Abstract
Leucine-rich repeat flightless-I-interacting protein 2 (LRRFIP2) is a myeloid differentiation factor 88-interacting protein with a positive regulatory function in toll-like receptor signaling. In this study, seven LRRFIP2 protein variants (LvLRRFIP2A-G) were identified in Litopenaeus vannamei. All the seven LvLRRFIP2 protein variants encode proteins with a DUF2051 domain. LvLRRFIP2s were upregulated in hemocytes after challenged with lipopolysaccharide, poly I:C, CpG-ODN2006, Vibrio parahaemolyticus, Staphylococcus aureus, and white spot syndrome virus (WSSV). Dual-luciferase reporter assays in Drosophila Schneider 2 cells revealed that LvLRRFIP2 activates the promoters of Drosophila and shrimp AMP genes. The knockdown of LvLRRFIP2 by RNA interference resulted in higher cumulative mortality of L. vannamei upon V. parahaemolyticus but not S. aureus and WSSV infections. The expression of L. vannamei AMP genes were reduced by dsLvLRRFIP2 interference. These results indicate that LvLRRFIP2 has an important function in antibacterials via the regulation of AMP gene expression.
Introduction
Toll-like receptors (TLRs) have a key function in the innate immune response [1]–[3]. Myeloid differentiation factor 88 (MyD88) is the common intracellular adaptor protein located immediately downstream of most TLRs [4]. Upon lipopolysaccharide (LPS) stimulation, MyD88 can recruit specific intracellular proteins along the MyD88-IRAK-TRAF6-IκB-NFκB signal relay to regulate the activity of downstream transcription factors such as NF-κB [5]–[7].
Leucine-rich repeat flightless-I-interacting protein 2 (LRRFIP2) is a poorly characterized protein implicated in TLR responses as a MyD88-interacting protein in vertebrates [8]. Together with LRRFIP1, LRRFIP2 was first reported as a novel protein that interacts with the LRR domain of human flightless I homolog (Fliih), a negative mediator of NF-κB activity functioning by interfering MyD88-TLR4 interaction in an exposure time-dependent manner [9], [10]. In humans, LRRFIP1 and LRRFIP2 are related genes from gene duplication that can activate β-catenin-dependent transcription activity [11], [12]. LRRFIP1, which also goes by the names GC-binding factor 2 (GCF2), flightless I LRR-associated protein 1 (FLAP1), and TAR RNA-interacting protein [9], [11], [13], functions in the regulation of tumor necrosis factor-α production and type I interferon [13]–[15]. LRRFIP2 exhibits 41% sequence homology with murine FLAP1 [2]. Similar to LRRFIP1, LRRFIP2 has a positive regulatory function in TLR signaling by disrupting the interaction of MyD88 and Fliih upon LPS-induced signal transduction [8]. Most of the current knowledge about LRRFIP2 stems from human or murine studies. Therefore, this study aims to gain additional insight into the function of LRRFIP2 in invertebrates. According to the information in the NCBI database, several expressed variants of LRRFIP2 have been predicted in vertebrates and invertebrates. In crustaceans, LRRFIP2 has been found in expressed sequence tags (ESTs) and full-length cDNA database of Caligus clemensi, Caligus rogercresseyi, and Lepeophtheirus salmonis.
Litopenaeus vannamei, a crustacean species, is one of the most important economic penaeid shrimps worldwide [16]. Since the 1990s, numerous shrimp-farming countries around the world have suffered substantial economic losses because of bacterial and viral diseases [17], [18]. Therefore, studying the mechanism of L. vannamei immunity is necessary to design better strategies for disease prevention and control. The research conducted in our laboratory proposed that a TLR/MyD88/Tube/Pelle/TRAF6/NF-κB cascade exists in L. vannamei [19]–[24]. In the current study, the homolog of human LRRFIP2 was identified in L. vannamei and its signal transduction function was studied, especially in antibacterial response. This study is the first to report on the function of LRRFIP2 in invertebrates, which is helpful to obtain more information about the LRRFIP2 gene. Moreover, study of L. vannamei LRRFIP2 may be beneficial to better understand the innate immune pathway in shrimp, which would be helpful in preventing various diseases in shrimp culture.
Materials and Methods
Microorganisms
Gram-negative Vibrio parahaemolyticus were cultured in a thiosulfate-citrate-bile salts-sucrose (TCBS) agar culture medium at 30°C for 18 h. Gram-positive Staphyloccocus. aureus were cultured in a nutrient broth agar at 37°C for 24 h. The V. parahaemolyticus and S. aureus cells were centrifuged at 5000 g for 10 min at 4°C, washed with 1×PBS (8 g NaCl, 0.2 g KCl, 1.44 g Na2HPO4, and 0.24 g K2HPO4, diluted with dH2O to 1 litre and with the pH adjusted to 7.3), and then resuspended in 1xPBS. The bacterial concentation was quantified as the microbial colony-forming units per milliliter (CFU/ml) and the bacterial solution adjusted to 106 CFU/ml.
The white spot syndrome virus (WSSV)-infected L. vannamei were collected from the Hengxing shrimp farm in Zhanjiang, Guangdong Province, China, and stored at −80°C. Muscle samples (0.1 g) from the WSSV -infected L. vannamei were homogenized in 1 ml of 1×PBS and centrifuged at 5000 g for 15 min at 4°C. The supernatant was filtered through a 0.45 µm membrane, and used as the WSSV inocula. TaqMan real-time PCR was used to quantify the WSSV dose as previously described [25].
Cloning of LvLRRFIP2 cDNA
Based on three EST sequences of L. vannamei (GenBank accession Numbers. FE100722, FE045230, and FE139225) homologous to Homo sapiens LRRFIP2, primers were designed to obtain the full-length cDNA of LRRFIP2 by 5′ and 3′ rapid amplification cDNA ends (RACE) polymerase chain reaction (PCR). The cDNA template for RACE-PCR was prepared using the BD SMART RACE cDNA amplification kit (Clontech, Japan). LvLRRFIP2-5′ RACE1 and LvLRRFIP2-3′ RACE1 primers (Table 1) were used for the first round 5′ end and 3′ end RACE-PCR using the following program: 94°C for 3 min, 10 cycles of 94°C for 30 s, 62°C for 30 s (a decrease of 0.5°C per cycle), 72°C for 2 min, 30 cycles of 94°C for 30 s, 57°C for 30 s, 72°C for 2 min, and a final extension at 72°C for 10 min. These PCR conditions were also applied to the second round 5′ end and 3′ end RACE PCR, where LvLRRFIP2-5′ RACE2 and LvLRRFIP2-3′ RACE2 primers were used, respectively. The PCR products were cloned into the pMD-20 vector (Takara, Japan), and then sequenced. The new sequences obtained in this study were deposited in the NCBI GenBank (http://www.ncbi.nlm.nih.gov/genbank/).
Table 1. PCR primers used in this study.
| Primers | Primer sequences (5′-3′) |
| For cDNA cloning | |
| LvLRRFIP2-5′ RACE1 | TCGTAGTCTCAGTTCTCTCGCTTCT |
| LvLRRFIP2-5′ RACE2 | CGGGCCTCAGCCTCTTTT |
| LvLRRFIP2-3′ RACE1 | GAAGGAACTAGAAGACCAAGTTAGAA |
| LvLRRFIP2-3′ RACE2 | GCTCAGGATTCATTAGATGTTAGGTTA |
| For Protein expression | |
| pAcLvLRRFIP2-F1a | CGGGGTACCATGCCTATAGTTAGAAAAGTCCCAG |
| pAcLvLRRFIP2-F2a | CGGGGTACCATGAGGGCCGAATTGAAAG |
| pAcLvLRRFIP2-F3a | CGGGGTACCATGGATGAGACGTCTAGGATGGA |
| pAcLvLRRFIP2-R1a | CGGGGGCCCTATCGAGCCGAGAGAGCATC |
| pAcLvLRRFIP2-R2a | CGGGGGCCCGAATCGGCCAATTCTGTCG |
| pAcLvLRRFIP2-R3a | CGGGGGCCCGGCAGGGTCTTGGGACAGGTCCT |
| For qPCR | |
| LvLRRFIP2-F | ACAGTTAGATAATGAAAAAGCGAC |
| LvLRRFIP2-R | GTGTTTCTTCAAGCTCGGTATACT |
| LvPEN2-F | GCATCAAGTTCGGAAGCTGT |
| LvPEN2-R | ACCCACATCCTTTCCACAAG |
| LvPEN4-F | ATGCTACGGAATTCCCTCCT |
| LvPEN4-R | ATCCTTGCAACGCATAGACC |
| LvALF1-F | ATAGTCGGGTTGTGGCACTC |
| LvALF1-R | GTCGTCCTCCGTGATGAGAT |
| LvCrustin-F | GGAGTAGGTGTTGGTGGTGGTT |
| LvCrustin-R | GCAGTCGCTTGTGCCAGTTC |
| LvLyz1-F | ACTGGTGCGGAAGCGACTA |
| LvLyz1-R | GGCGGATAGTCTCGGCG |
| LvLyz2-F | TCCCCCTGGTAAGAGAATCAAG |
| LvLyz2-R | GCACTTGGGCACCTGAGC |
| LvEF1α-F | GAAGTAGCCGCCCTGGTTG |
| LvEF1α-R | CGGTTAGCCTTGGGGTTGAG |
| For RNAi | |
| LvLRRFIP2i-F | GAAGGATAAGTATACCGAGCTTGAA |
| LvLRRFIP2i-R | GCCATATTCCTGTATTAACGCATCT |
| LvLRRFIP2i-T7Fb | GGATCCTAATACGACTCACTATAGG GAAGGATAAGTATACCGAGCTTGAA |
| LvLRRFIP2i-T7Rb | GGATCCTAATACGACTCACTATAGG GCCATATTCCTGTATTAACGCATCT |
| EGFP-F | GTTCAGCGTGTCCGGCGAG |
| EGFP-R | GTTCTTCTGCTTGTCGGCC |
| EGFP-T7Fb | GGATCCTAATACGACTCACTATAGG TCAGCGTGTCCGGCGAG |
| EGFP-T7Rb | GGATCCTAATACGACTCACTATAGG TCTTCTGCTTGTCGGCC |
Nucleotides in bold indicate restriction sites introduced for cloning.
T7 RNA polymerase promoter sequence are underlined.
Bioinformatics Analysis
The BLAST program (http://www.ncbi.nlm.nih.gov/BLAST/) was used to analyze the nucleotide sequence and to search for protein sequences from other species in the database. Multiple sequence alignments were performed using the ClustalX 2.0 program (http://www.ebi.ac.uk/tools/clustalw2). The simple modular architecture research tool (SMART, http://smart.embl-heidelberg.de) was used to analyze the protein domain topology. The neighbor-joining phylogenic trees were constructed based on the amino acid sequences using the MEGA 4.0 software (http://www.megasoftware.net/index.html) and bootstrapped for 1000 times.
Immune Challenge and Gene Expression Analysis
Twelve kinds of tissues, namely, hemocytes, hepatopancreas, gill, heart, stomach, pyloric cecum, nerve, epithelium, eyestalk, intestine, seminal vesicle, and muscle, were obtained from healthy L. vannamei for RNA extraction. The RNeasy mini kit (Qiagen, Germany) was used to extract the total RNA from each tissue. The PrimeScript™ RT reagent kit (TaKaRa, Japan) was used to reverse transcribe the total RNA into first-strand cDNA for real-time quantitative PCR (qPCR) analysis. Primers LvLRRFIP2-F and LvLRRFIP2-R (Table 1) were used to detect the relative mRNA expression of LvLRRFIP2s in different tissues. LvLRRFIP2 expression was measured using the Master SYBR Green I system with the following program: one cycle at 95°C for 30 s, 40 cycles of 95°C for 5 s, 57°C for 30 s, and 78°C for 5 s. Three replicate qPCR analyses were performed per sample using Elongation factor 1α (EF1α) as internal control.
For the challenge experiments, healthy L. vannamei was intramuscularly injected with LPS (Sigma, USA) (2 µg/g), poly I:C (Sigma, USA) (2 µg/g), CpG-ODN2006 (Sigma, USA) (2 µg/g), V. parahaemolyticus (5.5×106 CFU/g), Staphylococcus aureus (2.5×106 CFU/g), and white spot syndrome virus (WSSV) (106 copies/g) at the third abdominal segment. The L. vannamei injected with PBS were used as controls. Three animals from each group were randomly sampled for hemocyte collection at 0, 4, 8, 12, 24, 36, 48, and 72 h post-injection. The relative mRNA expression of the LvLRRFIP2 genes was detected by qPCR using the same program previously described.
Plasmid Construction
The pAc5.1/V5-His A (Invitrogen, USA) and PCR products (amplified with primers pAcLvLRRFIP2-F1/pAcLvLRRFIP2-R1, pAcLvLRRFIP2-F2/pAcLvLRRFIP2-R2, and pAcLvLRRFIP2-F3/pAcLvLRRFIP2-R3, respectively) were digested with restriction enzymes Kpn I and Xba I (Takara, Japan) and purified to determine protein expression in S2 cells. The mixture was ligated at 4°C overnight, and then transformed into the DH5α competent cells. Positive clones were confirmed by colony PCR and sequenced. Green fluorescent protein (GFP) PCR products were inserted into pAc5.1/V5-His A at the Xba I and Sac II sites to construct pAc5.1-N-GFP for protein localization. LvLRRFIP2 DNA fragments were then inserted into pAc5.1-N-GFP at the Kpn I and Xba I sites. Luciferase reporter vectors using the promoter sequences of Drosophila antimicrobial peptides (AMPs), Attacin A (AttA), and Drosomycin (Drs), as well as Penaeus monodon AMP Penaeidin (PEN453 and PEN536) were constructed in our previous studies [19]–[24].
Subcellular Localization Analysis of LvLRRFIP2
Given that no permanent shrimp cell line was available, Drosophila Schneider 2 (S2; Invitrogen, USA) cells were used for the functional and localization analysis of LvLRRFIP2s [26], [27]. S2 cells were seeded onto the cover slips in 12-well plates (TPP, Switzerland) for DNA transfection at 28°C in a Drosophila serum-free medium (SDM; Invitrogen, USA) supplemented with 10% fetal bovine serum (Invitrogen, USA) to perform localization analyses of LvLRRFIP2. The cells were then transfected with pAc5.1-N-GFP and pAc5.1-LvLRRFIP2-GFP using the Cellfectin II reagent (Invitrogen, USA) after 24 h. At 48 h post-transfection, cells on the cover slips were washed three times with PBS, fixed by Immunol Staining Fix Solution (Beyotime, China), and stained with Hoechst 33258 Solution (Beyotime, China). The treated cells were observed using a Leica laser scanning confocal microscope.
Dual-luciferase Reporter Assays
For the dual-luciferase reporter assays, S2 cells were seeded overnight in 96-well plates (TPP, Switzerland) and transfected using 0.3 µg pAc5.1-LvLRRFIP2s, 0.2 µg reporter gene plasmids, and 0.02 µg pRL-TK Renilla luciferase plasmid (Promega, USA) in a well. The pRL-TK Renilla luciferase plasmid was used alone as an internal control. At 48 h post-transfection, firefly and Renilla luciferase activities were measured using the dual-luciferase reporter assay system (Promega, USA). All assays were performed with three independent transfections.
Knockdown of LvLRRFIP2 in vivo by Double-stranded RNA (dsRNA)-mediated RNA Interference
The DsRNA of LvLRRFIP2 and EGFP were generated in vitro using gene specific primers (Table 1) according to T7 RiboMAX Express RNAi System (Promega, USA). For gene knockdown experiments, the experimental group (mean body weight 4 g to 5 g/L. vannamei) was intramuscularly injected with LvLRRFIP2 dsRNA (1 µg/g L. vannamei), whereas the control groups were injected with EGFP dsRNA and PBS only. Hemocyte samples from four animals of each treatment were collected at 0, 0.5, 1, 2, 3, 5, and 7 d post-dsRNA injections to determine the earliest time of maximal silencing. The total RNA was extracted and reverse transcribed to cDNA as previously described. The gene knockdown efficiency was checked using qPCR, and the optimum time of gene silencing was found. L. vannamei were challenged at the optimum time post-dsRNA injection.
Bioassay of V. parahaemolyticus, S. aureus, WSSV, and PBS Challenge Tests in LvLRRFIP2 Knockdown L. vannamei
A total of 600 L. vannamei (mean body weight of 4 g to 5 g) were divided into four groups (150 specimens per group) for the V. parahaemolyticus (5.5×106 CFU/g), S. aureus (2.5×106 CFU/g), WSSV (106 copies/g), and PBS challenges. Each group was further subdivided into three subgroups (50 specimens per group) for different dsRNA silencing treatments, i.e., injection with LvLRRFIP2 dsRNA (designated as dsLvLRRFIP2), EGFP dsRNA (designated as dsEGFP), or PBS. L. vannamei was then challenged with V. parahaemolyticus, S. aureus, WSSV, or PBS 2 d after dsRNA injection. The cumulative mortality was recorded every 8 h.
Detection of AMP Gene Expression in LvLRRFIP2 Knockdown L. vannamei
Specific primers (Table 1) of AMP genes were designed based on published L. vannamei cDNA sequences of penaeidin2 (LvPEN2, GenBank No.AF390146), penaeidin4 (LvPEN4, GenBank No. AF390147), anti-lipopolysaccharide factor 1 (LvALF1, GenBank No.EW713395), crustin (LvCrustin, GenBank No.AY488496), lysozyme1 (LvLyz1, GenBank No.AY170126), and lysozyme2 (LvLyz2, GenBank No. JN039375). The expression level of these genes at detected times after PBS, dsEGFP, and dsLvLRRFIP2 challenge were measured using qPCR as previously described.
Statistical Analysis
Student’s t-test was used to compare means from two samples using Microsoft Excel when applicable. In all cases, differences were considered significant at p<0.05. All experiments were repeated at least three times. The data were presented as the mean ± standard error (standard error of the mean, SEM). The Kaplan-Meier plot (log-rank x 2 test) was used to identify significant differences in mortality levels between the EGFP dsRNA and the LvLRRFIP2 dsRNA groups [28].
Results
cDNA Cloning and Bioinformatics Analysis of LvLRRFIP2
Seven LvLRRFIP2 variants, namely, LvLRRFIP2A, LvLRRFIP2B, LvLRRFIP2C, LvLRRFIP2D, LvLRRFIP2E, LvLRRFIP2F, and LvLRRFIP2G, were found. The sequences at 5′ end of LvLRRFIP2G were distinct from that of the other six LvLRRFIP2 variants. The 5′ end sequences of LvLRRFIP2A, LvLRRFIP2B, LvLRRFIP2C, and LvLRRFIP2D were identical. Both LvLRRFIP2E and LvLRRFIP2F have the same 5′ end sequences, which were different from that of LvLRRFIP2A-D. The sequence details of these seven variants of LvLRRFIP2 are shown in Fig. S1 and Table 2. Multiple sequence alignment shows that LvLRRFIP2s are highly conserved with each other (Fig. 1A). The amino acid sequence was analyzed using the SMART program to determine the structural domains of LvLRRFIP2. All LvLRRFIP2s have a DUF2051 domain (Fig. 1A), which was found in a dsRNA binding protein named DUF2051, a novel protein that interacts with the LRR domain of human FliI protein [29]. The identities among LvLRRFIP2s ranged from 44% to 97% (Table 3). Compared with the LRRFIP2 proteins from other species, LvLRRFIP2 shares a 35% to 51% identity with the LRRFIP2 proteins from insect to human (Table 4). A phylogenetic tree was constructed to determine the evolutionary relationship of LvLRRFIP2 with other known LRRFIP2 molecules. The phylogenetic tree showed that LvLRRFIP2 belonged to the invertebrate group and was closely related to LRRFIP2 in L. salmonis, Aedes aegypti, Acromyrmex echinatior, Ixodes scapularis, and Nasonia vitripennis, which are all arthropods (Fig. 1B).
Table 2. The cDNA information of seven LvLRRFIP2 variants.
| Name | GenBank accession No. | Full lengths | ORF lengths | Lengths of 5′ untranslated region | Lengths of 3′ untranslated region |
| LvLRRFIP2A | JX840473 | 1671 bp | 1269 bp | 50 bp | 352 bp |
| LvLRRFIP2B | JX840474 | 1573 bp | 1293 bp | 50 bp | 230 bp |
| LvLRRFIP2C | JX840475 | 1544 bp | 1068 bp | 50 bp | 426 bp |
| LvLRRFIP2D | JX840476 | 1624 bp | 1344 bp | 50 bp | 230 bp |
| LvLRRFIP2E | JX840477 | 1546 bp | 900 bp | 416 bp | 230 bp |
| LvLRRFIP2F | JX840478 | 1639 bp | 876 bp | 416 bp | 347 bp |
| LvLRRFIP2G | JX840479 | 1634 bp | 1281 bp | 123 bp | 230 bp |
Figure 1. Multiple sequence alignment of LvLRRFIP2s in Litopenaeus vannamei and phylogenetic analysis of LRRFIP2 proteins from various species.
(A) Multiple sequence alignment of LvLRRFIP2s in Litopenaeus vannamei. The identical amino acid residues shaded in black and the similar residues in gray. The DUF2051 domains are boxed. (B) Phylogenetic analysis of LRRFIP2 proteins. A rooted tree was constructed via the neighbor-joining method and was bootstrapped 1000 times using MEGA 4.0 (http://www.megasoftware.net/index.html). LvLRRFIP2 is boxed. LvLRRFIP2, L. vannamei LRRFIP2D (Accession No. JX840476); AeLRRFIP2, Acromyrmex echinatior LRRFIP2 (Accession No. EGI63253); NvLRRFIP2, Nasonia vitripennis LRRFIP2 (Accession No. XP_001608049); LsLRRFIP2; Lepeophtheirus salmonis LRRFIP2 (Accession No. ACO11882); AaLRRFIP2, Aedes aegypti LRRFIP2 (Accession No. XP_001654827); SpLRRFIP2, Strongylocentrotus purpuratus LRRFIP2 (Accession No. XP_782587); IsLRRFIP2, Ixodes scapularis LRRFIP2 (Accession No. XP_002410685); CiLRRFIP2, Ciona intestinalis LRRFIP2 (Accession No. XP_002130672); HsLRRFIP2, Homo sapiens LRRFIP2 (Accession No.NP_060194); BtLRRFIP2, Bos taurus LRRFIP2 (Accession No. NP_001033159); MmLRRFIP2, Mus musculus LRRFIP2 (Accession No. NP_082018); TgLRRFIP2, Taeniopygia guttata LRRFIP2 (Accession No. XP_002198991); DrLRRFIP2, Danio rerio LRRFIP2 (Accession No.NP_955773); XlLRRFIP2, Xenopus laevis LRRFIP2 (Accession No. NP_001085821); OaLRRFIP2, Ornithorhynchus anatinus LRRFIP2 (Accession No. XP_003430994).
Table 3. Identities of seven variants of LvLRRFIP2.
| Seq | LvLRRFIP2A | LvLRRFIP2B | LvLRRFIP2C | LvLRRFIP2D | LvLRRFIP2E | LvLRRFIP2F | LvLRRFIP2G |
| LvLRRFIP2A | 100% | ||||||
| LvLRRFIP2B | 95% | 100% | |||||
| LvLRRFIP2C | 75% | 74% | 100% | ||||
| LvLRRFIP2D | 91% | 95% | 78% | 100% | |||
| LvLRRFIP2E | 64% | 69% | 44% | 66% | 100% | ||
| LvLRRFIP2F | 68% | 65% | 45% | 62% | 93% | 100% | |
| LvLRRFIP2G | 92% | 97% | 71% | 93% | 69% | 65% | 100% |
Table 4. Full-length amino acid sequence identities of LRRFIP2 in L. vannamei with other species.
| Species | Accession number | Amina acids | Identity% |
| Homo sapiens | NP_060194 | 400 | 41% |
| Mus musculus | NP_082018 | 400 | 41% |
| Bos taurus | NP_001033159 | 400 | 41% |
| Ornithorhynchus anatinus | XP_003430994 | 280 | 40% |
| Xenopus laevis | NP_001085821 | 405 | 40% |
| Taeniopygia guttata | XP_002198991 | 399 | 41% |
| Danio rerio | NP_955773 | 405 | 40% |
| Ciona intestinalis | XP_002130672 | 429 | 35% |
| Strongylocentrotus purpuratus | XP_782587 | 459 | 39% |
| Ixodes scapularis | XP_002410685 | 386 | 41% |
| Aedes aegypti | XP_001654827 | 389 | 50% |
| Lepeophtheirus salmonis | ACO11882 | 406 | 39% |
| Nasonia vitripennis | XP_001608049 | 401 | 49% |
| Acromyrmex echinatior | EGI63253 | 402 | 51% |
Expression of LvLRRFIP2 in Healthy and Immune-challenged L. vannamei
The primers LvLRRFIP2-F/LvLRRFIP2-R were designed according to the identical sequences among LvLRRFIP2s and were used to detect their total amount. The expression level of LvLRRFIP2s was highest in the muscle and lowest in hepatopancreas (Fig. 2). The ligands for TLR3 (poly I:C), TLR4 (LPS), TLR9 (CpG-ODN2006), gram-negative bacteria V. parahaemolyticus, gram-positive bacteria S. aureus, and one of the most common and most destructive viral pathogens in shrimp aquaculture, WSSV, were used for the challenge experiments [30], [31]. LvLRRFIP2s was highly expressed in hemocytes, which are important in immune response in L. vannamei. Thus, we selected hemocytes to study LvLRRFIP2s expression in response to immune challenges.
Figure 2. Tissue distributions of LvLRRFIP2s in healthy L. vannamei.
Ten animals were used for tissue sampling. LvEF1α was used as the internal control to normalize the cDNA template used for real-time PCR analysis.
After LPS challenge, the level of LvLRRFIP2s increased to its peak at 8 h post-injection. After 48 h, the expression of LvLRRFIP2s was not obviously different from the control (Fig. 3A). After challenge with poly I:C, the LvLRRFIP2s expression was upregulated at all the detected times, with the highest expression level at 4 h post-injection (Fig. 3B). The LvLRRFIP2s expression was also upregulated by CpG-ODN2006 challenge (Fig. 3C). LvLRRFIP2s expression has short-term downregulation at 4 h post-injection, but upregulated after V. parahaemolyticus and S. aureus challenge (Fig. 3D, Fig. 3E). Compared with the control group, the WSSV-infected group showed increased LvLRRFIP2s expression starting at 8 h (Fig. 3F).
Figure 3. Temporal expression of LvLRRFIP2 in immune-challenged L. vannamei.
The relative expression of LvLRRFIP2s in th treated groups ((A) lipope lysaccharide (LPS), (B) poly I:C, (C) CpG-ODN2006, (D) Vibrio parahaemolyticus, (E) Staphyloccocus aureus, (F) white spot syndrome virus (WSSV)) were compared with the control group. The relative expression level of the target genes was normalized to LvEF1α. The results were based on three independent experiments and expressed as mean values ± SD. Statistical significance was calculated using Student’s t-test (*indicates p<0.05 and **indicates p<0.01 compared with the control).
Intracellular Localization of LvLRRFIP2
The subcellular location of LRRFIP2 has not been previously characterized. LvLRRFIP2s-GFP were observed under confocal microscopy using Drosophila S2 cells to identify the cellular localization of LvLRRFIP2. Although differences exist among the sequences of LvLRRFIP2s, their GFP fusion proteins were all observed in the cytoplasm of S2 cells (Fig. 4), which was consistent with the interaction of LRRFIP2 and MyD88, an adaptor protein downstream of TLRs [8].
Figure 4. Subcellular localizations of LvLRRFIP2s.
Drosophila S2 cells were transfected with GFP fusion proteins of pAcLvLRRFIP2s. At 48 h post-transfection, the cells were observed using a Leica laser scanning confocal microscope.
Drosophila and Shrimp AMP Genes were Regulated by LvLRRFIP2
LRRFIP2 is a positive regulator of NF-κB activity in murine macrophage cells [8]. AMPs are important immune factors in Drosophila and shrimp, and their expression is believed to be controlled mainly by the NF-κB signal pathway [20], [21], [32]. The NF-κB signal pathway can be activated by Toll, Pelle, TRAF6, Dorsal, and Relish in shrimp [19]–[24]. The present study demonstrated that LvLRRFIP2s activated the promoters of Drosophila and shrimp AMP genes. Compared with six other variants of LvLRRFIP2, LvLRRFIP2F induced higher activities of AMP promoters, including the Drosophila AMPs AttA (3.78-fold), Drs (2.11-fold), L. vannamei AMP PEN4 (3.32-fold), and P. monodon AMP PEN536 (5.14-fold) (Fig. 5).
Figure 5. Effects of LvLRRFIP2s on the promoter activities of Drosophila and shrimp AMPs in Drosophila S2 cells.
Drosophila S2 cells were transfected with the protein expression vector (pAC5.1 empty vector, one of the LvLRRFIP2s), the reporter gene plasmid (pGL3-Basic, pGL3-AttA, pGL3-Drs, pGL3-PEN453, or pGL3-PEN536), and the pRL-TK Renilla luciferase plasmid (as an internal control: Promega, USA). After 48 h, the cells were harvested for luciferase activity determination using the dual-luciferase reporter assay system (Promega, USA). All data are representative of three independent experiments. The bars indicate the mean ± SD of luciferase activity (n = 3). The statistical significance was calculated using Student’s t-test (*indicates p<0.05 and **indicates p<0.01compared with control).
LvLRRFIP2 Suppression Led to an Increased Mortality of L. vannamei after V. parahaemolyticus Infection, but not after S. aureus and WSSV Infection
DsRNA were used to knockdown all the variants of LvLRRFIP2. The relative expression level of LvLRRFIP2 in hemocytes after dsLvLRRFIP2 interference is shown in Fig. 6. Reduced LvLRRFIP2 mRNA expression was observed at 0.5 d post-injection. The most significant effect was detected 2 d post-injection. The relative expression of LvLRRFIP2 in dsLvLRRFIP2 injected group accounts for 10% of that of blank L. vannamei (0 h without any treatment) and 8% that of the PBS group. Compared with the dsLvLRRFIP2 injection group, the expression of LvLRRFIP2 was not significantly affected by dsEGFP and PBS injection at all the detected times (p>0.05).
Figure 6. Expression of LvLRRFIP2 mRNA after knockdown by dsRNA-mediated RNAi.
Injections of the enhanced EGFP dsRNA and PBS were used as dsRNA controls. Relative expression values were normalized to LvEF1α. The results are based on three independent experiments and expressed as mean values±SD. Statistical significance was calculated by the Student’s t-test (Letters a and b indicate p<0.05 compared with blank (0 h without any treatment) or PBS group, respectively).
L. vannamei was challenged with V. parahaemolyticus, S. aureus, WSSV, and a PBS control to explore the possible involvement of LvLRRFIP2 in a protective response against invaders at 2 d post-dsRNA injection. The baseline cumulative mortality of L. vannamei injected with PBS at 2 d after LvLRRFIP2 dsRNA injection is shown in Fig. 7A. The final mortality rates at 136 hpi were low for all groups (11.6%, 9.3%, and 6.9% for the LvLRRFIP2 dsRNA, EGFP dsRNA, and PBS groups, respectively), and no significant difference in mortality was observed among the three groups (p>0.05). In the V. parahaemolyticus challenge test (Fig. 7B), the cumulative mortality of the LvLRRFIP2 dsRNA group began to increase at 8 h post-V. parahaemolyticus challenge. The cumulative mortality in the LvLRRFIP2 dsRNA group was significantly higher than in the EGFP dsRNA, starting at 88 hpi (Kaplan-Meier log-rank χ 2: 7.402, p<0.05). The final mortality rates at 136 hpi were 63.6%, 30.0%, and 27.9% for the LvLRRFIP2 dsRNA, EGFP dsRNA, and PBS groups, respectively. In the challenge tests with S. aureus and WSSV, no evidence showed that knockdown of LvLRRFIP2 expression by dsRNA had any statistically significance on cumulative mortality (Figs. 7C and 7D).
Figure 7. Gene silencing of L. vannamei LvLRRFIP2 increased its mortality after V. parahaemolyticus injection.
L. vannamei were injected intramuscularly with PBS or dsRNAs corresponding to LvLRRFIP2 or EGFP. At 2 d after the initial injection, the animals were infected with PBS (negative control) (A), V. parahaemolyticus (B), S. aureus (C), or WSSV (D). Mortality was measured in each treatment group (n = 50) and was recorded every 8 h post-challenge. Differences in cumulative mortality levels between the LvLRRFIP2 dsRNA group and the EGFP dsRNA group were analyzed by Kaplan-Meier log-rank χ 2 tests. Significant differences in L. vannamei mortality are marked with asterisks, and were found only in L. vannamei challenged with V. parahaemolyticus from 88 hpi to the end of the experiment (p<0.05).
The Expression of L. vannamei AMPs was Reduced by dsLvLRRFIP2 Interference
Considering that the knockdown of LvLRRFIP2 led to significantly increased mortality after V. parahaemolyticus infection (Fig. 7B), the expressions of six AMP genes were observed in LvLRRFIP2 knockdown L. vannamei. Fig. 8 shows that LvPEN4 underwent a brief period of downregulation at 0.5 d, 1 d, and 2 d after dsLvLRRFIP2 injection. However, the expression level of LvPEN4 was not significantly different in the dsLvLRRFIP2 and dsEGFP injection groups (Fig. 8B). Compared with the dsEGFP injection group, the expression level of LvPEN2, LvCrustin, LvALF1, LvLyz1, and LvLyz2 decreased at all detected times in the dsLvLRRFIP2 injection group (Figs. 8A, 8C, 8D, 8E, and 8F, respectively). All the results corresponded to the increase of the cumulative mortality of L. vannamei in the LvLRRFIP2 dsRNA group challenged with V. parahaemolyticus.
Figure 8. The expression of L. vannamei AMPs after dsLvLRRFIP2 was knocked down.
The relative expression of the L. vannamei AMP genes ((A) LvPEN2, (B) LvPEN4, (C) LvCrustin, (D) LvALF1, (E) LvLyz1, (F) LvLyz2) were compared against the PBS and dsEGFP injection group at the corresponding times. Relative expression values were normalized to LvEF1α. The results are based on three independent experiments and expressed as mean values±SD. Statistical significance was calculated by the Student’s t-test (*indicates p<0.05 and **indicates p<0.01 compared with EGFP dsRNA injection group.
Discussion
LRRFIP2 is a poorly characterized protein implicated in TLR responses [8]. To date, no report about the function of LRRFIP2 protein in invertebrates exists. In the present study, seven variants of LRRFIP2 were cloned from L. vannamei. The LvLRRFIP2 expression was regulated by different immune challenges. Luciferase reporter assays showed that Drosophila and shrimp AMP genes can be regulated by LvLRRFIP2. The knockdown of LvLRRFIP2 increased the cumulative mortality of L. vannamei after V. parahaemolyticus infection, but not after S. aureus and WSSV infection. All these results suggest that LvLRRFIP2 has a function in antibacterial response.
The analysis of all LRRFIP2 proteins presently published on the NCBI database showed that several isoforms of LRRFIP2 exist in Nasonia vitripennis, Danio rerio, and 12 kinds of mammals, including human and murine. The differences among isoforms in one of these species can be divided into three groups: 1) the nucleotide sequences at the 5′ end were different; 2) the nucleotide sequences at the 3′ end were different; and 3) several nucleotide sequences were missing in the short isoforms. N. vitripennis was the only invertebrate variant of LRRFIP2 found. In N. vitripennis, nucleotide sequences of the two LRRFIP2 isoforms were different only at the 5′ end. In the present study, seven variants of LvLRRFIP2 were cloned in L. vannamei. Most of the nucleotide sequences were identical in the seven variants of LvLRRFIP2, except for the different nucleotide fragments at the 5′ end and the lacked sequences in the short isoforms. Unlike LRRFIP2 in vertebrate species with varied isoforms, different nucleotide sequences at the 3′ end were not found in LvLRRFIP2s in this study. The seven variants of LvLRRFIP2 were different isoforms of LRRFIP2 gene in L. vannamei.
qPCR analysis showed that LvLRRFIP2 was detected in all tissues examined in L. vannamei, indicating a ubiquitous and constitutive expression of LvLRRFIP2 (Fig. 2). LvLRRFIP2s was expressed significantly higher in the muscle than the other tissues, which is similar to the expression pattern of the human LRRFIP2 gene [9]. Considering that LRRFIP2 is a protein implicated in TLR responses [8], the expression of LvLRRFIP2 was investigated in the hemocytes of L. vannamei after stimulation with the ligands of different TLRs, gram-negative bacterium V. parahaemolyticus, gram-positive bacterium S. aureus, and viral pathogen WSSV to improve understanding of the functions of LRRFIP2. In humans, LRRFIP2 mRNA expression level is regulated by LPS stimulation [8]. LvLRRFIP2 was upregulated by LPS stimulation in L. vannamei, especially at 8 h to 24 h after LPS challenge. LvLRRFIP2 was also upregulated at different levels after challenged by poly I:C, CpG-ODN2006, V. parahaemolyticus, S. aureus, and WSSV. These data indicate that LvLRRFIP2 participates in the immune response of L. vannamei.
We analyzed the subcellular localization to better define LvLRRFIP2. LRRFIP1 is the related gene of LRRFIP2 and is predominantly dispersed in the cytoplasm of primary murine monocytes [11], [33]. Subcellular localization of the seven variants of LvLRRFIP2 proteins were all observed in the cytoplasm of the S2 cells. This observation is consistent with the putative function of LRRFIP2 as an interactional protein with MyD88 in the modulation of TLR signaling [8]. The present study is the first to report on the subcellular localization of the LRRFIP2 protein. However, the function of LRRFIP2 needs further investigation.
In Drosophila, the Toll pathway is involved in immune response regulation, which controls several immune-related genes, including AMP genes, whose expression was believed to be controlled mainly by the NF-κB signal pathway [19], [27], [32]. A similar regulation mechanism for the shrimp AMPs exists [21], [22]. As MyD88 interactors, both LRRFIP1 and LRRFIP2 are positive regulators of the NF-κB activities in human [8]. The present study reveals that LvLRRFIP2 can activate the promoters of Drosophila and shrimp AMP genes in Drosophila S2 cells, suggesting that LvLRRFIP2 displays antibacterial function by regulating the expression of AMPs through the Toll pathway. LvLRRFIP2 was knocked down and the cumulative mortality of L. vannamei upon V. parahaemolyticus, S. aureus, and WSSV infection were detected to further study the function LRRFIP2 in the immune pathway of L. vannamei. The cumulative mortality of L. vannamei significantly increased upon V. parahaemolyticus infection. The expression of L. vannamei AMPs was reduced by dsLvLRRFIP2 interference, which corresponded with the increased cumulative mortality of L. vannamei in the LvLRRFIP2 dsRNA group challenged by V. parahaemolyticus. Thus, we speculated that the knockdown of LvLRRFIP2 impaired the immune defense of invaded V. parahaemolyticus by reducing the AMP expression. The cumulative mortalities of L. vannamei were not significantly changed upon S. aureus and WSSV infection when LvLRRFIP2 was knocked down. However, we cannot analyze the cause according to the present results, thus future studies are needed. In summary, the results suggest that LvLRRFIP2 has a function in the innate immune pathway in L. vannamei, at least against V. parahaemolyticus.
Supporting Information
Nucleotide and deduced amino acid sequences of LvLRRFIP2s from Litopenaeus vannamei . (A) LvLRRFIP2A, (B) LvLRRFIP2B, (C) LvLRRFIP2C, (D) LvLRRFIP2D, (E) LvLRRFIP2E, (F) LvLRRFIP2F, (G) LvLRRFIP2G. The nucleotide (lower row) and deduced amino acid (upper row) sequences are shown and numbered on the left. The initiation codon (ATG) and stop codon (TAA or TGA) are in boldface. The DUF2051 domains are shaded. Different sequences at the 5′ end were boxed and painted by different colors. The sequences missing in several LvLRRFIP2s were underlined.
(TIF)
Funding Statement
This research was supported by the National Natural Science Foundation of China under Grant No. U1131002, the National High Technology Research and Development Program of China (973 Program) 2012CB114401, the China Agriculture Research System, the Special Fund for Agro-scientific Research in the Public Interest 201103034, the Foundation of Administration of Ocean and Fisheries of Guangdong Province A201101B02, the Open Project of the State Key Laboratory of Biocontrol (SKLBC09K04) and the Foundation of Science and Technology Bureau of Guangdong Province (2011A020102002 and 2009A020102002). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
- 1. Liew FY, Xu D, Brint EK, O’Neill LA (2005) Negative regulation of toll-like receptor-mediated immune responses. Nat Rev Immunol 5: 446–458. [DOI] [PubMed] [Google Scholar]
- 2. Dunne A, O’Neill LA (2003) The interleukin-1 receptor/Toll-like receptor superfamily: signal transduction during inflammation and host defense. Sci STKE 2003: re3. [DOI] [PubMed] [Google Scholar]
- 3. Janeway CA, Medzhitov R (2002) Innate immune recognition. Annu Rev Immunol 20: 197–216. [DOI] [PubMed] [Google Scholar]
- 4. O’Neill LA (2003) The role of MyD88-like adapters in Toll-like receptor signal transduction. Biochem Soc Trans 31: 643–647. [DOI] [PubMed] [Google Scholar]
- 5. Takeda K, Kaisho T, Akira S (2003) Toll-like receptors. Annu Rev Immunol 21: 335–376. [DOI] [PubMed] [Google Scholar]
- 6. Hatao F, Yamamoto M, Muroi M, Kaminishi M, Tanamoto K (2008) MyD88-induced downregulation of IRAK-4 and its structural requirements. FEMS Immunol Med Microbiol 53: 260–264. [DOI] [PubMed] [Google Scholar]
- 7. Verma IM, Stevenson JK, Schwarz EM, Van Antwerp D, Miyamoto S (1995) Rel/NF-kappa B/I kappa B family: intimate tales of association and dissociation. Genes Dev 9: 2723–2735. [DOI] [PubMed] [Google Scholar]
- 8. Dai P, Jeong SY, Yu Y, Leng T, Wu W, et al. (2009) Modulation of TLR signaling by multiple MyD88-interacting partners including leucine-rich repeat Fli-I-interacting proteins. J Immunol 182: 3450–3460. [DOI] [PubMed] [Google Scholar]
- 9. Fong KS, de Couet HG (1999) Novel proteins interacting with the leucine-rich repeat domain of human flightless-I identified by the yeast two-hybrid system. Genomics 58: 146–157. [DOI] [PubMed] [Google Scholar]
- 10. Povelones M, Waterhouse RM, Kafatos FC, Christophides GK (2009) Leucine-rich repeat protein complex activates mosquito complement in defense against Plasmodium parasites. Science 324: 258–261. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Lee YH, Stallcup MR (2006) Interplay of Fli-I and FLAP1 for regulation of beta-catenin dependent transcription. Nucleic Acids Res 34: 5052–5059. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Liu J, Bang AG, Kintner C, Orth AP, Chanda SK, et al. (2005) Identification of the Wnt signaling activator leucine-rich repeat in Flightless interaction protein 2 by a genome-wide functional analysis. Proc Natl Acad Sci U S A 102: 1927–1932. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Suriano AR, Sanford AN, Kim N, Oh M, Kennedy S, et al. (2005) GCF2/LRRFIP1 represses tumor necrosis factor alpha expression. Molecular and cellular biology 25: 9073–9081. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Yang P, An H, Liu X, Wen M, Zheng Y, et al. (2010) The cytosolic nucleic acid sensor LRRFIP1 mediates the production of type I interferon via a beta-catenin-dependent pathway. Nat Immunol 11: 487–494. [DOI] [PubMed] [Google Scholar]
- 15. Bagashev A, Fitzgerald MC, Larosa DF, Rose PP, Cherry S, et al. (2010) Leucine-rich repeat (in Flightless I) interacting protein-1 regulates a rapid type I interferon response. J Interferon Cytokine Res 30: 843–852. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Bachère E (2000) Shrimp immunity and disease control. Aquaculture 191: 3–11. [Google Scholar]
- 17.Lightner DV, Poulos BT, Tang-Nelson KF, Pantoja CR, Nunan LM, et al. (2006) Application of molecular diagnostic methods to penaeid shrimp diseases: advances of the past 10 years for control of viral diseases in farmed shrimp. Dev Biol (Basel) 126: 117–122; discussion 325–116. [PubMed]
- 18. Lightner DV, Redman RM (2007) Opportunities for training in shrimp diseases. Dev Biol (Basel) 129: 137–146. [PubMed] [Google Scholar]
- 19. Wang PH, Gu ZH, Wan DH, Zhang MY, Weng SP, et al. (2011) The shrimp NF-kappaB pathway is activated by white spot syndrome virus (WSSV) 449 to facilitate the expression of WSSV069 (ie1), WSSV303 and WSSV371. PLoS One 6: e24773. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Yang LS, Yin ZX, Liao JX, Huang XD, Guo CJ, et al. (2007) A Toll receptor in shrimp. Mol Immunol 44: 1999–2008. [DOI] [PubMed] [Google Scholar]
- 21. Wang PH, Liang JP, Gu ZH, Wan DH, Weng SP, et al. (2012) Molecular cloning, characterization and expression analysis of two novel Tolls (LvToll2 and LvToll3) and three putative Spatzle-like Toll ligands (LvSpz1–3) from Litopenaeus vannamei . Dev Comp Immunol 36: 359–371. [DOI] [PubMed] [Google Scholar]
- 22. Wang PH, Wan DH, Gu ZH, Deng XX, Weng SP, et al. (2011) Litopenaeus vannamei tumor necrosis factor receptor-associated factor 6 (TRAF6) responds to Vibrio alginolyticus and white spot syndrome virus (WSSV) infection and activates antimicrobial peptide genes. Dev Comp Immunol 35: 105–114. [DOI] [PubMed] [Google Scholar]
- 23. Huang XD, Yin ZX, Liao JX, Wang PH, Yang LS, et al. (2009) Identification and functional study of a shrimp Relish homologue. Fish Shellfish Immunol 27: 230–238. [DOI] [PubMed] [Google Scholar]
- 24. Huang XD, Yin ZX, Jia XT, Liang JP, Ai HS, et al. (2010) Identification and functional study of a shrimp Dorsal homologue. Dev Comp Immunol 34: 107–113. [DOI] [PubMed] [Google Scholar]
- 25. Fouzi M, Shariff M, Omar AR, Yusoff FM, Tan SW (2010) TaqMan real-time PCR assay for relative quantification of white spot syndrome virus infection in Penaeus monodon Fabricius exposed to ammonia. J Fish Dis 33: 931–938. [DOI] [PubMed] [Google Scholar]
- 26. Akira S, Uematsu S, Takeuchi O (2006) Pathogen recognition and innate immunity. Cell 124: 783–801. [DOI] [PubMed] [Google Scholar]
- 27. Lemaitre B, Hoffmann J (2007) The host defense of Drosophila melanogaster. Annu Rev Immunol 25: 697–743. [DOI] [PubMed] [Google Scholar]
- 28. Labreuche Y, O’Leary NA, de la Vega E, Veloso A, Gross PS, et al. (2009) Lack of evidence for Litopenaeus vannamei Toll receptor (lToll) involvement in activation of sequence-independent antiviral immunity in shrimp. Dev Comp Immunol 33: 806–810. [DOI] [PubMed] [Google Scholar]
- 29. Marchler-Bauer A, Lu S, Anderson JB, Chitsaz F, Derbyshire MK, et al. (2011) CDD: a Conserved Domain Database for the functional annotation of proteins. Nucleic Acids Res 39: D225–229. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Moresco EM, LaVine D, Beutler B (2011) Toll-like receptors. Curr Biol 21: R488–493. [DOI] [PubMed] [Google Scholar]
- 31. Lin YR, Hung HC, Leu JH, Wang HC, Kou GH, et al. (2011) The Role of Aldehyde Dehydrogenase and Hsp70 in Suppression of White Spot Syndrome Virus Replication at High Temperature. Journal of virology 85: 3517–3525. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. O’Leary NA, Gross PS (2006) Genomic structure and transcriptional regulation of the penaeidin gene family from Litopenaeus vannamei. Gene 371: 75–83. [DOI] [PubMed] [Google Scholar]
- 33. Arakawa R, Bagashev A, Song L, Maurer K, Sullivan KE (2010) Characterization of LRRFIP1. Biochem Cell Biol 88: 899–906. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Nucleotide and deduced amino acid sequences of LvLRRFIP2s from Litopenaeus vannamei . (A) LvLRRFIP2A, (B) LvLRRFIP2B, (C) LvLRRFIP2C, (D) LvLRRFIP2D, (E) LvLRRFIP2E, (F) LvLRRFIP2F, (G) LvLRRFIP2G. The nucleotide (lower row) and deduced amino acid (upper row) sequences are shown and numbered on the left. The initiation codon (ATG) and stop codon (TAA or TGA) are in boldface. The DUF2051 domains are shaded. Different sequences at the 5′ end were boxed and painted by different colors. The sequences missing in several LvLRRFIP2s were underlined.
(TIF)








