Skip to main content
Proceedings of the National Academy of Sciences of the United States of America logoLink to Proceedings of the National Academy of Sciences of the United States of America
. 2013 Feb 4;110(8):2934–2939. doi: 10.1073/pnas.1222570110

Conditional inactivation of p53 in mature B cells promotes generation of nongerminal center-derived B-cell lymphomas

Monica Gostissa a,b,c, Julia M Bianco a,b,c, Daniel J Malkin a,b,c, Jeffery L Kutok d, Scott J Rodig d, Herbert C Morse III e, Craig H Bassing f, Frederick W Alt a,b,c,1
PMCID: PMC3581964  PMID: 23382223

Abstract

The p53 tumor suppressor exerts a central role in protecting cells from oncogenic transformation. Accordingly, the p53 gene is mutated in a large number of human cancers. In mice, germ-line inactivation of p53 confers strong predisposition to development of different types of malignancies, but the early onset of thymic lymphomas in the majority of the animals prevents detailed studies of tumorigenesis in other tissues. Here, we use the Cre/Lox approach to inactivate p53 in mature B cells in mice (referred to as “CP” B cells) and find that such p53 inactivation results in the routine development of IgM-positive CP peripheral B-cell lymphomas. The CP lymphomas generally appear to arise, even in mice subjected to immunization protocols to activate germinal center reaction, from naive B cells that had not undergone immunoglobulin (Ig) heavy chain gene class switching or somatic hypermutation. In contrast to thymic lymphomas that arise in p53-deficient mice, which generally lack clonal translocations, nearly all analyzed CP B-cell tumors carried clonal translocations. However, in contrast to spontaneous translocations in other mouse B-cell tumor models, CP B-cell tumor translocations were not recurrent and did not involve Ig loci. Therefore, CP tumors might provide models for human lymphomas lacking Ig translocations, such as splenic marginal zone B-cell lymphoma or Waldenstrom macroglobulinemia. Our studies indicate that deletion of p53 is sufficient to trigger transformation of mature B cells and support the notion that p53 deficiency may allow accumulation of oncogenic translocations in B cells.


The p53 tumor suppressor is a transcription factor that regulates a large array of genes involved in control of cell cycle and apoptosis (1, 2). Transactivation-independent activities of p53 have also been described, ranging from transcriptional repression (3) to cytoplasmic and mitochondrial functions (2). Levels of p53 protein are extremely low in normal conditions, but p53 becomes stabilized and activated by a variety of posttranslational modifications in cells subjected to different types of DNA damage as well as upon overexpression of oncogenes (1, 2). As a result of p53 activation, cells carrying potentially harmful lesions, such as DNA double-strand breaks (DSBs) or mutations that activate oncogenes, initiate cell cycle arrest to repair the lesion or undergo programmed cell death. Germ-line p53 mutations in humans cause Li-Fraumeni syndrome, a familial condition characterized by early onset of different tumors (4, 5). Moreover, the p53 gene is somatically mutated or deleted in a large number of human cancers, indicating that this tumor suppressor exerts its protective role against oncogenic transformation in multiple tissues (5). Targeted disruption of the p53 gene in mice, however, results in a strong predisposition for early-onset thymic lymphomas (6). A small percentage of germ-line p53-deficient mice succumb to B lineage lymphomas (7, 8), but the short lifespan of these animal resulting from thymic lymphoma prevented more detailed studies of the effects of p53 deficiency in different stages of B-cell differentiation as well as in other tissues. By using the Cre/Lox approach in mice with p53-conditional alleles (6, 9), several studies demonstrated that somatic inactivation of p53 is sufficient to promote tumor formation in some, but not all, tissues examined. Thus, for example, p53 deletion per se results in development of breast tumors (10) and osteosarcomas (11, 12), whereas development of ovarian or prostate cancers requires simultaneous deletion of other tumor suppressors (13, 14).

In humans, many B- and T-cell lymphomas are characterized by clonal translocations that usually juxtapose an oncogene to antigen receptor loci (15, 16). Translocations in progenitors of lymphoid tumors involve on one partner programmed DSBs that are generated in the context of Ig gene assembly in B cells, and T-cell receptor (TCR) assembly in T cells. This process, called V(D)J recombination, takes place in early stages of B- and T-cell differentiation and is initiated by the RAG endonuclease, formed by the products of recombination activating gene (RAG)-1 and -2. RAG introduces DSBs at target V, D, and J segments in the Ig and TCR loci, which are then joined by the classical nonhomologous DNA end-joining pathway (C-NHEJ) (16, 17). Upon antigen stimulation of mature B cells, the constant (C) region of the Ig heavy chain (IgH) molecule, which initially is encoded by the Cμ exons, can be exchanged to another heavy chain isotype, with different effector functions, by class switch recombination (CSR) (16, 17). CSR is initiated by activation-induced cytidine deaminase (AID) activity, which leads to DSBs within large repetitive sequences (S regions) that flank each set of IgH C region exons with the breaks subsequently being joined by C-NHEJ or alternative end-joining (16, 17). AID is also responsible for another Ig diversification process, somatic hypermutation (SHM), which introduces of mutations in the variable region exons, allowing the selection of B cells that produce Ig molecules with higher affinity for antigen (18, 19). SHM takes place in specialized structures, called germinal centers (GCs) that organize in peripheral lymphoid organ following antigen encounter, whereas CSR can also occur outside of the GC reaction (20).

Human B-cell lymphomas can originate at different stages of B-cell differentiation, as can be inferred by examining the pattern of Ig loci rearrangements. Many human B-cell lymphomas, such as follicular lymphomas or large B-cell lymphomas, are of GC or post-GC origin and accordingly carry switched and hypermutated IgH alleles (21). These tumors routinely harbor translocations between IgH and oncogenes such as c-myc and Bcl6, with breakpoints that can be ascribed to aberrant CSR or SHM (16, 17). Although true pre-GC lymphomas, such as mantle cell lymphoma, are relatively rare, other cases, including splenic marginal zone lymphoma (MZL) and Waldenstrom macroglobulinemia, derive from B cells that may have undergone SHM but not CSR and usually do not harbor IgH translocations (22–24).

Despite the frequency of translocations involving antigen receptor loci in human lymphomas, T-cell tumors arising in germ-line p53-null animals harbor clonal translocations only in a minority of the cases. Moreover, the observed translocations are not recurrent and do not involve TCR loci (25). When both p53 and C-NHEJ factors are deleted in the germ line or in B-lineage cells, mice invariably develop B-cell lymphomas with characteristic translocations between the IgH and the c-myc oncogene loci (16), and p53 deficiency allows accumulation of IgH/c-myc translocations in normal B cells stimulated to undergo CSR (26). To better characterize the role of p53 in B-cell lymphoma formation, given that the onset of these tumors is masked by the fast appearance of thymic lymphomas in p53-null mice, we conditionally inactivated the p53 gene in mature B cells by mean of the Cre/Lox approach.

Results

Mice with Mature B Cell–Specific Inactivation of p53 Develop B-Cell Lymphomas.

To specifically delete the p53 gene in mature B cells, we bred a previously generated p53-floxed conditional allele (p53F, Fig. 1A) (9) into the CD21-Cre background (27). Cre recombinase expression from the CD21 promoter takes place during differentiation from immature transitional B cells to mature B cells; accordingly, efficient p53 deletion was observed by Southern blotting in peripheral B cells (Fig. 1A). CD21-Cre may become nonspecifically active in the germ line; therefore, we generated our experimental cohort by crossing CD21-Cre/p53F/F males to p53F/F females. CD21-Cre/p53F/F and CD21-Cre/p53F/- offspring (collectively referred to as “CP,” with the latter deriving from nonspecific Cre-mediated deletion of one floxed p53 allele) was monitored for tumor development. Because deficiency of the histone variant H2AX does not confer tumor susceptibility (28, 29), we similarly generated a cohort of CD21-Cre/H2AXF/F or CD21-Cre/H2AXF/- mice (referred to as “CH”) as controls.

Fig. 1.

Fig. 1.

CP mice develop B-cell lymphomas. (A) Southern blot analysis demonstrating deletion of p53 gene in mature B cells. A schematic map with the position of relevant restriction sites and probes used is shown at top. Position of the bands corresponding to the wild-type (wt), floxed (fl), and deleted (del) p53 alleles is indicated. Bc-day4, purified splenic B cells cultured for 4 d with anti-CD40/IL4; Bcells, purified splenic B cells; Tcells, purified splenic T cells. (B) Kaplan-Meier curve of the CP (n = 22) and control CH (n = 17) cohorts. Curves represent total survival. (C) (Left) Example of enlarged spleen frequently observed in CP mice succumbing to B-cell lymphomas; (Right) normal control spleen.

To promote immune responses, half of the mice in each cohort were immunized by injection of sheep RBCs, according to standard protocols (30). No difference in overall survival and cause of death were observed between the nonimmunized and immunized groups (Table S1); therefore, results from the two groups are presented together. CP mice became moribund between 8 and 12 mo of age, whereas control CH mice usually lived up to 2 y of age (Fig. 1B). About 50% of CP mice succumbed to B-cell lymphomas, which likely originated in the spleen (affected in 10/10 mice and usually greatly enlarged, Fig. 1C). The tumor often involved peripheral lymph nodes (5/10 mice), and more rarely mesenteric lymph nodes (3/10 mice) and thymus (3/10 mice). Metastasis to the liver was observed in four animals. Development of B-cell lymphomas was more frequent in p53F/F than in p53F/- mice, because the latter were also susceptible to other types of cancers, likely from p53 heterozygosity (Table S1). Indeed, three CP mice of the p53F/- genotype developed thymic lymphomas and sarcomas, which are typical in p53 heterozygous mice (31). Mice 187 and 307 presented with normal spleens and tumor masses, which histologically were of mixed lymphoid and myeloid lineages; therefore, these two tumors were not analyzed further. In the CH cohort, only one mouse developed a B-cell lymphoma at 21 mo of age, and two mice died of ovarian tumors at more than 27 mo of age (Table S1).

CP B-Cell Lymphomas Are Surface IgM+ and of Pregerminal Center Origin.

Histopathologic studies of sections from CP tumor samples revealed a relatively complex picture. Tumor CP220 (Fig. 2A, Upper Left) was characterized by a nodular growth pattern and a mixed centrocytic/centroblastic population typical of murine follicular lymphomas (32). Other cases (tumors CP245 and CP569; Fig. 2A, Upper Right) showed histologic and cytologic features characteristic of murine splenic MZL (33) and were remarkably similar to MZL previously identified in mice with a conventional knockout of p53 (8) or an altered p53 exon 1 (34). Some cases had a more diffuse and aggressive phenotype, characterized by high mitotic rates (tumors CP239 and CP301; Fig. 2A, Lower Left), larger cells (tumor CP166), or anaplastic cells (tumor CP277; Fig. 2A, Lower Right). Analysis of surface marker expression by flow cytometry revealed that CP lymphomas were invariably B220+/IgM+, with most of the tumors also being Igκ+. Tumor CP301 was the only IgM+/Igλ+ case (Fig. 2B). These results suggest that CP B-cell lymphomas most likely originated from B cells that had not undergone CSR. Moreover, immunohistochemical analysis showed that a subset of the tumors were Bcl6-negative, consistent with a pre-GC origin (Table S2).

Fig. 2.

Fig. 2.

CP B-cell lymphomas are IgM+ and show features of MZL. (A) Representative histologic sections from indicated CP tumors, stained with H&E. (B) Representative FACS analysis on CP220 and CP301 tumors, using antibodies against B220 and IgM, Igκ, or Igλ, as indicated. (Left) Normal spleen sample. pLN, peripheral lymph nodes; Spl, total spleen.

To further characterize these p53-deficient B-cell tumors, we analyzed rearrangements at the IgH and Igκ loci in CP tumor DNA by Southern blotting. We first used probes hybridizing downstream of the JH region (JH4–3 probe; Fig. 3A, Left) and of the Jκ region (Jκ probe; Fig. 3A, Right), and found that all samples contained distinct, rearranged bands (Fig. 3B). These results indicated that the tumors are monoclonal with one or two non–germ-line bands (e.g., CP236, CP301) or oligoclonal with more than two non–germ-line bands (e.g., CP220, CP250) and usually originated from single cells that had undergone V(D)J recombination at both IgH and Igκ loci. We next examined the status of the Sμ region by using an Iμ probe from the JH to Cμ intron, which on an EcoRI digest recognizes a fragment that is not within the IgH V, D, or J segments and is not altered by V(D)J recombination (Fig. 3A, Left). Sμ is the donor switch region for the vast majority of IgH CSR events; therefore, detection of a rearrangement with this probe would indicate that the cell of origin of the tumor had undergone CSR. All but one (CP246) of the analyzed CP tumor samples carried germ-line, unrearranged Sμ bands (Fig. 3C), further confirming that they derive from cells that had not undergone CSR. We also analyzed SHM at the IgH locus by PCR amplification and sequencing of the region encompassing the intron between the intronic Eμ enhancer and the rearranged JH segment (Fig. 3D). None of the lymphomas analyzed except CP246 had any mutations, consistent with the notion that they arose from naive pre-GC B cells (Fig. 3D).

Fig. 3.

Fig. 3.

CP B-cell tumors harbor clonal IgH and Igκ loci rearrangements, but are not somatically hypermutated. (A) Schematic of the IgH and Igκ loci showing restriction sites and probes used for Southern blot analyses. RI, EcoRI; HIII, HinDIII. (B) Southern blot analysis of DNA from CP tumors indicated on top demonstrating clonal rearrangements in the JH (Upper) and Jκ (Lower) regions. (C) Southern blot analysis of DNA from indicated CP tumors with the Iμ probe, which detects rearrangements in the Sμ region. (B and C), probes and restriction enzyme used are indicated at the bottom of each panel. Position of the germ-line bands (gl) is shown. DNA from normal spleen was used as control. (D) Table summarizing the results of experiments to verify levels of SHM in DNA from CP tumors. The diagram on the top shows the region of the IgH locus used for PCR amplification and sequencing.

CP B-Cell Lymphomas Harbor Clonal Nonrecurrent Translocations.

B-cell lymphomas in humans and mice routinely harbor clonal translocations that involve Ig loci and different oncogenes, such as c-myc, Bcl2, or Bcl6 (16). To determine if this was also the case for CP lymphomas, we performed spectral karyotyping (SKY) on metaphase spreads from short-term tumor cell cultures. Most of the tumors showed variable degrees of aneuploidy, a characteristic associated with p53 deficiency (35). All but one of the analyzed CP lymphomas carried multiple clonal translocations that were nonrecurrent, involving different chromosomes (chr) in each tumor analyzed (Fig. 4A and Table 1). Tumor CP569 harbored reciprocal T(14;2) and T(2;14) translocations; tumor CP239 harbored T(3;1), T(4;3), and T(17;2); and tumor CP166 carried reciprocal T(1;15) and T(15;1) plus T(13;10) and T(10;9). Two tumors also harbored complex translocations: tumor CP220 had a complex translocation involving chr 8, 14, and 12 in addition to a T(2;5) and a T(17;4), whereas tumor CP277 had a complex T(5;3;5) translocation in addition to clonal T(6;19), T(4;6) and frequent T(17;10), and T(X;3). Another tumor generated outside of the experimental cohort, tumor CP752, similarly carried multiple clonal translocations including T(10;6), T(9;1), T(15;16), T(14;1), and T(11;14). Only tumor CP246 lacked any translocations that could be identified by SKY. This was also the only tumor exhibiting SHM and it developed with a shorter latency than any of the other tumors (Table S1), suggesting it may represent a different tumor type than other CP tumors.

Fig. 4.

Fig. 4.

CP B-cell tumors harbor clonal, nonrecurrent translocations that do not involve Ig loci and c-myc. (A) SKY analysis of selected CP tumors. One representative metaphase is shown. The arrows indicate chromosomes involved in clonal translocations. Detailed view of these chromosomes is presented in the panels at the side, showing DAPI, spectral, and computer-classified staining for each chromosome. (B) FISH and chromosome paint analyses on CP tumors carrying chr 12 and chr 6 translocations. Sequential hybridization with the set of probes indicated on the left was performed. Only chromosomes involved in translocations are shown, with corresponding normal (n) counterparts. The whole metaphases are presented in Fig. S1. (C) Northern blot analysis on RNA from indicated CP tumors with probes specific for c-myc (Upper) or GAPDH (Lower) as loading control. RNA from normal spleen (norm spl) and from a pro-B-cell tumor with c-myc overexpression (+ control) is included for comparison.

Table 1.

SKY and FISH analysis of CP tumors

SKY
FISH
Tumor no. Clonal tr. Nonclonal tr. IgH Igκ Igλ TCRα/δ TCRβ
220 T(2:5), T(17;4), C(8;14;12) Normal ND ND C(14;8;12) ND
277 T(4;6), T(6;19), C(5;3;5) T(17;10, TX;3) ND Normal ND ND Duplicated
166 T(15;1), T(10;9), T(13;10) T(1;15), T(10;13)
239 T(3;1), T(4;3), T(17;2)
246 No translocations
569 T(10;5), T(14;10) ND ND ND Normal ND
752 T(10;6), T(9;1), T(15;16), T(14;1), T(11;14) ND Normal Normal Normal Normal

At least 10 metaphases were analyzed per each sample. Clonal translocations (tr.) are present in more than 50% of metaphases analyzed; nonclonal translocation are present in less than 50% of metaphases analyzed. ND, not done.

Mouse models deficient for p53 and C-NHEJ or DSB-response factors usually carry translocations involving Ig loci (16). The IgH locus lies on the telomeric portion of chr 12, whereas the Igκ and Igλ loci lie on chr 6 and 16, respectively. Tumor CP220 has a complex T(8;14;12) translocation. However, the chr 12 breakpoint did not involve the IgH locus, as demonstrated by FISH analysis with IgH-flanking probes (Fig. 4B, Left, and Fig. S1A). Surprisingly, FISH analyses with probes flanking the TRCα/δ locus on chr 14 showed that the complex translocation in this B-cell tumor splits the 5′ and 3′ ends of the TCRα/δ locus, which normally rearranges during V(D)J recombination in pro-T cells. However, other translocations involving chr 14 in tumors CP569 and CP752 did not involve TCRα/δ (Fig. S1 C and D). Tumors CP277 and CP752 had translocations involving chr 6 and tumor CP752 also had a chr 16 translocation. FISH analysis with probes flanking Igκ and Igλ showed that these loci were not involved in the translocations (Fig. 4B and Fig. S1 B and D). Chr 6 also carries the TCRβ locus, which was not translocated in tumor CP752 but was partially duplicated in tumor CP277 (Fig. 4B and Fig. S1 B and D). Together, these analyses indicated that CP tumors do not carry translocations involving Ig loci.

Mouse B-cell lymphomas often rearrange or amplify the c-myc oncogene, resulting in high levels of c-myc expression that contribute to transformation (36–38). This seems not to be the case for CP lymphomas because only one tumor, CP166, had a translocation involving chr 15 that bears the c-myc locus. To confirm that c-myc overexpression was not a key factor during lymphomagenesis in CP mice, we performed Northern blotting on RNA from selected CP tumors. High levels of c-myc transcripts were not detected (Fig. 4C), indicating that other, unknown mechanisms promote transformation of CP B cells.

Discussion

Here we show that specific inactivation of the p53 tumor suppressor gene in mature B cells is sufficient to promote oncogenic transformation and results in the development of splenic mature B-cell lymphomas. By histopathologic criteria, several CP B-cell tumors resemble murine splenic marginal zone lymphomas (SMZL), with some cases showing a more aggressive phenotype consistent with diffuse large B-cell lymphomas characteristic of high-grade MZL in mouse (33). Indeed, a previous study identified the prevalent B-cell tumor in germ-line p53 knockout mice as SMZL and found progression from marginal zone hyperplasia to invasive lymphomas composed of more pleomorphic cells (8). More recently, it was found that mice with an altered first exon resulting in B cell–specific deletion of p53 also developed SMZL (34). These studies, however, were limited to histological analyses and did not examine cytological abnormalities nor determine the cellular origin of the tumors. Nonetheless, the combined results of these studies clearly indicate that, at least in mice, splenic marginal zone B cells are uniquely sensitive to the transforming effects of p53 deficiency.

We found that all CP B-cell tumors were IgM+ and that only one exhibited somatic hypermutation, indicating that their cell of origin was a mature B cell that had not passaged the germinal center or undergone CSR. Accordingly, CP tumors lacked clonal translocations involving Ig loci or the c-myc oncogene, which are believed to originate from mistakes in rejoining DSBs generated during CSR and SHM (16, 17). These results are in keeping with the fact that splenic marginal zone B cells are almost universally IgM-positive with BCRs enriched for germ-line sequences (39).

Given that half of the CP mice analyzed had been immunized to stimulate T cell–dependent immune responses, our results suggest that naive B cells are better targets for transformation induced by p53 deficiency in the absence of other deficiencies, such as C-NHEJ deficiency. Because p53-dependent responses have been shown to be reduced during the GC reaction by BCL6 (40), it is possible that other p53-independent mechanisms are operational in cells undergoing CSR and SHM to safeguard genomic stability. A previous study used mb1-Cre to delete p53 from early developing B cells and showed that this resulted in generation of tumors from multiple stages of B-cell differentiation including pro-B cells and mature B cells (41). In contrast to our results, a subset of mice from this earlier study developed IgM-negative B-cell lymphomas with S region rearrangements and T(12;15) translocations. Given that mb1-Cre–mediated deletion of p53 takes place at the progenitor B-cell stage, the precise origin of these tumors remains unclear. Moreover, the exact nature of T(12;15) translocations in tumors that derived from mb1-Cre deletion of p53 were not determined, and it is possible that they originated from V(D)J recombination breaks at the IgH locus that persisted from the pro-B-cell stage. Alternatively, lack of p53 from early B-cell development could have favored accumulation of other mutations, which in turn allowed survival of cells carrying IgH/c-myc translocations. It is also possible that development of mb1-Cre–deleted p53-deficient tumors that appear to derive from B cells undergoing CSR was influenced by other factors, including differences in the housing conditions of the experimental animals, resulting in exposure to different types of antigens, and potential differences between the genetic backgrounds of the experimental animals.

Clonal translocations, even those not involving Ig loci, were present in all but one of the CP tumors as well as in many of the IgM+ tumors from mb1-Cre–deleted p53-deficient mice (41). These translocations were not recurrent and involved different chromosomes in each tumor. Moreover, most of the tumors carried multiple, sometimes complex translocations, which that made it most unlikely that any single oncogenic event was responsible for transformation of CP B cells. Such high frequency of translocations in CP B-cell tumors may reflect a propensity of B cells to tolerate high levels of DSBs. Indeed, recent work from our laboratory suggests that translocations in activated cycling B cells are more frequent than in G1-arrested pro-B-cell lines (42, 43). However, metaphases from p53-deficient splenic B cells stimulated in vitro to undergo CSR do not show high levels of chromosomal breaks and translocations, suggesting the activity of other checkpoint mechanisms (44, 45). It is possible that splenic B cells activated in vitro are not representative of the population of B cells from which CP tumors arise in vivo. An alternative, nonexclusive explanation is that p53 deficiency in B cells allows accumulation of oncogenic translocations that occur at very low levels because of a defective apoptotic response. Indeed, a specific increase in oncogenic IgH/c-myc translocations can be detected in p53-deficient cultured splenic B cells (26). Moreover, evidence suggests that the proapoptotic functions of p53 are responsible for protecting against B-cell lymphoma development, whereas its cell-cycle arrest functions are more important for suppression of T-cell lymphomas, which lack clonal translocations (6).

Given that organization and function of primary and secondary lymphoid organs are significantly different between mice and humans, it is often difficult to compare B-cell malignancies in these species (32). Indeed, only few CP tumors closely resemble human MZL by histopathologic criteria, with most of them showing a more diffuse pattern. However, for several characteristics, CP tumors might represent a model for human SMZL or other IgM-positive human malignancies, such as Waldenstrom macroglobulinemia. First, somatic p53 inactivation is found in about 20–30% of human SMZL. Moreover, although translocations between oncogenes and Ig loci are present in most human B-cell lymphomas, splenic MZL or Waldenstrom macroglobulinemia most often lack these characteristic aberrations (22–24). These tumors usually also carry evidence of SHM (22, 23, 46), but mouse SMZLs are not hypermutated (33), again indicating an intrinsic difference between mouse and human B-cell biology. Finally, similarly to human MZL and Waldenstrom macroglobulinemia, which are slowly progressing diseases, CP tumors arise with long latencies, suggesting they may initially develop as indolent disease and become more aggressive after accumulation of additional mutations.

Materials and Methods

Generation of CP and CH Mice.

CD21-Cre, H2AXF/F, and p53F/F mice have been previously described (9, 27, 47). Because the CD21-Cre transgene deletes nonspecifically more in the female than in the male germ line, CD21-Cre/H2AXF/F or CD21-Cre/p53F/F males were crossed with H2AXF/F and p53F/F females, respectively, to generate the experimental cohorts. Mice were maintained in a pathogen-free environment. For immunization, 1 × 108 sheep RBCs resuspended in 100 µL of PBS were injected intraperitoneally; booster injections were performed every 2 wk. Induction of a robust GC reaction 10 d after immunization was confirmed in selected mice by histological examination of the spleen and by an increase in PNAhi splenic B cells according to published protocols (30). Experimental animals were monitored for tumor formation and killed for analysis when clear signs of disease appeared.

All animal experiments were performed under protocols approved by the institutional Animal Care and Use Committee of Boston Children’s Hospital (Protocol 11-11-2074R).

FACS Analysis.

Single-cell suspensions from tumor masses and control organs were stained with CyChrome (CyC)-labeled anti-mouse B220 (eBiosciences), FITC-labeled anti-mouse CD43 (BD Biosciences), and RPE-labeled anti-mouse IgM (Southern Biotech) antibodies or with CyC-labeled anti-mouse B220 (eBiosciences), FITC-labeled anti-mouse Igκ (BD Biosciences), and PE-labeled anti-mouse Igλ (BD Biosciences).

Data acquisition was performed on a FACSCalibur flow cytometer equipped with CellQuest software (Becton Dickinson). Analysis was performed with FlowJo software (Tree Star).

Histological Analysis.

Tumor tissues were fixed in 10% (vol/vol) buffered formalin and stored in 70% (vol/vol) ethanol. Paraffin-embedded tissues were sectioned and stained with H&E. Histologic diagnoses were made on the basis of established criteria (32).

Southern Blotting.

Genomic DNA isolated from tumor masses or normal control tissues were separated on 0.8% agarose gel and transferred to Zeta-Probe GT (Biorad) nylon membrane. Hybridization was performed in 50% (vol/vol) formamide/SScPE at 42 °C. The 5′ p53 probe was a 600-bp XbaI fragment upstream of p53 gene exon1 and has been described previously. The JH4–3 probe was a 1.6-kb HindIII/EcoRI fragment downstream of JH4; the Jκ probe was a 1-kb fragment downstream of Jκ5; and the Iμ probe was a 1.2-kb XbaI/PstI fragment encompassing part of the Iμ promoter. The c-myc probe used for Northern blot was generated by PCR-amplifying c-myc exon2.

Somatic Hypermutation Analysis.

The genomic region encompassing JH1 to JH4 and part of the intron downstream of JH4 was PCR-amplified from tumor DNA using degenerate oligonucleotides corresponding to the different VH families (48) as forward primers and oligonucleotides downstream of JH4 (5′AGGCTCTGAGATCCCTAGACAG3′ or 5′CCTCTCCAGTTTCGGCTGATCC3′) as reverse primers. Proofreading polymerase (iProof High-Fidelity DNA Polymerase, Biorad) was used for amplification and PCR conditions were as previously published (48). Amplification products were purified from agarose gel and submitted to sequencing. Sequences were compared with the published 129/Sv and C57/B6 sequences (accession nos. NT_114985.2 and NT_166318.1, respectively). PCR amplification and sequencing was repeated two or three times for each sample.

Metaphase Preparation, SKY, and FISH.

Tumor cell suspensions were cultured for overnight and Colcemid (KaryoMAX Colcemid Solution; GIBCO) was added at the final concentration of 50 ng/mL for 3–5 h. Metaphase spreads were prepared according to standard protocols (44). Spectral karyotyping was performed with a mouse SKY paint kit (Applied Spectral Imaging) following manufacturer’s indications. Images were acquired with BX61 Microscope (Olympus) equipped with a motorized automatic stage, a cooled-CCD camera, and an interferometer (Applied Spectral Imaging). A 63× objective was used. Analysis was performed with the HiSKY software (Applied Spectral Imaging). At least 15 metaphases per each sample were analyzed.

Supplementary Material

Supporting Information

Acknowledgments

We thank Roberto Chiarle for helpful suggestions. This work was supported by National Institutes of Health Grants 5P01CA92625 and CA098285 and a Leukemia and Lymphoma Society of America (LLS) Specialized Center of Research grant (to F.W.A.). This work was supported in part by the Intramural Research Program of the National Institutes of Health, National Institute of Allergy and Infectious Diseases (to H.C.M.). M.G. was an LLS senior fellow. C.H.B. is an LLS Scholar. F.W.A. is an investigator of the Howard Hughes Medical Institute.

Footnotes

The authors declare no conflict of interest.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1222570110/-/DCSupplemental.

References

  • 1.Vousden KH, Prives C. Blinded by the light: The growing complexity of p53. Cell. 2009;137(3):413–431. doi: 10.1016/j.cell.2009.04.037. [DOI] [PubMed] [Google Scholar]
  • 2.Brady CA, Attardi LD. p53 at a glance. J Cell Sci. 2010;123(Pt 15):2527–2532. doi: 10.1242/jcs.064501. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Böhlig L, Rother K. One function—multiple mechanisms: The manifold activities of p53 as a transcriptional repressor. J Biomed Biotechnol. 2011;2011:464916. doi: 10.1155/2011/464916. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Palmero EI, Achatz MI, Ashton-Prolla P, Olivier M, Hainaut P. Tumor protein 53 mutations and inherited cancer: Beyond Li-Fraumeni syndrome. Curr Opin Oncol. 2010;22(1):64–69. doi: 10.1097/CCO.0b013e328333bf00. [DOI] [PubMed] [Google Scholar]
  • 5.Olivier M, Hollstein M, Hainaut P. TP53 mutations in human cancers: Origins, consequences, and clinical use. Cold Spring Harb Perspect Biol. 2010;2(1):a001008. doi: 10.1101/cshperspect.a001008. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Attardi LD, Donehower LA. Probing p53 biological functions through the use of genetically engineered mouse models. Mutat Res. 2005;576(1-2):4–21. doi: 10.1016/j.mrfmmm.2004.08.022. [DOI] [PubMed] [Google Scholar]
  • 7.Donehower LA, et al. Effects of genetic background on tumorigenesis in p53-deficient mice. Mol Carcinog. 1995;14(1):16–22. doi: 10.1002/mc.2940140105. [DOI] [PubMed] [Google Scholar]
  • 8.Ward JM, et al. Splenic marginal zone B-cell and thymic T-cell lymphomas in p53-deficient mice. Lab Invest. 1999;79(1):3–14. [PubMed] [Google Scholar]
  • 9.Jonkers J, et al. Synergistic tumor suppressor activity of BRCA2 and p53 in a conditional mouse model for breast cancer. Nat Genet. 2001;29(4):418–425. doi: 10.1038/ng747. [DOI] [PubMed] [Google Scholar]
  • 10.Liu X, et al. Somatic loss of BRCA1 and p53 in mice induces mammary tumors with features of human BRCA1-mutated basal-like breast cancer. Proc Natl Acad Sci USA. 2007;104(29):12111–12116. doi: 10.1073/pnas.0702969104. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Berman SD, et al. Metastatic osteosarcoma induced by inactivation of Rb and p53 in the osteoblast lineage. Proc Natl Acad Sci USA. 2008;105(33):11851–11856. doi: 10.1073/pnas.0805462105. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Walkley CR, et al. Conditional mouse osteosarcoma, dependent on p53 loss and potentiated by loss of Rb, mimics the human disease. Genes Dev. 2008;22(12):1662–1676. doi: 10.1101/gad.1656808. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Quinn BA, et al. Induction of ovarian leiomyosarcomas in mice by conditional inactivation of Brca1 and p53. PLoS ONE. 2009;4(12):e8404. doi: 10.1371/journal.pone.0008404. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Zhou Z, et al. Synergy of p53 and Rb deficiency in a conditional mouse model for metastatic prostate cancer. Cancer Res. 2006;66(16):7889–7898. doi: 10.1158/0008-5472.CAN-06-0486. [DOI] [PubMed] [Google Scholar]
  • 15.Küppers R, Dalla-Favera R. Mechanisms of chromosomal translocations in B cell lymphomas. Oncogene. 2001;20(40):5580–5594. doi: 10.1038/sj.onc.1204640. [DOI] [PubMed] [Google Scholar]
  • 16.Gostissa M, Alt FW, Chiarle R. Mechanisms that promote and suppress chromosomal translocations in lymphocytes. Annu Rev Immunol. 2011;29:319–350. doi: 10.1146/annurev-immunol-031210-101329. [DOI] [PubMed] [Google Scholar]
  • 17.Zhang Y, et al. The role of mechanistic factors in promoting chromosomal translocations found in lymphoid and other cancers. Adv Immunol. 2010;106:93–133. doi: 10.1016/S0065-2776(10)06004-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Di Noia JM, Neuberger MS. Molecular mechanisms of antibody somatic hypermutation. Annu Rev Biochem. 2007;76:1–22. doi: 10.1146/annurev.biochem.76.061705.090740. [DOI] [PubMed] [Google Scholar]
  • 19.Maul RW, Gearhart PJ. AID and somatic hypermutation. Adv Immunol. 2010;105:159–191. doi: 10.1016/S0065-2776(10)05006-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.MacLennan ICM, et al. Extrafollicular antibody responses. Immunol Rev. 2003;194:8–18. doi: 10.1034/j.1600-065x.2003.00058.x. [DOI] [PubMed] [Google Scholar]
  • 21.Küppers R, Klein U, Hansmann ML, Rajewsky K. Cellular origin of human B-cell lymphomas. N Engl J Med. 1999;341(20):1520–1529. doi: 10.1056/NEJM199911113412007. [DOI] [PubMed] [Google Scholar]
  • 22.Issa GC, Leblebjian H, Roccaro AM, Ghobrial IM. New insights into the pathogenesis and treatment of Waldenstrom macroglobulinemia. Curr Opin Hematol. 2011;18(4):260–265. doi: 10.1097/MOH.0b013e3283474e5b. [DOI] [PubMed] [Google Scholar]
  • 23.Oscier D, Owen R, Johnson S. Splenic marginal zone lymphoma. Blood Rev. 2005;19(1):39–51. doi: 10.1016/j.blre.2004.03.002. [DOI] [PubMed] [Google Scholar]
  • 24.Traverse-Glehen A, Baseggio L, Salles G, Felman P, Berger F. Splenic marginal zone B-cell lymphoma: A distinct clinicopathological and molecular entity. Recent advances in ontogeny and classification. Curr Opin Oncol. 2011;23(5):441–448. doi: 10.1097/CCO.0b013e328349ab8d. [DOI] [PubMed] [Google Scholar]
  • 25.Liao MJ, et al. No requirement for V(D)J recombination in p53-deficient thymic lymphoma. Mol Cell Biol. 1998;18(6):3495–3501. doi: 10.1128/mcb.18.6.3495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Ramiro AR, et al. Role of genomic instability and p53 in AID-induced c-myc-Igh translocations. Nature. 2006;440(7080):105–109. doi: 10.1038/nature04495. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Kraus M, Alimzhanov MB, Rajewsky N, Rajewsky K. Survival of resting mature B lymphocytes depends on BCR signaling via the Igalpha/beta heterodimer. Cell. 2004;117(6):787–800. doi: 10.1016/j.cell.2004.05.014. [DOI] [PubMed] [Google Scholar]
  • 28.Bassing CH, et al. Histone H2AX: A dosage-dependent suppressor of oncogenic translocations and tumors. Cell. 2003;114(3):359–370. doi: 10.1016/s0092-8674(03)00566-x. [DOI] [PubMed] [Google Scholar]
  • 29.Celeste A, et al. H2AX haploinsufficiency modifies genomic stability and tumor susceptibility. Cell. 2003;114(3):371–383. doi: 10.1016/s0092-8674(03)00567-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Shinall SM, Gonzalez-Fernandez M, Noelle RJ, Waldschmidt TJ. Identification of murine germinal center B cell subsets defined by the expression of surface isotypes and differentiation antigens. J Immunol. 2000;164(11):5729–5738. doi: 10.4049/jimmunol.164.11.5729. [DOI] [PubMed] [Google Scholar]
  • 31.Jacks T, et al. Tumor spectrum analysis in p53-mutant mice. Curr Biol. 1994;4(1):1–7. doi: 10.1016/s0960-9822(00)00002-6. [DOI] [PubMed] [Google Scholar]
  • 32.Morse HC, 3rd, et al. Hematopathology subcommittee of the Mouse Models of Human Cancers Consortium Bethesda proposals for classification of lymphoid neoplasms in mice. Blood. 2002;100(1):246–258. doi: 10.1182/blood.v100.1.246. [DOI] [PubMed] [Google Scholar]
  • 33.Fredrickson TN, Lennert K, Chattopadhyay SK, Morse HC, 3rd, Hartley JW. Splenic marginal zone lymphomas of mice. Am J Pathol. 1999;154(3):805–812. doi: 10.1016/S0002-9440(10)65327-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34.Chiang YJ, Difilippantonio MJ, Tessarollo L, Morse HC, III, Hodes RJ. Exon 1 disruption alters tissue-specific expression of mouse p53 and results in selective development of B cell lymphomas. PLoS ONE. 2012;7(11):e49305. doi: 10.1371/journal.pone.0049305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Aylon Y, Oren M. p53: Guardian of ploidy. Mol Oncol. 2011;5(4):315–323. doi: 10.1016/j.molonc.2011.07.007. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Zhu C, et al. Unrepaired DNA breaks in p53-deficient cells lead to oncogenic gene amplification subsequent to translocations. Cell. 2002;109(7):811–821. doi: 10.1016/s0092-8674(02)00770-5. [DOI] [PubMed] [Google Scholar]
  • 37.Wang JH, et al. Oncogenic transformation in the absence of Xrcc4 targets peripheral B cells that have undergone editing and switching. J Exp Med. 2008;205(13):3079–3090. doi: 10.1084/jem.20082271. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38.Gostissa M, et al. Long-range oncogenic activation of Igh-c-myc translocations by the Igh 3′ regulatory region. Nature. 2009;462(7274):803–807. doi: 10.1038/nature08633. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Martin F, Kearney JF. B-cell subsets and the mature preimmune repertoire. Marginal zone and B1 B cells as part of a “natural immune memory.”. Immunol Rev. 2000;175:70–79. [PubMed] [Google Scholar]
  • 40.Phan RT, Dalla-Favera R. The BCL6 proto-oncogene suppresses p53 expression in germinal-centre B cells. Nature. 2004;432(7017):635–639. doi: 10.1038/nature03147. [DOI] [PubMed] [Google Scholar]
  • 41.Rowh MA, et al. Tp53 deletion in B lineage cells predisposes mice to lymphomas with oncogenic translocations. Oncogene. 2011;30(47):4757–4764. doi: 10.1038/onc.2011.191. [DOI] [PubMed] [Google Scholar]
  • 42.Chiarle R, et al. Genome-wide translocation sequencing reveals mechanisms of chromosome breaks and rearrangements in B cells. Cell. 2011;147(1):107–119. doi: 10.1016/j.cell.2011.07.049. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Zhang Y, et al. Spatial organization of the mouse genome and its role in recurrent chromosomal translocations. Cell. 2012;148(5):908–921. doi: 10.1016/j.cell.2012.02.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Franco S, et al. H2AX prevents DNA breaks from progressing to chromosome breaks and translocations. Mol Cell. 2006;21(2):201–214. doi: 10.1016/j.molcel.2006.01.005. [DOI] [PubMed] [Google Scholar]
  • 45.Franco S, et al. DNA-PKcs and Artemis function in the end-joining phase of immunoglobulin heavy chain class switch recombination. J Exp Med. 2008;205(3):557–564. doi: 10.1084/jem.20080044. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Hockley SL, et al. Insight into the molecular pathogenesis of hairy cell leukaemia, hairy cell leukaemia variant and splenic marginal zone lymphoma, provided by the analysis of their IGH rearrangements and somatic hypermutation patterns. Br J Haematol. 2010;148(4):666–669. doi: 10.1111/j.1365-2141.2009.07962.x. [DOI] [PubMed] [Google Scholar]
  • 47.Bassing CH, et al. Increased ionizing radiation sensitivity and genomic instability in the absence of histone H2AX. Proc Natl Acad Sci USA. 2002;99(12):8173–8178. doi: 10.1073/pnas.122228699. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48.Ehlich A, Martin V, Muller W, Rajewsky K. Analysis of the B-cell progenitor compartment at the level of single cells. Curr Biol. 1994;4(7):573–583. doi: 10.1016/s0960-9822(00)00129-9. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supporting Information

Articles from Proceedings of the National Academy of Sciences of the United States of America are provided here courtesy of National Academy of Sciences

RESOURCES