Skip to main content
PLOS One logoLink to PLOS One
. 2013 Feb 25;8(2):e57537. doi: 10.1371/journal.pone.0057537

tmRNA Is Essential in Shigella flexneri

Nitya S Ramadoss 1, Xin Zhou 1, Kenneth C Keiler 1,*
Editor: Christophe Herman2
PMCID: PMC3581467  PMID: 23451240

Abstract

Nonstop mRNAs pose a challenge for bacteria, because translation cannot terminate efficiently without a stop codon. The trans-translation pathway resolves nonstop translation complexes by removing the nonstop mRNA, the incomplete protein, and the stalled ribosome. P1 co-transduction experiments demonstrated that tmRNA, a key component of the trans-translation pathway, is essential for viability in Shigella flexneri. tmRNA was previously shown to be dispensable in the closely related species Escherichia coli, because E. coli contains a backup system for trans-translation mediated by the alternative release factor ArfA. Genome sequence analysis showed that S. flexneri does not have a gene encoding ArfA. E. coli ArfA could suppress the requirement for tmRNA in S. flexneri, indicating that tmRNA is essential in S. flexneri because there is no functional backup system. These data suggest that resolution of nonstop translation complexes is required for most bacteria.

Introduction

mRNAs that lack a stop codon can originate from many events, including premature transcription termination, physical or chemical damage to a complete mRNA, or nucleolytic activity. Translation of a nonstop mRNA is problematic, because termination requires a stop codon. Release factors specifically recognize a stop codon in the ribosomal A site and promote hydrolysis of the peptidyl-tRNA, releasing the newly-synthesized protein and the ribosome [1], [2]. Eukaryotes have mRNA proofreading mechanisms to limit translation initiation on nonstop mRNAs [3]. However, bacteria lack most mRNA proofreading mechanisms and ribosomes frequently translate to the end of a nonstop mRNA [4], generating a nonstop translation complex composed of a truncated mRNA, an incomplete nascent polypeptide, and a ribosome that cannot elongate or terminate translation by the canonical reactions. These nonstop translation complexes are resolved by trans-translation, a reaction mediated by tmRNA and a small protein, SmpB [5]. tmRNA contains a tRNA-like acceptor stem and a reading frame encoding a short peptide. SmpB binds tmRNA with high affinity [6]. During trans-translation, tmRNA-SmpB recognizes the nonstop translation complex and promotes translation of the tmRNA-encoded peptide onto the end of the nascent polypeptide [7], [8]. This reaction releases the ribosome at a stop codon within tmRNA. The tmRNA-encoded peptide is recognized by several proteases, so the incomplete protein is rapidly degraded [9], [10], [11], [12]. trans-Translation also stimulates degradation of the nonstop mRNA, so all components of the nonstop translation complex are efficiently removed [13], [14].

trans-Translation occurs with high frequency in bacteria, and is found throughout the bacterial kingdom. Estimates from E. coli suggest that 2–4% of translation reactions end in trans-translation [4]. Genes encoding tmRNA (ssrA) and SmpB (smpB) have been identified in all sequenced bacterial genomes, indicating that trans-translation confers a selective advantage in all environments that can support bacterial life [15].

The abundance and ubiquity of trans-translation suggest that it is very important, and in some species ssrA and smpB are essential [16], [17], [18], [19]. However, mutants of E. coli K12 lacking trans-translation activity are viable and have only mild growth defects in typical culture conditions [20], [21]. A screen for E. coli genes that cannot be deleted in ΔssrA cells identified arfA, which encodes an alternative release factor [22]. ArfA binds nonstop translation complexes and recruits RF-2 to hydrolyze the peptidyl-tRNA, releasing the nascent polypeptide and ribosome [23], [24]. ArfA is a backup system for trans-translation, because it is only produced when trans-translation activity is limiting [25], [26]. In E. coli, arfA mRNA contains an RNase III cleavage site 5′ of the stop codon, so expression of arfA will result in a nonstop complex [25]. When trans-translation is functional, ArfA will be tagged and degraded. However, if trans-translation is limiting, the truncated but active ArfA will be released [25]. arfA genes have been found in the genome sequences of many bacteria, including most enteric gamma-proteobacteria [22], [26].

In this paper we show that ssrA is essential in S. flexneri, a human pathogen that causes acute dysentery. S. flexneri is closely related to E. coli [27]. In fact, the Shigella and Escherichia genera are phylogenetically indistinguishable [27]. S. flexneri lacks arfA, but when E. coli arfA is expressed in S. flexneri, ssrA can be deleted. These results suggest that trans-translation is essential in S. flexneri because it is the only available mechanism to resolve nonstop translation complexes.

Results and Discussion

ssrA is essential in S. flexneri

Efforts to replace ssrA in the chromosome of S. flexneri 2a 2457T with a kanamycin-resistance gene using Red-mediated recombination were not successful in wild-type cells. However, when a second copy of ssrA was provided on a plasmid (pSsrA), kanamycin-resistant colonies were recovered. Diagnostic PCR reactions confirmed that ssrA was deleted in kanamycin-resistant cells containing pSsrA (Fig. 1). These results suggested that ssrA is essential in S. flexneri.

Figure 1. ssrA is dispensible in S. flexneri when a second copy of the gene is provided.

Figure 1

Diagnostic PCR reactions were used to verify deletion of ssrA in S. flexneri ssrA::kan pSsrA. The expected product size for wild-type ssrA is 0.6 kb and for ssrA::kan is 1.7 kb. A control reaction using genomic DNA from wild-type S. flexneri and molecular weight markers with sizes in kb are indicated.

The requirement for ssrA was confirmed using a co-transduction experiment. A marker linked to the chromosomal ssrA locus was introduced into S. flexneri by transducing zfg-2003::Tn10 from a donor E. coli strain. The Tn10 insertion in zfg-2003 confers tetracycline resistance, and is located ∼0.25 minutes from ssrA. S. flexneri zfg-2003::Tn10 was then transformed with pSsrA and the chromosomal copy of ssrA was replaced with a kanamycin-resistance gene to produce S. flexneri zfg-2003::Tn10 ssrA::kan pSsrA. P1 lysates were prepared from this strain and used to measure co-transduction of ssrA::kan and zfg-2003::Tn10 into S. flexneri strains. The co-transduction frequencies were measured by selecting for tetracycline-resistant transductants and screening these transductants for kanamycin resistance. Based on the map distance between zfg-2003 and ssrA, the tetracycline-resistance gene and kanamycin-resistance gene should be co-transduced with a frequency of ∼70% if ssrA were not essential. When S. flexneri pSsrA was used as a recipient, the co-transduction frequency was 72±4%, close to the theoretical value. However, when wild-type S. flexneri with no additional copy of ssrA was used as a recipient, no kanamycin-resistant colonies were recovered from 550 tetracycline-resistant transductants. If ssrA were not essential, the probability of obtaining no co-transductants in these experiments would be (0.3)550, or ∼10−288. These results show that unlike E. coli K12, S. flexneri requires ssrA for viability.

S. flexneri strains do not have arfA

E. coli can survive without trans-translation activity because arfA is expressed in the absence of trans-translation and ArfA activity can resolve nonstop translation complexes [22], [23], [24], [25]. Deletions of ssrA and arfA in E. coli are synthetically lethal [22]. Searches of genome sequences of Shigella species using BLAST [28] revealed that arfA homologs are present in S. boydii, S. sonnei, and S. dysenteriae, but not in S. flexneri. In Escherichia and Shigella species that have arfA, the gene is encoded between mscL and zntR, 3′ of trkA. This chromosomal locus in S. flexneri strains contains an insertion element 3′ of trkA, suggesting that arfA has been deleted by genetic rearrangement (Fig. 2A).

Figure 2. arfA accounts for phenotypic differences produced by deleting ssrA in E. coli and S. flexneri.

Figure 2

(A) arfA (blue) in Escherichia coli K-12 MG1655 and the corresponding locus in Shigella flexneri 2a 2457T, aligned using EcoCyc Pathway Tools (SRI International). (B) Diagnostic PCR reactions of genomic DNA prepared from wild-type S. flexneri (lane 1), S. flexneri pCA24N-His6-ArfA (lane 2), and S. flexneri ssrA::kan pCA24N-His6-ArfA (lane 3). The expected product size for wild-type ssrA is 0.6 kb and for ssrA::kan is 1.7 kb. Molecular weight markers with sizes in kb are indicated.

E. coli ArfA can suppress the lethal phenotype of ssrA deletion in S. flexneri

Given the close phylogenetic relationship between E. coli and S. flexneri, it was surprising that the phenotypes caused by deleting ssrA were so different. However, the absence of arfA in S. flexneri suggested that the difference might be due to the absence of a backup mechanism for trans-translation in S. flexneri. To determine if E. coli ArfA could suppress the requirement for ssrA in S. flexneri, a plasmid encoding His6-ArfA from the ASKA collection (pCA24N-His6-ArfA) was transformed into S. flexneri and these cells were used as the recipient in a co-transduction experiment with P1 lysates from S. flexneri zfg-2003::Tn10 ssrA::kan pSsrA. ssrA::kan and zfg-2003::Tn10 were co-transduced into S. flexneri pCA24N-His6-ArfA with a frequency of 69±8%, indicating that ssrA is not essential in cells with pCA24N-His6-ArfA. Diagnostic PCR reactions confirmed that ssrA was deleted in the kanamycin-resistant cells (Fig. 2B). These results indicated that ArfA can suppress the requirement for ssrA in S. flexneri.

ssrA could be deleted in S. flexneri pCA24N-His6-ArfA cells even when IPTG was not added to induce arfA expression. Western blotting revealed that amount of ArfA in uninduced S. flexneri ssrA::kan pCA24N-His6-ArfA was 15–20% the amount in cells that had been induced (Fig. 3A). When S. flexneri ssrA::kan pCA24N-His6-ArfA cells were inoculated into fresh medium containing IPTG the lag phase of growth was shorter than when no IPTG was added, but the doubling time during logarithmic growth was similar (Fig. 3B). These data indicate that the amount of ArfA produced in uninduced cultures is sufficient for viability of S. flexneri in the absence of trans-translation, but higher levels of ArfA are required for optimal growth in culture.

Figure 3. ArfA is expressed in cells containing pCA24N-His6-ArfA.

Figure 3

(A) Western blots to determine the expression of ArfA in wild-type S. flexneri (lane 1), S. flexneri ssrA::kan pCA24N-His6-ArfA grown with IPTG at all times (lane 2), grown without IPTG and diluted into medium containing IPTG (lane 3), and grown without exposure to IPTG (lane 4). The amounts of ArfA relative to lane 3 are shown (n.d.: not detectable). (B) Growth of S. flexneri ssrA::kan pCA24N-His6-ArfA with IPTG (closed circles) and with no IPTG (open circles) monitored by optical density at 600 nm. Doubling times during exponential growth (80–160 min) are indicated.

The results described here suggest that all species of the Escherichia/Shigella lineage require a mechanism to resolve nonstop translation complexes. For most species in this group ssrA is not essential because ArfA acts as a backup system, but because S. flexneri does not have arfA, ssrA is essential. In other proteobacteria, such as Caulobacter crescentus, ssrA is not essential [29], but there is no ArfA homolog. Perhaps nonstop translation complexes are not as severe a challenge in these species. Alternatively, these species may have a distinct mechanism for releasing nonstop translation complexes.

Like E. coli, S. flexneri has a gene encoding ArfB (YaeJ), a second alternative release factor. Purified ArfB can release nonstop translation complexes in vitro, and multicopy expression of arfB in E. coli can suppress the synthetic lethality of ssrA and arfA deletions [30], [31]. However, endogenous arfB does not support deletion of ssrA in S. flexneri or simultaneous deletion of ssrA and arfA in E. coli [30], suggesting that it is not expressed under culture conditions even when nonstop translation complexes accumulate to lethal levels.

Materials and Methods

Bacterial strains and plasmids

All strains were grown at 37°C in lysogeny broth supplemented with 30 µg/ml kanamycin, 20 µg/ml chloramphenicol, or 12 µg/ml tetracycline as appropriate (Table 1). Transformation of plasmids into S. flexneri was performed by electroporation [32].

Table 1. Strains, plasmids and primers used in this study.

Name Description Source or reference
Strains
E. coli K-12 MG1655 Wild-type strain Gift from S. Ades
Shigella flexneri 2a 2457T Wild-type strain American Type Culture Collection
S. flexneri pSsrA Contains plasmid expressing ssrA under control of its native promoter This study
S. flexneri pSsrA pKD20 Recipient for Red-mediated replacement of ssrA This study
S. flexneri pCA24N-His6-ArfA Contains ASKA plasmid with arfA This study
E. coli BD1467 Donor E. coli strain used to transduce zfg-2003::Tn10 into S. flexneri Yale Stock Center
S. flexneri zfg-2003::Tn10 pSsrA Recipient strain for Red-mediated replacement of ssrA This study
S. flexneri zfg-2003::Tn10 ssrA::kan pSsrA Donor strain for preparing P1 lysate for co-transduction experiments This study
Plasmids
pJS14 Derivative of pBBR1MCS; chlorR [38]
pSsrA ssrA with its endogenous promoter on pJS14 This study
pKD4 Plasmid template used to generate insert for ssrA replacement [33]
pKD20 Red-recombinase expression plasmid [33]
pCA24N-His6-ArfA ASKA plasmid expressing His-tagged ArfA under control of an IPTG-inducible promoter [39]
Primers
Shi_ssrA_del-F 5′-cgacacaaatgttgccatcccattgcttaatcg aatttgagcgattgtgtaggctggagctgcttc -3′ This study
Shi_ssrA_del-R 5′-tcggatgactctggtaatcaccgatgga gaattttgatgggaattagccatggtcc -3′ This study
ssrAU_BamHI 5′-acgggatccctcttattggctatcacatc-3′ This study
ssrAL_HindIII 5′-cgtcgtaagctttaaaaggttcggatttaa -3′ This study
ssrA_KO_check-F 5′-aattattgaccagttcctcaccgcgcctc-3′ This study
ssrA_KO_check-R 5′-gttggcatcagacttcgcgggacaaattcg -3′ This study

The sequences of ssrA genes from E.coli and S. flexneri are identical. Plasmid pSsrA was made by amplifying ssrA from E. coli K-12 MG1655 using primers ssrAU_BamHI and ssrAL_HindIII, digesting the product with BamHI and HindIII, and ligating the resulting DNA into pJS14 cut with the same enzymes. Red-mediated recombination was performed using the Wanner method [33]. S. flexneri cells containing pKD20 and pSsrA were transformed with a PCR product made using primers Shi_ssrA_del-F and Shi_ssrA_del-R with plasmid pKD4 as the template. E. coli strain BD1467 was used as the donor strain to transduce zfg-2003::Tn10 mutation into S.flexneri. Plasmid pCA24N-His6-ArfA was a gift from the Ades lab, and the sequence of arfA on the plasmid was verified prior to use.

P1 transduction

P1 lysates were prepared from E. coli zfg-2003::Tn10 and S. flexneri zfg-2003::Tn10 ssrA::kan pSsrA according to published protocols [34]. For transductions, cells of the recipient strain were harvested from 1.5 ml saturated culture and resuspended in 0.75 ml P1 salts solution (10 mM CaCl2, 5 mM MgSO4). 0.1 ml cell suspension was incubated with 1, 10, or 100 µl P1 lysate for 30 min at 37°C. After incubation, 1 ml lysogeny broth and 0.2 ml 1 M sodium citrate were added and the samples grown 1 h at 37°C with aeration. Cells were harvested by centrifugation, resuspended in 50 µl lysogeny broth and grown on LB plates with the appropriate antibiotic at 37°C. The expected co-transduction frequency was calculated according to the formula [1-(d/L)]3 [35].

PCR to verify gene replacement

Replacement of ssrA in S. flexneri ssrA::kan pSsrA was verified by colony PCR using primers ssrA_KO_check-F and ssrA_KO_check-R, which flank the ssrA gene. As a control, colony PCR using the same primers was also performed on wild-type S. flexneri. To verify replacement of ssrA in S. flexneri ssrA::kan pCA24N-His6-ArfA, genomic DNA was prepared from the deletion strain [36], and used as template for PCR amplification using primers ssrA_KO_check-F and ssrA_KO_check-R. As a control, genomic DNA was prepared from wild-type S. flexneri and used as a template for PCR amplification using the same primers. The expected product size for wild-type was 681 bp, and for ssrA::kan the expected product size was 1724 bp.

ArfA expression and growth

Expression of ArfA in S. flexneri ssrA::kan pCA24N-His6-ArfA was examined under three different conditions. Saturated cultures of S. flexneri ssrA::kan pCA24N-His6-ArfA grown with or without IPTG were diluted 1∶100 into growth medium with 1 mM final concentration of IPTG, or cells were grown without any exposure to the inducing agent. As a negative control, wild-type S. flexneri without plasmid was tested. Cultures were grown to OD600 = 0.4 at 37°C, and cells were harvested by centrifugation and analyzed by Western blotting.

Growth curves were obtained by diluting saturated cultures of S. flexneri ssrA::kan pCA24N-His6-ArfA 1∶100 in growth medium with or without 1 mM IPTG at 37°C with constant shaking, and sampling cultures every 20 min to measure OD600. Points between 80 min and 160 min were fit to the single exponential function OD600 = c(ebt), where t is time, and the value for b was used as the growth rate.

Western blotting

Cell pellets were lysed by boiling in SDS sample buffer (63 mM Tris-HCl (pH 6.8), 2% SDS, 10% glycerol, 0.1% 2-mercaptoethanol, 0.0005% bromophenol blue). The samples were resolved on a 15% SDS polyacrylamide gel, blotted to PVDF membrane, and probed with 1∶5000 dilution anti-PentaHis antibody (Qiagen) [37]. Goat anti-mouse antibody (GE Healthcare) was added at 1∶5000 dilution for 1 h at room temperature prior to addition of ECF reagent and imaging with a Typhoon 9410 (GE Healthcare). The relative amounts of ArfA protein were determined by quantifying the bands using InageQuant software (GE Healthcare).

Acknowledgments

We thank Sarah Ades at Penn State for gifts of E. coli K-12 MG1655 and pCA24N-His6-ArfA.

Funding Statement

This work was supported by NIH grant GM68720. The funder had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

References

  • 1. Capecchi MR (1967) Polypeptide chain termination in vitro: isolation of a release factor. Proc Natl Acad Sci U S A 58: 1144–1151. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Scolnick E, Tompkins R, Caskey T, Nirenberg M (1968) Release factors differing in specificity for terminator codons. Proc Natl Acad Sci U S A 61: 768–774. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Doma MK, Parker R (2007) RNA quality control in eukaryotes. Cell 131: 660–668. [DOI] [PubMed] [Google Scholar]
  • 4. Ito K, Chadani Y, Nakamori K, Chiba S, Akiyama Y, et al. (2011) Nascentome analysis uncovers futile protein synthesis in Escherichia coli. PLoS One 6: e28413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Keiler KC, Ramadoss NS (2011) Bifunctional transfer-messenger RNA. Biochimie 93: 1993–1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Dulebohn DP, Cho HJ, Karzai AW (2006) Role of conserved surface amino acids in binding of SmpB protein to SsrA RNA. J Biol Chem 281: 28536–28545. [DOI] [PubMed] [Google Scholar]
  • 7. Karzai AW, Susskind MM, Sauer RT (1999) SmpB, a unique RNA-binding protein essential for the peptide-tagging activity of SsrA (tmRNA). EMBO J 18: 3793–3799. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Keiler KC, Waller PR, Sauer RT (1996) Role of a peptide tagging system in degradation of proteins synthesized from damaged messenger RNA. Science 271: 990–993. [DOI] [PubMed] [Google Scholar]
  • 9. Keiler KC, Sauer RT (1996) Sequence determinants of C-terminal substrate recognition by the Tsp protease. J Biol Chem 271: 2589–2593. [DOI] [PubMed] [Google Scholar]
  • 10. Gottesman S, Roche E, Zhou Y, Sauer RT (1998) The ClpXP and ClpAP proteases degrade proteins with carboxy-terminal peptide tails added by the SsrA-tagging system. Genes Dev 12: 1338–1347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Herman C, Thevenet D, Bouloc P, Walker GC, D'Ari R (1998) Degradation of carboxy-terminal-tagged cytoplasmic proteins by the Escherichia coli protease HflB (FtsH). Genes Dev 12: 1348–1355. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Choy JS, Aung LL, Karzai AW (2007) Lon protease degrades transfer-messenger RNA-tagged proteins. J Bacteriol 189: 6564–6571. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Yamamoto Y, Sunohara T, Jojima K, Inada T, Aiba H (2003) SsrA-mediated trans-translation plays a role in mRNA quality control by facilitating degradation of truncated mRNAs. RNA 9: 408–418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Richards J, Mehta P, Karzai AW (2006) RNase R degrades non-stop mRNAs selectively in an SmpB-tmRNA-dependent manner. Mol Microbiol 62: 1700–1712. [DOI] [PubMed] [Google Scholar]
  • 15. Gueneau de Novoa P, Williams KP (2004) The tmRNA website: reductive evolution of tmRNA in plastids and other endosymbionts. Nucleic Acids Res 32: D104–108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Akerley BJ, Rubin EJ, Novick VL, Amaya K, Judson N, et al. (2002) A genome-scale analysis for identification of genes required for growth or survival of Haemophilus influenzae. Proc Natl Acad Sci U S A 99: 966–971. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Huang C, Wolfgang MC, Withey J, Koomey M, Friedman DI (2000) Charged tmRNA but not tmRNA-mediated proteolysis is essential for Neisseria gonorrhoeae viability. EMBO J 19: 1098–1107. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Hutchison CA, Peterson SN, Gill SR, Cline RT, White O, et al. (1999) Global transposon mutagenesis and a minimal Mycoplasma genome. Science 286: 2165–2169. [DOI] [PubMed] [Google Scholar]
  • 19. Thibonnier M, Thiberge JM, De Reuse H (2008) Trans-translation in Helicobacter pylori: essentiality of ribosome rescue and requirement of protein tagging for stress resistance and competence. PLoS One 3: e3810. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Keiler KC (2007) Physiology of tmRNA: what gets tagged and why? Curr Opin Microbiol 10: 169–175. [DOI] [PubMed] [Google Scholar]
  • 21. Oh BK, Apirion D (1991) 10Sa RNA, a small stable RNA of Escherichia coli, is functional. Mol Gen Genet 229: 52–56. [DOI] [PubMed] [Google Scholar]
  • 22. Chadani Y, Ono K, Ozawa S, Takahashi Y, Takai K, et al. (2010) Ribosome rescue by Escherichia coli ArfA (YhdL) in the absence of trans-translation system. Mol Microbiol 78: 796–808. [DOI] [PubMed] [Google Scholar]
  • 23. Chadani Y, Ito K, Kutsukake K, Abo T (2012) ArfA recruits release factor 2 to rescue stalled ribosomes by peptidyl-tRNA hydrolysis in Escherichia coli. Mol Microbiol 86: 37–50. [DOI] [PubMed] [Google Scholar]
  • 24. Shimizu Y (2012) ArfA recruits RF2 into stalled ribosomes. J Mol Biol 423: 624–631. [DOI] [PubMed] [Google Scholar]
  • 25. Garza-Sanchez F, Schaub RE, Janssen BD, Hayes CS (2011) tmRNA regulates synthesis of the ArfA ribosome rescue factor. Mol Microbiol 80: 1204–1219. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Schaub RE, Poole SJ, Garza-Sanchez F, Benbow S, Hayes CS (2012) Proteobacterial ArfA peptides are synthesized from non-stop messenger RNAs. J Biol Chem 287: 29765–29775. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Wei J, Goldberg MB, Burland V, Venkatesan MM, Deng W, et al. (2003) Complete genome sequence and comparative genomics of Shigella flexneri serotype 2a strain 2457T. Infect Immun 71: 2775–2786. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Basic local alignment search tool. J Mol Biol 215: 403–410. [DOI] [PubMed] [Google Scholar]
  • 29. Keiler KC, Shapiro L (2003) TmRNA is required for correct timing of DNA replication in Caulobacter crescentus. J Bacteriol 185: 573–580. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Chadani Y, Ono K, Kutsukake K, Abo T (2011) Escherichia coli YaeJ protein mediates a novel ribosome-rescue pathway distinct from SsrA- and ArfA-mediated pathways. Mol Microbiol 80: 772–785. [DOI] [PubMed] [Google Scholar]
  • 31. Handa Y, Inaho N, Nameki N (2011) YaeJ is a novel ribosome-associated protein in Escherichia coli that can hydrolyze peptidyl-tRNA on stalled ribosomes. Nucleic Acids Res 39: 1739–1748. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Dower WJ, Miller JF, Ragsdale CW (1988) High efficiency transformation of E. coli by high voltage electroporation. Nucleic Acids Res 16: 6127–6145. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Datsenko KA, Wanner BL (2000) One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97: 6640–6645. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Thomason LC, Costantino N, Court DL (2007) E. coli genome manipulation by P1 transduction. Curr Protoc Mol Biol Chapter 1 Unit 1: 17. [DOI] [PubMed] [Google Scholar]
  • 35. Wu TT (1966) A model for three-point analysis of random general transduction. Genetics 54: 405–410. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, et al. (1994). Current Protocols in Molecular Biology. New York, NY: John Wiley & Sons Inc. [Google Scholar]
  • 37.Sambrook JF, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual, vol. I. 2nd edition. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. [Google Scholar]
  • 38. Kovach ME, Phillips RW, Elzer PH, Roop RM 2nd, Peterson KM (1994) pBBR1MCS: a broad-host-range cloning vector. Biotechniques 16: 800–802. [PubMed] [Google Scholar]
  • 39. Kitagawa M, Ara T, Arifuzzaman M, Ioka-Nakamichi T, Inamoto E, et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res 12: 291–299. [DOI] [PubMed] [Google Scholar]

Articles from PLoS ONE are provided here courtesy of PLOS

RESOURCES