0.847 by population. A significant deviation from Hardy–Weinberg equilibrium was observed in zero to two markers in each population, and no significant linkage disequilibrium between markers was detected. The markers reported here would be useful for evolutionary studies and conservation strategies in Robinsonia.

Keywords: Genetic diversity, Oceanic islands, Pyrosequencing, Robinsonia

Oceanic islands are significant ecosystems for the conservation of global plant diversity due to their small areas and high levels of endemism in comparison with continental regions (Kier et al. 2009). Tiny population sizes and unique characteristics of insular endemic species make them particularly sensitive to anthropogenic disturbances (Frankham 1997). The Juan Fernández Archipelago is located in the Pacific Ocean 667 km west of continental Chile, and it consists of two major islands of different geological ages, Robinson Crusoe Island (4 million years old) and Alejandro Selkirk Island (1–2 million years old) (Stuessy et al. 1984). The flora of the Archipelago contains 132 endemic vascular plants (Marticorena et al. 1998), 74 % of which is regarded as “threatened” based on IUCN criteria (Ricci 2006). Biodiversity assessement in this archipelago, including population genetic study, is a pressing need as is the case with other oceanic islands (Caujape-Castells et al. 2010).

The genus Robinsonia DC. (Asteraceae) is endemic to the archipelago, and consists of eight species (Sanders et al. 1987; Danton and Perrier 2006). It should be pointed out that Pelser et al. (2007, 2010) suggested submergence of all species of Robinsonia into the large genus Senecio in order to maintain strict holophyly of the latter, which would obviate endemic generic status for Robinsonia. We do not follow this suggestion, however, as we prefer to recognize Robinsonia as generically distinct based on its striking divergence in morphological features, such as a dioecious breeding system and a rosette tree habit. Morphological and ecological divergences occur among Robinsonia species, and genetic divergence among them has also been demonstrated with isozyme and ITS markers (Crawford et al. 1992; Sang et al. 1995). In view of the estimated ages of the islands, species of Robinsonia have diversified cladogenetically within the past 4 million years (Stuessy et al. 1990). Most of the species in Robinsonia are considered to be highly threatened (Ricci 2006). In this present study, we develop microsatellite markers for investigating evolutionary processes within the genus.

We used one individual of R. masafuerae Skottsb. for isolation of microsatellites, plus one individual each of R. evenia Phil., R. gayana Decne., R. gracilis Decne., R. saxatilis Danton, and R. thurifera Decne. for cross-species amplification tests. Polymorphism of microsatellite markers was evaluated in one population each of R. evenia, R. gayana, and R. gracilis, the most common species on Robinson Crusoe Island.

Total genomic DNA was extracted from leaf tissue by the cetyltrimethylammonium bromide method (Doyle and Doyle 1987) or Qiagen DNeasy 96 Plant Kit (Qiagen, Hilden, Germany). The extracted DNA of R. masafuerae was sequenced with one-fourth of the run on 1/8 of a 70 × 75 PicoTiterPlate using a multiplex identifier in 454 Genome Sequencer FLX System (Roche Applied Science, Penzberg, Germany) of LGC Genomics (Berlin, Germany). A total of 32,468 reads with an average length of 425 bp was generated.

The design for primer pairs was conducted with QDD 2.1 (Meglécz et al. 2010) using default settings. A total of 201 unique microsatellite regions contained pure/compound dinucleotide (140 regions) and trinucleotide microsatellite sequences (61 regions) with more than five repetitions, and primer designable flanking regions were found. First, a cross-species amplification test was performed in 24 selected primer pairs (Table 1) using the Qiagen Multiplex PCR plus Kit (Qiagen, Hilden, Germany) with the 5′-tailed primer method (Boutin-Ganache et al. 2001) with CAG-tailing (5′-CAGTCGGGCGTCATCA-3′) and the PIG tailing (5′-GTTT-3′) method (Brownstein et al. 1996) following Takayama et al. (2011). We applied single-plex PCR in touchdown thermal cycling programs as follows: initial denaturation at 95 °C for 5 min, followed by first 15 cycles of denaturation at 95 °C for 30 s, annealing at 63 °C for 90 s (decreased 0.5 °C per cycle), and extension at 72 °C for 60 s; and by second 25 cycles of denaturation at 95 °C for 30 s, annealing at 55 °C for 90 s, and extension at 72 °C for 60 s; a final extension step was performed at 60 °C for 30 min. An automated sequencer (ABI 3130xl, Applied Biosystems, CA, USA) and GeneMarker (SoftGenetics LLC, PA, USA) were used for scoring of the PCR products.

Table 1.

Characteristics of 24 microsatellite markers developed in Robinsonia masafuerae

Locus Accession No. Primer sequences (5′-3′)a Repeat motif N A Length of fragments (bp)b
R. evenia R. gayana R. gracilis R. masafuerae R. saxatilis R. thurifera
RM-HD5GH* AB739985 F: [cag]TGGACAAATAATATGGGACGG (AT)7 2 123 123 123 123/125 123 123
R: [pig]TGTGTGTCTAGTGGTCCACATTC
RM-G3THW* AB739986 F: [cag]AATGGAATTCCCATCATCAAA (GAA)8 5 190/193 187 181/184 184/187 193 187/190
R: [pig]TGAAGAATACCGGTTGAAGC
RM-HCT78* AB739987 F: [cag]TCAAGCTGCTCAAAGAAAGG (ATA)11 5 213/216 210/213 216 231 213/216 210/225
R: [pig]TGGCCAAACTATGAAGTCCA
RM-HIFPY* AB739988 F: [cag]CGGTTAGCTCATCTCGGTTC (AC)8 5 126 120 120 122 120/128 120/134
R: [pig]GTGTTGTGGTAGCGATGGTG
RM-HBJ9H* AB739989 F: [cag]TTCAATTCCCTTTAGAGTTGGG (AT)7 3 202 194 194 202 192 192
R: [pig]GAATTCGTCTCTTTAGGTATCGG
RM-HJIWZ* AB739990 F: [cag]ATCCGGGTTTCCATATGTCC (TG)6 2 259 259 261 259 259/261 259
R: [pig]GAGTGGGAAAGTGTTAGAAAGCA
RM-HMDCO* AB739991 F: [cag]AGCATCACTGGTGTCAACCC (GT)9AT(GT)3AT(GT)6 10 128/130 134/140 122/144 126/136 160 140
R: [pig]CACATTTCCGTGATAAGTTAAGAGC
RM-HBZZR* AB739992 F: [cag]GTAGATGAACCCGGCTGTG (AT)6 6 195 189/203 195/201 195/197 201/207 195
R: [pig]TCCGGCGACTACTCTTTAACA
RM-HGNFW* AB739993 F: [cag]CAACAAGGACATTTCAACATTCA (GT)7 3 217 215 219 217 215 215
R: [pig]AATAGGTTGACGAGATCAAGGG
RM-HGG8M* AB739994 F: [cag]AGTATGGCAAGTTGGGTTGC (TG)7 5 290 294/296 286 290 288 288
R: [pig]TGACTGTAAGTAATGTGCAAGATGA
RM-G07PU AB739995 F: [cag]TCCGTATCATCAGGGTGTGA (TTA)8 3 129 126 126 126 123 129
R: [pig]TTTCAAGATGTAACCATTCATCA
RM-G7UI4 AB739996 F: [cag]CAAGCTATGACGTTGAGGCA (GT)11 3 127 127 129 127/130 127 127
R: [pig]TTGCATTATTTATATGGGTTGACG
RM-GSNGV AB739997 F: [cag]CATGTTCAACAAGATCAACAACA (CAA)8 4 129 123 123 129/135 126 126
R: [pig]GTGTACAATTGGTGGAATGGG
RM-HH90V AB739998 F: [cag]CAAAGTGGGTACCTAAATTGCAC (TG)7 2 165/167 165/167 165/167 165 165/167 165/167
R: [pig]TTTCAAAGTGTACCGTTCCC
RM-CO292 AB739999 F: [cag]AGAATTACACAGCCCTGCCA (AT)7 1 205 205 205 205 205 205
R: [pig]GAAGCTCCCATCGAAATTCA
RM-HE3XN AB740000 F: [cag]AAGAGAGGGTGAGATTGTGTCA (TC)9 7 119/121 133/137 119/135 117/121 × 121
R: [pig]TTTACACAACAAACAGACACCC
RM-CO472 AB740001 F: [cag]ACATGAAGCGGTTATGGGAG (CA)9 3 133 133 × 127 133/135 135
R: [pig]AGGCAGAAACAATAATCCGC
RM-G05Q6 AB740002 F: [cag]AAACAGAGGCAATGGTACGTG (TA)6 2 277 279 279 277 × ×
R: [pig]AGAATGTTACAATGGACCTCCTC
RM-G1J9T AB740003 F: [cag]CCTTGCGAGAGGTCAATTTC (TAA)8 2 133 × × 133/142 133 133
R: [pig]CAGATGATCTTGAATCGGTTATATG
RM-HA7DJ AB740004 F: [cag]ACATGTCCCTTGTTGGTCTTAG (TA)6 3 252 260 × 258 × ×
R: [pig]TTGTTACATTCTCATGCACTTGG
RM-CO442 AB740005 F: [cag]TTCAGATGGGCAAATTACACC (TA)11 1 × 178 176 × × ×
R: [pig]TTCATTTGTCACCTGATCCTTC
RM-HKUSB AB740006 F: [cag]TTCTTCTCCGGTTGATTTCG (AC)9 1 × × × × 221 221
R: [pig]TTCCTTATCCTCTTCTGTGTTCA
RM-G1L4T AB740007 F: [cag]CTCTTCGCATCTGGCATTTA (AT)10 2 × × × 124/126 × ×
R: [pig]GGAACGGACGCGTATATTGA
RM-G5RN7 AB740008 F: [cag]AACTTCGGTCCCATTGTCAC (GT)8GA(GT)9 0 × × × × × ×
R: [pig]TGTTATCCGCTACAACTTCTTTGA
Open in a new tab

N A, total number of alleles in the six species; *, ten microsatellite markers selected for the polymorphic test in Table 2; ×, amplification unsuccessful

a[cag], CAG tailing (5′-CAGTCGGGCGTCATCA-3′); [pig], GTTT tailing (5′-GTTT-3′)

bLength of fragments is shown by a single number (homozygote) or by two numbers separated by a slash (heterozygote)

Next, we selected the ten best of the 24 markers, and confirmed the polymorphism using multiple individuals of three populations, one from each of the three species (Table 2). We applied multi-plex PCR as follows: RM-HD5GH, RM-G3THW, RM-HCT78 with 6-FAM, RM-HIFPY, RM-HBJ9H, RM-HJIWZ with VIC, RM-HMDCO, RM-HBZZR with NED, RM-HGNFW, RM-HGC8M with PET. Two to 17 alleles per locus were detected in the three populations, and expected heterozygosity ranged from 0.000 to 0.847 (Table 2). A significant heterozygote deficiency was detected for zero to two markers in each population, and no significant linkage disequilibrium between markers was observed in both populations (P < 0.05, after Bonferroni correction) using GENEPOP 4.0 (Raymond and Rousset 1995). Ten microsatellite markers present easily scorable polymorphic peaks in the six species of Robinsonia, rendering these markers useful for populational genetic studies.

Table 2.

Results of ten microsatellite markers in R. evenia, R. gayana, and R. gracilis

Marker All R. evenia (n = 37) R. gayana, population 2 (n = 18) R. gracilis, population 2 (n = 29)
T A N A H O H E F IS N A H O H E F IS N A H O H E F IS
RM-HD5GH 4 1 0.000 0.000 NA 1 0.000 0.000 NA 4 0.241 0.640 0.623*
RM-G3THW 5 2 0.351 0.407 0.136 3 0.056 0.156 0.644* 2 0.483 0.485 0.005
RM-HCT78 10 6 0.595 0.589 −0.009 8 0.833 0.844 0.013 3 0.552 0.527 −0.046
RM-HIFPY 8 4 0.541 0.551 0.019 4 0.500 0.608 0.178 3 0.138 0.347 0.603*
RM-HBJ9H 5 3 0.270 0.349 0.226 2 0.278 0.313 0.113 3 0.379 0.511 0.258
RM-HJIWZ 2 1 0.000 0.000 NA 1 0.000 0.000 NA 1 0.000 0.000 NA
RM-HMDCO 17 5 0.432 0.581 0.255 10 0.944 0.847 −0.115 3 0.448 0.424 −0.058
RM-HBZZR 5 1 0.000 0.000 NA 5 0.222 0.684 0.675* 2 0.552 0.471 −0.172
RM-HGNFW 3 2 0.054 0.053 −0.028 1 0.000 0.000 NA 3 0.103 0.099 −0.042
RM-HGC8M 5 1 0.000 0.000 NA 3 0.778 0.549 −0.416 1 0.000 0.000 NA
Open in a new tab

T A, total number of alleles in the three populations; N A, total number of alleles within each population; H O, observed heterozygosity; H E, expected heterozygosity; F IS, inbreeding coefficient; NA, not applicable

*departs significantly from HWE (P < 0.05)

Acknowledgments

We are grateful to the Corporación Nacional Forestal of Chile (CONAF), the Armada de Chile, and the Departamento de Botánica, Universidad de Concepción, Chile, for supporting field research. This work was supported by a Japan Society for the Promotion of Science (JSPS) Postdoctoral Fellowship for Research Abroad, grant number 526 to KT, and the Austrian National Science Foundation (FWF), grant number P21723-B16 to TS.

Open Access

This article is distributed under the terms of the Creative Commons Attribution License which permits any use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited.

References

  1. Boutin-Ganache I, Raposo M, Raymond M, Deschepper CF. M13-tailed primers improve the readability and usability of microsatellite analyses performed with two different allele-sizing methods. Biotechniques. 2001;31:24–28. [PubMed] [Google Scholar]
  2. Brownstein MJ, Carpten JD, Smith JR. Modulation of non-templated nucleotide addition by Taq DNA polymerase: primer modifications that facilitate genotyping. Biotechniques. 1996;20:1004–1010. doi: 10.2144/96206st01. [DOI] [PubMed] [Google Scholar]
  3. Caujape-Castells J, Tye A, Crawford DJ, Santos-Guerra A, Sakai A, Beaver K, Lobin W, Florens FBV, Moura M, Jardim R, Gomes I, Kueffer C. Conservation of oceanic island floras: present and future global challenges. Perspect Plant Ecol Evol Syst. 2010;12:107–129. doi: 10.1016/j.ppees.2009.10.001. [DOI] [Google Scholar]
  4. Crawford DJ, Stuessy TF, Haines DW, Cosner MB, Silva M, Lopez P. Allozyme diversity within and divergence among four species of Robinsonia (Asteraceae, Senecioneae), a genus endemic to the Juan Fernandez Islands, Chile. Am J Bot. 1992;79:962–966. doi: 10.2307/2445008. [DOI] [Google Scholar]
  5. Danton P, Perrier C. Nouveau catalogue de la flore vasculaire del’archipel Juan Fernández. Acta Bot Gall. 2006;153:399–587. [Google Scholar]
  6. Doyle J, Doyle J. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bull. 1987;9:11–15. [Google Scholar]
  7. Frankham R. Do island populations have less genetic variation than mainland populations? Heredity. 1997;78:311–327. doi: 10.1038/hdy.1997.46. [DOI] [PubMed] [Google Scholar]
  8. Kier G, Kreft H, Lee TM, Jetz W, Ibisch PL, Nowicki C, Mutke J, Barthlott W. A global assessment of endemism and species richness across island and mainland regions. Proc Nat Acad Sci USA. 2009;106:9322–9327. doi: 10.1073/pnas.0810306106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Marticorena C, Stuessy TF, Baeza M. Catálogo de la flora vascular del Archipiélago de Juan Fernández, Chile. Gayana Bot. 1998;55:187–211. [Google Scholar]
  10. Meglécz E, Costedoat C, Dubut V, Gilles A, Malausa T, Pech N, Martin JF. QDD: a user-friendly program to select microsatellite markers and design primers from large sequencing projects. Bioinformatics. 2010;26:403–404. doi: 10.1093/bioinformatics/btp670. [DOI] [PubMed] [Google Scholar]
  11. Pelser PB, Nordenstam B, Kadereit JW, Watson LE. An ITS phylogeny of tribe Senecioneae (Asteraceae) and a new delimitation of Senecio L. Taxon. 2007;56:1077–1104. doi: 10.2307/25065905. [DOI] [Google Scholar]
  12. Pelser PB, Tepe EJ, Kennedy AH, Watson LE. The fate of Robinsonia (Asteraceae): sunk in Senecio, but still monophyletic? Phytotaxa. 2010;5:31–46. [Google Scholar]
  13. Raymond M, Rousset F. GENEPOP (version 1.2): population genetics software for exact tests and ecumenism. J Hered. 1995;86:248–249. [Google Scholar]
  14. Ricci M. Conservation status and ex situ cultivation efforts of endemic flora of the Juan Fernández Archipelago. Biodivers Conserv. 2006;15:3111–3130. doi: 10.1007/s10531-005-5404-y. [DOI] [Google Scholar]
  15. Sanders RW, Stuessy TF, Marticorena C, Silva OM. Phytogeography and evolution of Dendroseris and Robinsonia, tree-Compositae of the Juan Fernandez Islands. Opera Botanica. 1987;92:195–215. [Google Scholar]
  16. Sang T, Crawford DJ, Stuessy TF, Silva OM. ITS sequences and the phylogeny of the genus Robinsonia (Asteraceae) Syst Bot. 1995;20:55–64. doi: 10.2307/2419632. [DOI] [Google Scholar]
  17. Stuessy TF, Crawford DJ, Marticorena C. Patterns of phylogeny in the endemic vascular flora of the Juan Fernandez Islands, Chile. Syst Bot. 1990;15:338–346. doi: 10.2307/2419187. [DOI] [Google Scholar]
  18. Stuessy TF, Foland KA, Sutter JF, Sanders RW, Silva M. Botanical and geological significance of potassium-argon dates from the Juan Fernandez Islands. Science. 1984;225:49–51. doi: 10.1126/science.225.4657.49. [DOI] [PubMed] [Google Scholar]
  19. Takayama K, López P, König C, Kohl G, Novak J, Stuessy TF. A simple and cost-effective approach for microsatellite isolation in non-model plant species using small-scale 454 pyrosequencing. Taxon. 2011;60:1442–1449. [Google Scholar]

Articles from Conservation Genetics Resources are provided here courtesy of Springer

RESOURCES