Skip to main content
NIHPA Author Manuscripts logoLink to NIHPA Author Manuscripts
. Author manuscript; available in PMC: 2013 Feb 28.
Published in final edited form as: J Bone Miner Res. 2011 Nov;26(11):2647–2655. doi: 10.1002/jbmr.481

Heterozygous inactivation of Gnas in adipose-derived mesenchymal progenitor cells enhances osteoblast differentiation and promotes heterotopic ossification

Robert J Pignolo 1,2,4, Meiqi Xu 2,4, Elizabeth Russell 1, Alec Richardson 1, Josef Kaplan 2,4, Paul C Billings 2,4, Frederick S Kaplan 1,2,4, Eileen M Shore 2,3,4
PMCID: PMC3584579  NIHMSID: NIHMS391486  PMID: 21812029

Abstract

Human genetic disorders sharing the common feature of subcutaneous heterotopic ossification (HO) are caused by heterozygous inactivating mutations in GNAS, a gene encoding multiple transcripts including two stimulatory G-proteins, the α-subunit of the stimulatory G-protein (Gsα) of adenylyl cyclase and the ‘extra-long” form of Gsα, XLαs. In one such disorder, progressive osseous heteroplasia (POH), bone formation initiates within subcutaneous fat before progressing to deeper tissues, suggesting that osteogenesis may involve abnormal differentiation of mesenchymal precursors that are present in adipose tissues. We determined by immunohistochemical analysis that GNAS protein expression is limited to Gsα in bone-lining cells and to Gsα and XLαs in osteocytes. By contrast, the GNAS proteins Gsα, XLαs, and NESP55 are detected in adipocytes and in adipose stroma. Although Gnas transcripts, as assessed by qRT-PCR, show no significant changes upon osteoblast differentiation of bone-derived precursor cells, the abundance of these transcripts is enhanced by osteoblast differentiation of adipose-derived mesenchymal progenitors. Using a mouse knockout model, we determined that heterozygous inactivation of Gnas (by disruption of the Gsα-specific exon 1) abrogates upregulation of multiple Gnas transcripts that normally occurs with osteoblast differentiation in wild-type adipose stromal cells. These transcriptional changes in Gnas+/− mice are accompanied by accelerated osteoblast differentiation of adipose stromal cells in vitro. In vivo, altered osteoblast differentiation in Gnas+/− mice manifests as subcutaneous HO by an intramembranous process. Taken together, these data suggest that Gnas is a key regulator of fate decisions in adipose-derived mesenchymal progenitor cells, specifically those that are involved in bone formation.

Keywords: GNAS/Gnas, heterotopic ossification, osteoblast differentiation, progressive osseous heteroplasia (POH), Albright hereditary osteodystrophy (AHO), pseudohypoparathyroidism (PHP), osteoma cutis (OC)

Introduction

Related genetic disorders that are associated with heterozygous inactivating mutations of GNAS include progressive osseous heteroplasia (POH), Albright hereditary osteodystrophy/pseudopseudohypoparathyroidism (AHO/PPHP), pseudohypoparathyroidism (PHP), and osteoma cutis (OC).(1–6) This spectrum of GNAS inactivation disorders has the common feature of superficial/dermal ossification with the de novo formation of islands of heterotopic bone in skin and subcutaneous fat.

Based on our previous evaluation,(7) GNAS-based disorders of HO can be broadly divided into those presenting with stable superficial bony lesions and those in which superficial lesions progress into deep connective tissue. Among the non-progressive forms are osteoma cutis, AHO/PPHP, and PHP1a/c. The progressive types of GNAS-based HO are POH and the POH-related syndromes. POH presents clinically with superficial HO that progresses to deeper tissues in the absence of multiple other AHO features and without hormone resistance. POH and progressive HO syndromes can be distinguished from other GNAS-based disorders by the single parameter of HO extension from superficial to deep tissue.

The main product of the GNAS gene is the α-subunit of the stimulatory G-protein (Gsα). However, multiple mRNAs are transcribed from different promoters at the GNAS locus and the GNAS gene locus is imprinted, showing differential mRNA expression patterns of these transcripts from maternally-inherited and paternally-inherited alleles.(5,6,8) Heterotopic ossification (HO) in POH is not limited to the dermis and subcutaneous tissues,(1,9,10) and GNAS mutations in POH patients are paternally-inherited. Therefore, the bony patches that coalesce into plaques and later progress to deeper connective tissues (including fascia, skeletal muscle, tendon and ligament) correlate progression of heterotopic ossification to inactivating mutations carried on the paternally-inherited allele, and by extension to paternal allele-specific transcripts.

In addition to Gsα, multiple transcripts are produced utilizing different GNAS promoters, including XLαs, A/B (1A in mouse), and Nesp. The imprinted GNAS gene locus shows maternal, paternal, and biallelic expression of mRNAs.(5,6,8) For example, Gsα mRNA is biallelically expressed in most tissues, but the XLαs transcript, which encodes an ‘extra-long’ form of the G-protein Gsα is only synthesized from the paternally-inherited allele. The Nesp55 transcript is maternally expressed.

Functionally, heterotrimeric G-proteins, composed of α, β, and γ subunits, couple extracellular signals from specific cell surface receptors to intracellular effectors.(5,11) G-proteins bind guanine nucleotides and are defined by the α-subunit of the complex. Gsα is ubiquitously expressed and couples multiple receptors to stimulation of adenylyl cyclase, PKC, and specific ion channels.

The tissue distribution of HO lesions in GNAS inactivation disorders such as POH suggests that pathogenesis involves abnormal differentiation of mesenchymal stem cells and/or more committed precursor cells that are present in skin, subcutaneous fat, muscle, tendon and ligament tissue. Considerable evidence supports that tissues contain multipotential progenitor cells that can give rise to osteoblasts and adipocytes.(12–18) Intramembranous bone formation occurring in subcutaneous fat in POH patients suggests a close, perhaps reciprocal, relationship between adipogenesis and osteogenesis in peripheral tissues that is perturbed in patients with this disease. Given this relationship, we sought to uncover a role for GNAS in osteoblast differentiation in adipose-derived mesenchymal progenitor cells.

Materials and Methods

Animals

Gnas+/− mice having a heterozygous deletion in exon 1(19,20) were bred as F1 SvEv × CD1 crosses maintaining the deletion on the paternal allele. Analyses were carried out on 3 month old animals unless otherwise indicated. All animal handling and protocols were approved by the University of Pennsylvania IACUC.

Isolation and culture of bone marrow stromal cells (BMSC)

Murine BMSCs were harvested from wildtype and Gnas+/− mice according to methods previously described.(21) Briefly, metaphyses were removed and bone marrow plugs expelled by insertion of a 21 gauge needle into the marrow cavity and flushing the cavity with 10 ml of α-Minimal Essential Medium (α-MEM) with nucleosides (Gibco/Invitrogen). The bone marrow cells (marrow plugs) from femurs of the same animal were collected, pooled, and dispersed by repeat pipeting before centrifugation at 300 × g for 10 minutes. The supernatant was removed and the pellet resuspended in α-MEM containing 10% fetal calf serum (FCS, Hyclone). Cells were plated at a density of two marrow plugs per 25 cm2 of tissue culture growth surface and refed every three days until confluent. Adherent cell strains were derived from individual animals, and used at passage 3 or less for all experiments. The ability of these cells to differentiate along osteogenic and adipogenic lineages was confirmed.

Isolation and culture of adipose soft tissue stromal cells (STSC)

Due to the paucity of subcutaneous fat in Gnas+/− mice, we isolated STSC from fat pads that overlie the pelvis and proximal femurs; this adipose tissue is more intimately associated with cutaneous tissue and underlying fascia than abdominal fat. Murine STSC were harvested from wildtype and Gnas+/− mice as previously described.(22) Briefly, fat pads were excised, washed in 1×PBS and minced using the double scalpel method. Minced fat tissue was digested with type II collagenase (Sigma) for 1 hour (37°C) with shaking. Following digestion, an equal volume of growth media (DMEM/F12 containing 10% FCS and antibiotics) was added and the cell suspension was filtered through a 100-µM cell strainer (BD, Falcon, Franklin Lakes, NJ, USA). Cells in the filtrate were recovered by centrifugation (300 × g, 10 minutes) and plated in growth medium containing DMEM/F12, 10% FCS and antibiotics. Adherent cell strains were established from individual animals and used at passage 3 or less for all experiments. The ability of these cells to differentiate along osteogenic and adipogenic lineages was confirmed.

Osteogenic differentiation in vitro

For osteogenic differentiation, cells were plated at a density of 10,000/cm2 and allowed to attach overnight in growth media. The following day, the cells were treated with osteogenic differentiation medium containing growth media supplemented with 100ng/ml rBMP-2 (R&D, Minneapolis MN), 10mM β-glycerophosphate and 50ug/ml ascorbic acid that was replenished every 3 days. Cells were harvested at specified time points for whole cell RNA isolation, detection of alkaline phosphatase (ALP) and detection of mineralization.

Detection of alkaline phosphatase (ALP) and mineralization

ALP activity was determined histochemically. In brief, cells were washed 3 times with ddH2O and ALP detected with BCIP/NBT-plus substrate (Moss Substrates, Pasadena, MD, USA) at 37°C for 20 minutes. For detection of mineralization, cells were washed 3 times with ddH2O and stained with 1% Alizarin Red S solution (Ricca Chemical Company, Arlington, TX, USA) for 15 minutes, washed 4 times with ddH2O (or until washes were colorless). Images were taken using Nikon Eclipse (TS100) microscope at 100X magnification.

To quantify mineralization, Alizarin Red S stained cells, from duplicate wells at each time point, were solubilized in 0.5N HCL and 5% SDS for 30 minutes and absorbance measured at 405 nm using a Bio-Rad microplate reader. Results were normalized to protein content using the BCA assay (Pierce).

Immunohistochemistry

Immunohistochemistry (IHC) was performed for the identification of Gnas-XLαs, NESP, and Gsα in bone and fat tissue using specific antisera and a horseradish peroxidase (HRP)-conjugated universal secondary antibody detection system (Lab Vision Corporation, Fremont, CA, USA) as described by the manufacturer’s instructions. Diaminobenzidine (DAB) served as the chromogen/substrate. Briefly, deparaffinized and rehydrated tissue sections were incubated with a hydrogen peroxide blocking solution for 15 minutes to reduce nonspecific staining due to endogenous peroxidase and then with pre-immune serum at a dilution of 1:100 for 30 minutes. The primary antisera was incubated with sections at a dilution of 1:100 for 1 hour. The addition of HRP-conjugated secondary antibody and DAB were performed as described by the manufacturer. All washes were performed with phosphate-buffered saline (PBS), except after chromogen/DAB substrate incubation which substituted deionized water. Sections were counterstained with hematoxylin. Antiserum against Gsα was purchased commercially (Santa Cruz). Antigenic peptides for NESP (C-KGPIPIRRH) and XLαs (C-HLRPPSPEIQAAD) were synthesized with a Cys residue at the N-Terminus. Peptides were coupled to maleimide-activated keyhole limpet hemocyanin (KLH) carrier protein (Pierce/Thermo-Fisher) following the manufactures protocol.(23) Peptide-KLH complexes were used to immunize rabbits. Antibody production was carried out by Cocalico Biologicals (Reamstown, PA). Antibody specificity was confirmed by reactivity with protein species of the estimated molecular weight on Western blotting of crude mouse pituitary lysates and by reactivity on IHC of mouse pituitary tissue sections.

Histology

Tissue samples were fixed in neutral buffered formalin, decalcified, infiltrated and embedded in paraffin, and sectioned at a thickness of 6 micrometers. Cut samples were then deparaffinized, stained with Harris hematoxylin solution and counterstained with hematoxylin and eosin (H&E) by standard procedures.

Animal Imaging

Whole-body radiographic images of the frozen or PFA fixed mice were performed with a modified FFDM system (Senographe 2000D, General Electric Medical Systems, Milwaukee, WI). The data were analyzed using ImageJ software.

RNA isolation and relative quantitative RT-PCR

RNA was isolated from day 14 cultures treated with and without osteogenic factors using the RNeasy® mini kit (Qiagen, Cat. No. 74104) according to the manufacturer’s intructions. For quantitative RT-PCR (qRT-PCR), 5µl of a 1:20 diluted cDNA and 5.0 µM of each forward and reverse primer in 25 µl of reaction volume was used for amplification of β-2 microglobulin mRNA; 5 ul of a 1:5 diluted cDNA and 6.0 µM of each forward and reverse primer in 25 µl of reaction volume was used for amplification of Gsα mRNA; 5µl of a 1:5 diluted cDNA and 7.5 µM of each forward and reverse primer in 25 µl of reaction volume was used for amplification of 1A, Nesp, and XLαs mRNAs. qPCR was performed using the ABI 7500 Fast Real Time PCR System (Applied Biosystems), Fast SYBR® Green Master Mix (Applied Biosystems, Cat. No. 4385612) and primer pairs listed in Table 1. Transcript levels normalized to β-2 microglobulin mRNA were calculated by the delta-delta method.(24) At least 3 biological replicates were performed for each Gnas transcript, with at least 4 experimental replicates per biological isolate.

Table 1.

Primer Sets Used for qPCR

Gene 5’-Forward-3’ 5’-Reverse-3’
Gsα GCGCGAGGCCAACAAAAAGAT TGCCAGACTCTCCAGCACCCAG
1A GCGTGTGAGTGCGTCTCACT GATCCTCATCTGCTTCACAATGG
Nesp CGTCCAGATTCTCCTTGTTTTCA GATCCTCATCTGCTTCACAATGG
Xlαs CGAGAGCAGAAGCGCGCA AGACTCTCCAGCACCTAGA
β2MG AGTATGGCCGAGCCCAAGA GCTTGATCACATGTCTCGATCC
ALP TGAGCGACACGGACAAGA GGCCTGGTAGTTGTTGTGAG
OC CTGACAAAGCCTTCATGTCCAA GCGGGCGAGTCTGTTCACTA
OP GCACTCCAACTGCCCAAGA TTTTGGAGCCCTGCTTTCTG
Osx ATGGCGTCCTCTCTGCTTG TGAAAGGTCAGCGTATGGCTT
Runx2 GTGCGGTGCAAACTTTCTCC AATGACTCGGTTGGTCTCGG
GAPDH CAAGGTCATCCATGACAACTTTG- GGCCATCCACAGTCTTCTGG

For other experiments, RNA was isolated at specified time points using TRIzol® Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. For quantitative RT-PCR (q RT-PCR), 2.5µl of a 1:10 diluted cDNA and 5.0 µM of each forward and reverse primer in 12.5 µl final reaction volume was used for amplification of Alkaline Phosphatase (ALP), Osteocalcin (OC) and Osteopontin (OP), osterix (Osx), and Runx2 mRNA. qPCR was performed using the ABI 7500 Fast Real Time PCR System, (Applied Biosystems), Fast SYBR® Green Master Mix (Applied Biosystems, Cat. No. 4385612) and primer pairs listed in Table 1. Transcript levels normalized to GAPDH mRNA were used to calculate relative changes in mRNA expression. At least 3 biological replicates were performed for each Gnas transcript, with 3 experimental replicates per biological isolate.

BrdU labeling

STSCs (passage 2) were seeded in duplicate into a 24-well plate with cover slips at a density of 0.75×104 cells per well. The following day, BrdU was added (diluted 1:100) and incubated in normal growth media for 16 hours. Cells were fixed in 4% paraformaldehyde for 30 minutes and washed 3 times with wash buffer (0.1M PBS, pH 7.4 with 1% TritonX100). Following washes, cells were incubated in HCl (1N) for 10 minutes on ice followed by incubation with HCl (2N) for 10 minutes at room temperature and then at 37°C for 20 minutes. Immediately after acid washes, cells were buffered with the addition of Borate buffer (0.1M) for 12 min and washed 3 times with wash buffer. Cells were blocked in goat serum (0.1M PBS, pH 7.4 + Triton X-100 + Glycine (1M) +5% normal goat serum) for 1 hr. Following 2 washes in PBS, mouse anti-BrdU (Alexa Fluor® 488 conjugate) diluted 1:400 was added and incubated for 2 hours at room temperature in the dark. After incubation with BrdU antibody, DAPI was added for 5 minutes for the detection of nuclear staining, washed twice with PBS and cover slips mounted on slides using Flouromount-G (SouthernBiotech, Birmingham, AL) and fluorescence visualized using a Nikon Eclipse 90i microscope. STSCs isolated from three wild-type and three Gnas+/− mice were separately plated in duplicate. Percent BrdU incorporation was calculated as BrdU-positive cells/DAPI-positive cells × 100. At least 100 DAPI-positive cells were scored per cover slip.

Statistical Analysis

The t test (Student’s t test; two-sided and paired) was used to determine whether the mean value for relative Gnas transcript expression in cells with osteoblast differentiation differed significantly from that in cells without osteoblast differentiation. Similarly, the Student’s t test (two-sided and paired) was used to determine whether the mean value for transcript levels of osteogenic markers, BrdU incorporation, or quantitative mineralization of cells derived from Gnas+/− mice differed significantly from wild-type cells.

Results

Gnas is a complex genetic locus that encodes multiple transcripts. In most cells, Gsα is biallelically expressed, while other transcripts show a parent-of-origin dependent imprinted pattern of transcript expression. XLαs, Nespas, and 1A are specifically expressed from the paternally-inherited allele, while Nesp is only expressed from the maternally-inherited allele.(5,6,8,25)

To initiate investigation of potential roles of the protein products encoded by the Gnas gene (Gsα, XLαs, Nesp55) in bone and adipose tissue, we detected these proteins by immunohistochemistry. We found that the major protein product of Gnas, Gsα, is expressed in bone-lining cells and osteocytes (Figure 1). The XLαs protein is also expressed in osteocytes, but not bone-lining cells. Nesp55 is undetectable in osteocytes and bone-lining cells (Figure 1). In contrast, all three Gnas proteins are expressed in adipocytes and in adipose stroma (Figure 1).

Figure 1.

Figure 1

Detection of Gnas protein products (Gsα, XLαs, Nesp) in bone and fat tissue from wild-type mice by immunohistochemical analysis. Arrowheads, bone-lining cells; arrows, osteocytes.

Heterotopic bone formation initiates within subcutaneous fat in patients with POH,(9,26) suggesting that osteogenesis involves abnormal differentiation of adipose mesenchymal stem cells and/or more committed soft tissue stromal cells (STSCs) present in peripheral tissues such as fat. We therefore isolated murine STSCs from adipose tissue and bone marrow MSCs, two well-characterized osteogenic cell systems, in order to examine the expression of Gnas transcripts during osteoblast differentiation from these mesenchymal precursor cells.

Using qRT-PCR, we found no significant changes in any Gnas transcript upon osteoblast differentiation of mesenchymal precursor cells derived from wild-type bone marrow (Figure 2A). However, the abundance of 1A, Nesp, and XLαs transcripts are statistically significantly enhanced with osteoblast differentiation in wild-type STSC (Figure 2B). The transcript for Gsα showed a statistically non-significant trend toward greater expression with osteoblast differentiation (Figure 2B). By contrast, heterozygous inactivation of the Gsα transcript-specific exon 1 in Gnas abrogated the upregulation of multiple Gnas transcripts in STSC compared to wild-type animals (Figure 2B).

Figure 2.

Figure 2

Figure 2

Expression of Gnas transcripts in (A) bone marrow stromal cells (BMSC) and in (B) adipocyte soft tissue stromal cells (STSC). Specific Gnas transcripts were quantified by qRT-PCR after 14 days in culture in the presence or absence of osteogenic differentiation factors. Relative expression of each transcript was normalized to day 1 levels. Ob, osteoblast.

The transcriptional changes in Gnas+/− mice are accompanied by accelerated osteoblast differentiation of STSC by day 20 as measured by the accumulation of mineralized matrix (Figure 3). No differences in alkaline phosphatase (ALP) expression throughout the 20 day time course were detected (data not shown). Although ALP expression precedes mineralization in our culture system, there is also an overlap of the two which potentially could obscure differences in ALP (since ALP-expressing STSCs from Gnas+/− mice mineralize more quickly). In support of this possibility, ALP transcript expression is increased in Gnas+/− mice compared to wild-type (Figure 4). To test if increased expression of matrix proteins may be facilitating mineralization, we also evaluated other osteogenic markers and found that osteocalcin and osteopontin transcripts are up-regulated in Gnas+/− mice (Figure 4). No differences in early markers, including Runx2 and Osterix, were detected between Gnas+/− and wild-type cells (data not shown). To determine whether enhanced mineralization is a result of recruitment of a greater number of precursor cells, we determined cell proliferation rates of wild-type and Gnas+/− cells; however, we did not detect any differences in STSC proliferative potential by BrdU pulse labeling (% BrdU+ wild-type STSCs, 65.1 ± 7.4%; %BrdU+ Gnas+/− STSCs, 56.2 ± 2.2%; p= 0.16).

Figure 3.

Figure 3

Accelerated osteoblast differentiation of adipocyte soft tissue stromal cells (STSC) from Gnas+/− mice compared to wild-type (WT) animals. (A) Mineralization of wild-type and Gnas+/− STSC cultures by Alizarin Red S staining on day 20. (B) Quantification of mineralization at days 9, 17, and 20 during osteoblast differentiation in WT and Gnas+/− STSC cultures. *, statistically significant (p < 0.05)

Figure 4.

Figure 4

Expression of osteogenic markers during differentiation of STSCs derived from wild-type and Gnas+/− mice. Expression of (A) alkaline phosphatase (ALP), (B)osteopontin (OP), and (C) osteocalcin (OC) mRNAs were quantified by RT-PCR. Transcript levels were normalized to GAPDH mRNA. Relative expression of the indicated transcripts was compared between genotypes. *, statistically significant (p < 0.05)

In vivo, altered osteoblast differentiation in Gnas+/− mice manifests phenotypically as subcutaneous HO that is detected by 9 months of age (Figure 5A–B, D). No HO was detected in wild-type mice. The presence of bony spicules in fibroproliferative tissue, in the absence of cartilaginous elements, suggests that the ectopic ossification occurs through an intramembranous process (Figure 5C). In contrast to POH patients, but similarly to AHO/PHP patients, observation of Gnas+/− mice up to 24 months of age revealed no progression of HO to deeper connective tissues, such as fascia, skeletal muscle, tendon and ligament. The appearance of heterotopic bone in the context of adjacent adipocytes is illustrated in Figure 5C.

Figure 5.

Figure 5

Gnas+/− mice develop subcutaneous heterotopic ossification. (A) X-ray showing subcutaneous ossification in a 12 month old Gnas+/− male mouse. (B) Area of interest from (A) at higher magnification. White arrowheads indicate sites of heterotopic ossification. (C) Hematoxylin & Eosin staining of a histological section showing intramembranous ossification. Note the appearance of heterotopic bone in the context of adjacent adipocytes. (D) Onset of heterotopic ossification (HO) with age. Male Gnas+/− mice were euthanized and imaged at the ages indicated (3–24 months). Numbers of unaffected animals are indicated by grey bars and mice with HO by black bars. By 12 months of age, all Gnas+/− mice demonstrate HO. B, bone, F, fat.

Discussion

Here we have demonstrated that Gnas transcripts in cells from wild-type mice show no significant changes upon osteoblast differentiation of bone marrow stromal cells, but are upregulated with osteoblast differentiation of adipose mesenchymal progenitor cells. In contrast, heterozygous inactivation of Gnas results in dysregulation and decreased expression of multiple Gnas transcripts during osteoblast differentiation of soft tissue (adipose) stromal cells. These transcriptional changes in cells from Gnas+/− mice are correlated with accelerated osteoblast differentiation in vitro. By 9 months of age, aberrant osteoblast differentiation in Gnas+/− mice results in the formation of subcutaneous HO. These findings suggest that the formation of HO in genetic disorders that are associated with heterozygous inactivating mutations of GNAS, including progressive osseous heteroplasia (POH), Albright hereditary osteodystrophy (AHO), pseudohypoparathyroidism (PHP), and osteoma cutis (OC), is the result of decreased GNAS/Gnas expression.

Gnas knockout mice used in this study have a heterozygous deletion of exon 1 (homozygous knockouts are not viable) which is predicted to only affect the Gsα transcript.(19,20) This knockout mouse line forms subcutaneous heterotopic bone(27) as shown in Figure 5. Thus in addition to providing an in vivo model for HO, these Gnas knockout mice are a source of multiple cell types that can be examined ex vivo and tested for cell differentiation capabilities. Given that HO formation in POH and in the Gnas knockout mice appears to be initiated in subcutaneous adipose tissue, our current studies use adipose-derived stromal cells that allow investigation of stem cells from adult/post-natal tissue that may be relevant to heterotopic bone induction.

The GNAS gene is transcriptionally complex, initiating mRNA synthesis from multiple promoters and unique first exons that splice into common exons 2–13.(5,11) The most abundant product of the GNAS gene is Gsα mRNA, which is biallelically expressed in most tissues. However, other GNAS transcripts are imprinted (showing parent-of-origin mono-allelic expression).(28–30) The GNAS Nesp55 transcript is maternally expressed, and the GNAS-XLαs and -1A transcripts are paternally expressed. Our data show that statistically significant increases in Gnas-XLαs and -1A transcripts occur with osteoblast differentiation in wild-type but not Gnas+/− derived adipose stromal cells. This suggests that the clinical effects of GNAS inactivating mutations in patients is not solely dependent on the level of Gsα expression but may be influenced by the expression levels of other GNAS transcripts. Studies from other investigators(31) have shown that XLαs, like Gsα, activates cAMP signaling, suggesting that paternally-inherited mutations may result in a larger deficit of cAMP signaling (due to reduction of Gsα plus the absence of XLαs) compared to maternally-inherited mutations (which do not affect expression of XLαs). The roles of Nesp and 1A are less clear, but given its low transcript abundance it is likely that Nesp plays a minor, if any, role in bone.

The differences in Gnas transcript levels between adipose and bone tissues may be related to their responses to differentiation; in fat, transcript levels are up-regulated with osteoblast differentiation; in bone, they are essentially unchanged. This may be related to the role of Gnas in preventing bone formation in tissues where bone should not form. Thus, reduction of Gsα (and cAMP signaling) could mediate the formation of superficial HO, but a further deficit of cAMP signaling, perhaps by inactivation of XLαs, may be required for more progressive HO to occur (Figure 6). This possibility could explain why POH and progressive HO syndromes are at the severe end of a phenotypic spectrum of GNAS-inactivating conditions associated with extra-skeletal ossification.(7)

Figure 6.

Figure 6

Possible mechanisms of heterotopic bone formation regulated by GNAS/Gnas. In tissues where bone doses not ordinarily form, Gnas may have a role in preventing extra-skeletal ossification in wild-type animals. Reduction in Gsα (and cAMP signaling) could promote superficial bone formation as seen in Gnas+/− mice. In POH, where progressive heterotopic ossification occurs, a further deficit in cAMP signaling may be required, perhaps by inactivation of XLαs.

We previously defined a set of clinical characteristics that serve as minimum diagnostic criteria for POH.(7) POH can be distinguished from other GNAS-based disorders of heterotopic ossification (HO) by the presence of superficial HO that progresses to deeper tissues in the absence of multiple other features of Albright’s Hereditary Osteodystrophy (AHO) and without hormone resistance.(7) It is important to note in the context of clinical HO that the exon 1 deletion in Gnas+/− mice results in only superficial (subcutaneous) HO that does not progress into deeper tissues and to date no exon 1 mutations have been found in POH patients.(4) Since the exon 1 deletion in Gnas+/− mice reduces basal expression of all Gnas transcripts except XLαs, it is interesting to speculate that preservation of XLαs mRNA levels prevents progression of HO in these mice (Figure 6).(7,32,33)

We are intrigued by the unexpected observation that dysregulation of multiple Gnas transcripts occur in response to Gnas exon 1 disruption. One possibility is that there is coordinated regulation of other Gnas transcripts with Gsα expression, although this is purely speculative. In support of such a possibility, an imprinting control region has been identified in the Gnas cluster that affects the expression of multiple transcripts.(34) In this case, a paternally-derived deletion of the germline differentially methylated region was associated with the antisense Nespas transcript; however, a point mutation in exon 6 has also been described that causes diverse phenotypes depending on whether the mutation is maternally or paternally transmitted.(35) It is thus possible that the heterozygous deletion in exon 1 eliminates a control region that also affects expression of other Gnas transcripts.

Although the specific cell targets of heterotopic ossification in genetic conditions such as POH are unknown, investigation of enhanced osteogenic potential of osteoblast/adipocyte progenitors (such as soft-tissue stromal cells) with inactivating Gnas mutations may have direct implications for understanding heterotopic ossification and its progression. Adipocyte STSC strains derived from individual Gnas mutant mice show an enhanced osteogenic potential compared to wild-type cells, which in vivo is demonstrated as subcutaneous HO that becomes more prevalent with increasing age. Heterotopic ossification in Gnas+/− mice could proceed by recruitment of a greater number of precursor cells, by the greater predisposition of precursor cells toward an osteoblastic phenotype (i.e., lineage switching between adipogenic and osteogenic fates), or by up-regulation of matrix proteins necessary for mineralization to occur. Our data support the latter two possibilities, since ossification in vivo tends to occur in the context of adjacent adipocytes and later markers of osteogenesis are up-regulated during differentiation of Gnas+/− derived adipose stromal cells in vitro.

Taken together, these data support the concept that Gnas is a key factor in the regulation of cell fate decisions, particularly those that are involved in bone formation. The role of GNAS inactivation in POH and similar genetic conditions may be related to downstream cAMP signaling and regulation of lineage switching between osteoblast and adipocyte fates. Maternal vs. paternal inheritance of GNAS mutations affect the phenotypic consequences in patients and our current study confirms the hypothesis that altered GNAS/Gnas expression affects the regulation of osteoblast differentiation. We propose that in POH and related GNAS inactivation disorders, HO results from decreased GNAS/Gnas expression to promote osteogenesis and suppress adipogenesis in multipotent connective tissue progenitor cells.

Acknowledgements

The authors wish to acknowledge Deyu Zhang and Kevin P. Egan for excellent technical assistance, Salin Chakkalakal and Andrew Maidment for whole-body radiographic imaging, and Michael Levine and Emily Germain-Lee for the generous gift of Gnas+/− mice. This work was supported by the National Institutes of Health R01-AR046831 (EMS, RJP), the John A. Hartford Foundation (RJP), the Progressive Osseous Heteroplasia Association (POHA), the Italian POH Association, the International Fibrodysplasia Ossificans Progressiva Association (IFOPA), the University of Pennsylvania Center for Research in FOP and Related Disorders, the Penn Center for Musculoskeletal Disorders, and the Isaac and Rose Nassau Professorship of Orthopaedic Molecular Medicine (FSK).

Footnotes

Disclosures

The authors indicate no potential conflicts of interest.

Author contributions are as follows: conception and design (RJP, EMS), acquisition of data (RJP, MX, ER, AR, JK, PCB), analysis and interpretation of data (RJP, EMS, FSK), manuscript drafting/revising (RJP, JK, EMS, FSK), and approval of the final version of the submitted manuscript (all authors).

References

  • 1.Shore EM, Ahn J, Jan de Beur S, Li M, Xu M, Gardner RJ, Zasloff MA, Whyte MP, Levine MA, Kaplan FS. Paternally inherited inactivating mutations of the GNAS1 gene in progressive osseous heteroplasia. N Engl J Med. 2002;346:99–106. doi: 10.1056/NEJMoa011262. [DOI] [PubMed] [Google Scholar]
  • 2.Bastepe M, Juppner H. GNAS locus and pseudohypoparathyroidism. Horm Res. 2005;63:65–74. doi: 10.1159/000083895. [DOI] [PubMed] [Google Scholar]
  • 3.Farfel Z, Bourne HR, Iiri T. The expanding spectrum of G protein diseases. N Engl J Med. 1999;340:1012–1020. doi: 10.1056/NEJM199904013401306. [DOI] [PubMed] [Google Scholar]
  • 4.Kumagai K, Motomura K, Egashira M, Tomita M, Suzuki M, Uetani M, Shindo H. A case of progressive osseous heteroplasia: a first case in Japan. Skeletal Radiol. 2008;37:563–567. doi: 10.1007/s00256-008-0469-9. [DOI] [PubMed] [Google Scholar]
  • 5.Plagge A, Kelsey G, Germain-Lee EL. Physiological functions of the imprinted Gnas locus and its protein variants Galpha(s) and XLalpha(s) in human and mouse. J Endocrinol. 2008;196:193–214. doi: 10.1677/JOE-07-0544. [DOI] [PubMed] [Google Scholar]
  • 6.Weinstein LS, Chen M, Xie T, Liu J. Genetic diseases associated with heterotrimeric G proteins. Trends Pharmacol Sci. 2006;27:260–266. doi: 10.1016/j.tips.2006.03.005. [DOI] [PubMed] [Google Scholar]
  • 7.Adegbite NS, Xu M, Kaplan FS, Shore EM, Pignolo RJ. Diagnostic and mutational spectrum of progressive osseous heteroplasia (POH) and other forms of GNAS-based heterotopic ossification. Am J Med Genet A. 2008;146A:1788–1796. doi: 10.1002/ajmg.a.32346. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Weinstein LS, Xie T, Zhang QH, Chen M. Studies of the regulation and function of the Gs alpha gene Gnas using gene targeting technology. Pharmacol Ther. 2007;115:271–291. doi: 10.1016/j.pharmthera.2007.03.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Kaplan FS, Shore EM. Progressive osseous heteroplasia. J Bone Miner Res. 2000;15:2084–2094. doi: 10.1359/jbmr.2000.15.11.2084. [DOI] [PubMed] [Google Scholar]
  • 10.Kaplan FS, Craver R, MacEwen GD, Gannon FH, Finkel G, Hahn G, Tabas J, Gardner RJ, Zasloff MA. Progressive osseous heteroplasia: a distinct developmental disorder of heterotopic ossification. Two new case reports and follow-up of three previously reported cases. J Bone Joint Surg Am. 1994;76:425–436. [PubMed] [Google Scholar]
  • 11.Weinstein LS, Yu S, Warner DR, Liu J. Endocrine manifestations of stimulatory G protein alpha-subunit mutations and the role of genomic imprinting. Endocr Rev. 2001;22:675–705. doi: 10.1210/edrv.22.5.0439. [DOI] [PubMed] [Google Scholar]
  • 12.Ahdjoudj S, Lasmoles F, Oyajobi BO, Lomri A, Delannoy P, Marie PJ. Reciprocal control of osteoblast/chondroblast and osteoblast/adipocyte differentiation of multipotential clonal human marrow stromal F/STRO-1(+) cells. J Cell Biochem. 2001;81:23–38. doi: 10.1002/1097-4644(20010401)81:1<23::aid-jcb1021>3.0.co;2-h. [DOI] [PubMed] [Google Scholar]
  • 13.Davis LA, Zur Nieden NI. Mesodermal fate decisions of a stem cell: the Wnt switch. Cell Mol Life Sci. 2008;65:2658–2674. doi: 10.1007/s00018-008-8042-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Gori F, Thomas T, Hicok KC, Spelsberg TC, Riggs BL. Differentiation of human marrow stromal precursor cells: bone morphogenetic protein-2 increases OSF2/CBFA1, enhances osteoblast commitment, and inhibits late adipocyte maturation. J Bone Miner Res. 1999;14:1522–1535. doi: 10.1359/jbmr.1999.14.9.1522. [DOI] [PubMed] [Google Scholar]
  • 15.Nuttall ME, Patton AJ, Olivera DL, Nadeau DP, Gowen M. Human trabecular bone cells are able to express both osteoblastic and adipocytic phenotype: implications for osteopenic disorders. J Bone Miner Res. 1998;13:371–382. doi: 10.1359/jbmr.1998.13.3.371. [DOI] [PubMed] [Google Scholar]
  • 16.Nuttall ME, Gimble JM. Is there a therapeutic opportunity to either prevent or treat osteopenic disorders by inhibiting marrow adipogenesis? Bone. 2000;27:177–184. doi: 10.1016/s8756-3282(00)00317-3. [DOI] [PubMed] [Google Scholar]
  • 17.Sabatakos G, Sims NA, Chen J, Aoki K, Kelz MB, Amling M, Bouali Y, Mukhopadhyay K, Ford K, Nestler EJ, Baron R. Overexpression of DeltaFosB transcription factor(s) increases bone formation and inhibits adipogenesis. Nat Med. 2000;6:985–990. doi: 10.1038/79683. [DOI] [PubMed] [Google Scholar]
  • 18.Spinella-Jaegle S, Rawadi G, Kawai S, Gallea S, Faucheu C, Mollat P, Courtois B, Bergaud B, Ramez V, Blanchet AM, Adelmant G, Baron R, Roman-Roman S. Sonic hedgehog increases the commitment of pluripotent mesenchymal cells into the osteoblastic lineage and abolishes adipocytic differentiation. J Cell Sci. 2001;114:2085–2094. doi: 10.1242/jcs.114.11.2085. [DOI] [PubMed] [Google Scholar]
  • 19.Schwindinger WF, Reese KJ, Lawler AM, Gearhart JD, Levine MA. Targeted disruption of Gnas in embryonic stem cells. Endocrinology. 1997;138:4058–4063. doi: 10.1210/endo.138.10.5439. [DOI] [PubMed] [Google Scholar]
  • 20.Germain-Lee EL, Schwindinger W, Crane JL, Zewdu R, Zweifel LS, Wand G, Huso DL, Saji M, Ringel MD, Levine MA. A mouse model of albright hereditary osteodystrophy generated by targeted disruption of exon 1 of the Gnas gene. Endocrinology. 2005;146:4697–4709. doi: 10.1210/en.2005-0681. [DOI] [PubMed] [Google Scholar]
  • 21.Pignolo RJ, Suda RK, McMillan EA, Shen J, Lee SH, Choi Y, Wright AC, Johnson FB. Defects in telomere maintenance molecules impair osteoblast differentiation and promote osteoporosis. Aging Cell. 2008;7:23–31. doi: 10.1111/j.1474-9726.2007.00350.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Yu G, Wu X, Kilroy G, Halvorsen YD, Gimble JM, Floyd ZE. Isolation of murine adipose-derived stem cells. Methods Mol Biol. 2011;702:29–36. doi: 10.1007/978-1-61737-960-4_3. [DOI] [PubMed] [Google Scholar]
  • 23.Billings PC, Herrick DJ, Howard PS, Kucich U, Engelsberg BN, Rosenbloom J. Expression of betaig-h3 by human bronchial smooth muscle cells: localization To the extracellular matrix and nucleus. Am J Respir Cell Mol Biol. 2000;22:352–359. doi: 10.1165/ajrcmb.22.3.3732. [DOI] [PubMed] [Google Scholar]
  • 24.Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001;29:e45. doi: 10.1093/nar/29.9.e45. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25.Plagge A, Isles AR, Gordon E, Humby T, Dean W, Gritsch S, Fischer-Colbrie R, Wilkinson LS, Kelsey G. Imprinted Nesp55 influences behavioral reactivity to novel environments. Mol Cell Biol. 2005;25:3019–3026. doi: 10.1128/MCB.25.8.3019-3026.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Shore EM, Kaplan FS. Inherited human diseases of heterotopic bone formation. Nat Rev Rheumatol. 2010;6:518–527. doi: 10.1038/nrrheum.2010.122. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Huso DL, McGuire S, Germain-Lee EL. Heterotopic subcutaneous ossifications in a mouse model of Albright hereditary osteodystrophy; 89th Annual Meeting of The Endocrine Society; 2007. abstract P4–90. [Google Scholar]
  • 28.Hayward BE, Moran V, Strain L, Bonthron DT. Bidirectional imprinting of a single gene: GNAS1 encodes maternally, paternally, and biallelically derived proteins. Proc Natl Acad Sci U S A. 1998;95:15475–15480. doi: 10.1073/pnas.95.26.15475. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29.Hayward BE, Kamiya M, Strain L, Moran V, Campbell R, Hayashizaki Y, Bonthron DT. The human GNAS1 gene is imprinted and encodes distinct paternally and biallelically expressed G proteins. Proc Natl Acad Sci U S A. 1998;95:10038–10043. doi: 10.1073/pnas.95.17.10038. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30.Lebrun M, Richard N, Abeguile G, David A, Coeslier Dieux A, Journel H, Lacombe D, Pinto G, Odent S, Salles JP, Taieb A, Gandon-Laloum S, Kottler ML. Progressive osseous heteroplasia: a model for the imprinting effects of GNAS inactivating mutations in humans. J Clin Endocrinol Metab. 2010;95:3028–3038. doi: 10.1210/jc.2009-1451. [DOI] [PubMed] [Google Scholar]
  • 31.Bastepe M, Gunes Y, Perez-Villamil B, Hunzelman J, Weinstein LS, Juppner H. Receptor-mediated adenylyl cyclase activation through XLalpha(s), the extra-large variant of the stimulatory G protein alpha-subunit. Mol Endocrinol. 2002;16:1912–1919. doi: 10.1210/me.2002-0054. [DOI] [PubMed] [Google Scholar]
  • 32.Schimmel RJ, Pasmans SG, Xu M, Stadhouders-Keet SA, Shore EM, Kaplan FS, Wulffraat NM. GNAS-associated disorders of cutaneous ossification: two different clinical presentations. Bone. 2010;46:868–872. doi: 10.1016/j.bone.2009.11.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Goto M, Mabe H, Nishimura G, Katsumata N. Progressive osseous heteroplasia caused by a novel nonsense mutation in the GNAS1 gene. J Pediatr Endocrinol Metab. 2010;23:303–309. doi: 10.1515/jpem.2010.23.3.303. [DOI] [PubMed] [Google Scholar]
  • 34.Williamson CM, Turner MD, Ball ST, Nottingham WT, Glenister P, Fray M, Tymowska-Lalanne Z, Plagge A, Powles-Glover N, Kelsey G, Maconochie M, Peters J. Identification of an imprinting control region affecting the expression of all transcripts in the Gnas cluster. Nat Genet. 2006;38:350–355. doi: 10.1038/ng1731. [DOI] [PubMed] [Google Scholar]
  • 35.Skinner JA, Cattanach BM, Peters J. The imprinted oedematous-small mutation on mouse chromosome 2 identifies new roles for Gnas and Gnasxl in development. Genomics. 2002;80:373–375. doi: 10.1006/geno.2002.6842. [DOI] [PubMed] [Google Scholar]

RESOURCES