Skip to main content
Indian Journal of Microbiology logoLink to Indian Journal of Microbiology
. 2012 Oct 20;53(1):106–110. doi: 10.1007/s12088-012-0316-5

Association of Three Plasmid-Encoded spv Genes Among Different Salmonella Serotypes Isolated from Different Origins

Abdollah Derakhshandeh 1,✉, Roya Firouzi 1, Rahem Khoshbakht 1
PMCID: PMC3587499  PMID: 24426086

Abstract

The virulence plasmid associated Salmonella plasmid virulence (spv) locus is strongly concomitant with strains that cause non typhoid bacteremia. The spv region contains three genes required for the virulence, the positive transcriptional regulator spvR and two structural genes spvB and spvC. The purpose of this study was to investigate the presence of these three genes among salmonella serotypes isolated from different sources. A collection of 60 salmonella serotypes from different sources were used. Polymerase chain reaction was carried out for the presence of these genes using specific primers. The prevalence of spvB, spvC, and spvR genes were 26 (43.3 %), 44 (73.3 %), and 28 (46.6 %), respectively. The findings revealed that the distribution of these genes was dissimilar among these serotypes. Many of the human pathogenic salmonella strains which can be transmitted by animals may have these genes and can be very injurious for public health.

Keywords: Spv genes, Salmonella serotype, PCR

Introduction

During the last decades, the isolation of Salmonella has been increased throughout the world [1]. Members of the genus Salmonella infect a wide variety of hosts and cause diseases in many animal species and in human beings according to their antigenic profiles [2, 3]. Salmonellosis is associated with medium to severe morbidity and even mortality in farm animals, representing major economic losses in the food and animal industries [4]. Certain serovars are particularly associated with systemic infections. A common feature of these serovars is the presence of the plasmid-encoded spv genes [5]. One main function of the spv operon is to potentiate the systemic spread of the pathogen [6]. The spv locus is strongly associated with strains that cause non-typhoid bacteremia, but are not present in typhoid strains, indicating that the pathogenesis and immunology of typhoid have fundamental differences from the syndrome of non-typhoid bacteremia [7]. Spv genes are found in nearly all natural isolates of Salmonella that are host adapted to animals (Salmonelladublin, S. choleraesuis, S. gallinarum-pullorum, and S.abortusovis) but not in S. typhi. Plasmid-encoded spv genes are also found in the common broad-host-range serovars, S. typhimurium and S. enteritidis, but only a variable proportion of isolates carries these virulence plasmids [8]. The spv locus consists of five genes, designated spvRABCD [9], three of which are required for the virulence phenotype: the positive transcriptional regulator spvR and two structural genes spvB and spvC. The spvD gene is missing in the chromosomal locus as found in serovar Arizona [10] and it has been shown that the spvA gene is dispensable for virulence in orally inoculated mice [11]. SpvB prevents actin polymerization by ADP-ribosylation of actin monomers. The C-terminal domain of SpvB contains ADP-ribosyltransferase activity that covalently modifies G-actin monomers and prevents their polymerization into F-actin filaments [12]. Since F-actin is continuously formed and depolymerized in the cell, the activity of SpvB in the host cell cytoplasm leads to loss of the F-actin cytoskeleton [13], furthermore, SpvB is required for Salmonella proliferation in a subset of monocyte derived human macrophages, and is responsible for the late apoptosis seen in host cells during Salmonella infection [14]. SpvC has been shown to have phosphothreoninelyase activity that irreversibly inactivates host cell MAPkinases by removal of phosphate and modification of the target threonine [15]. The role of this activity in the virulence phenotype of SpvC has not been determined. Both SpvB and SpvC are translocated by the SPI-2 TTSS [16]. spvR encodes a MetR/LysR-type transcriptional activator and is transcribed separately from the spvABCD structural genes. SpvR binds to both the spvR and spvA promoters and is required for expression of the spvABCD genes [17]. The spv genes from different serovars are highly homologous [8] and allow us to decide whether the pathogenesis of the isolates from positive clinical samples is attributable to chromosome or plasmid born virulence factor [18]. The present study aimed to investigate the prevalence of two main virulence plasmid-born genes in spv locus, spvB, spvC and regulator spvR gene and their association among different serovars of Salmonella enterica isolated from human and animals.

Materials and Methods

Bacterial Strains

A total of 60 Salmonella strains were recovered from specimens submitted to the diagnostic microbiology laboratory of the School of Veterinary Medicine between 2004 and 2005 in different outbreaks or individual cases in Shiraz, Iran. Human fecal isolates derived from patients with gastroenteritis were obtained from a diagnostic laboratory in Shiraz, Iran. Strains which were previously identified by conventional methods and serotyped by the Salmonella reference center are listed in Table 2.

Table 2.

Prevalence of spvB, spvC and spvR genes in Salmonella serotypes

Source/serotype No. of isolates No. (%) positive for virulence genes
spvB spvC spvR
Poultry
 S. Enteritidis 15 7 (46.6) 14 (93.3) 9 (60)
 S. Typhimurium 9 2 (22.2) 7 (77.7) 4 (44.4)
 S. Infantis 5 1 (20) 1 (20) 0 (0)
 S. Colindal 1 0 (0) 0 (0) 0 (0)
Animals
 S. Abortusovis 12 8 (66.6) 10 (83.3) 7 (58.3)
 S. Enteritidis 7 2 (28.5) 6 (85.7) 3 (42.8)
 S. Typhimurium 5 5 (100) 3 (60) 3 (60)
 S. Virchow 1 0 (0) 0 (0) 0 (0)
Human
 S. Enteritidis 3 0 (0) 3 (100) 2 (66.6)
 S. Bardo 2 1 (50) 0 (0) 0 (0)
Total 60 26 (43.3) 44 (73.3) 28 (46.6)

DNA Preparation

A loopful of colonies of each isolate on agar plate was picked and suspended in 200 μL of distilled water. After vortexing, the suspension was boiled for 5 min, and 50 μL of the supernatant was collected after spinning at 14,000 rpm for 10 min. The DNA concentration of the boiled extracts was determined with spectrophotometer [19].

PCR Assay

PCR amplifications were performed in a final volume of 25 μL in PCR tubes. The reaction mixtures consisted of 2 μL of the DNA template, 2.5 μL 10× PCR buffer (75 mM Tris–HCl, pH 9.0, 2 mM MgCl2, 50 mM KCl, 20 mM (NH4)2SO4), (CinaGen, Iran), 1 μL dNTPs (50 μM), (CinaGen, Iran), 1 μL (1U Ampli Taq DNA polymerase), (CinaGen, Iran), 1 μL (25 pmol) from the forward and reverse primers (CinaGen, Iran), of both primer pairs (Table 1) and the volume of the reaction mixture was completed to 25 μL using distilled deionized water. The thermal cycler (MJ mini, BioRad, USA) was adjusted under the following conditions: Initial denaturation at 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 1 min, annealing as shown in Table 1 for 1 min and extension at 72 °C for 1 min. Final extension was carried out at 72 °C for 10 min and the PCR products were stored in the thermal cycler at 4° C until they were collected. Amplified products were separated by electrophoresis in 1.5 % agarose gel stained with ethidium bromide. Visualization was undertaken using a UV transilluminator (BTS-20, Japan) and the 50 bp plus DNA ladder was used as molecular size marker Fig. 1.

Table 1.

Nucleotide sequences used as primers in the PCR reaction for three spv genes in Salmonella serotypes

Name of primer Sequence (5′–3′) Target gene Annealing temperature Product size (bp) References
spvC1 CGGAAATACCATCTACAAATA spvC 42 °C 669 [20]
spvC2 CCCAAACCCATACTTACTCTG
spvBF ATGTTGATACTAAATGGTTTTTCA spvB 55 °C 1,776 [21]
spvBR CTATGAGTTGAGTACCCTCATGTT
spvRF ATGGATTTCATTAATAAAAAATTA spvR 55 °C 894 [21]
spvRR TCAGAAGGTGGACTGTTTCAGTTT

Fig. 1.

Fig. 1

Agarose gel electrophoresis of PCR product of three spv genes. Lanes 1 and 2 PCR product of spvB gene, Lanes 3 and 4 PCR product of spvR gene, Lanes 5 and 6 PCR product of spvC gene, Lane 7 50 bp DNA marker

Results

Among 60 different salmonella isolates, the prevalence of spvB, spvC, and spvR genes were 26 (43.3 %), 44 (73.3 %), and 28 (46.6 %), respectively. S. colindal detected from poultry and S. Virchow obtained from animals did not show the presence of these virulence genes. Furthermore, 14 serotypes (four S. enteritidis and two S. typhimurium isolated from poultry and five S. abortusovis, two S. typhimurium, and one S. enteritidis detected from animals) were positive for occurrence of these three virulence genes concurrently. All strains with spvR gene had one or both of the other spv genes. Just one S. infantis isolated from poultry had both spvB and spvC genes, while four other analogous strains did not have these genes. The detailed results of PCR detection of three spv virulence genes in different Salmonella serotypes with various sources are presented in Table 2.

Discussion

Yet, more than 2,500 serovars of S. enterica have been identified using the Kauffman-White typing scheme, of which about 20 serovars [22] cause the vast majority of cases of disorders, as these strains are widely distributed amongst domestic food animals and so enter the food chain [23]. A number of central gene regulatory functions govern the life and growth of salmonellae, and these have been studied for decades [24]. Non-typhoid Salmonella strains associated with extra-intestinal infections in humans and animals carry an additional locus termed spv including five genes [5, 25]. Genetic analysis demonstrates that the spvR and spvBC genes are required for the virulence phenotype of the spv locus [11]. Based on previous studies, of the most commonly isolated serovars from stool cultures only Typhimurium and Enteritidis can carry virulence plasmids that encode the spv operon, indicating that spv genes are not required to cause gastroenteritis in people [7]. Few studies have been conducted on the prevalence of these genes in different serovars of Salmonella in all parts of the world, especially in Iran [26, 27]. This study is the first report of distribution of spvB, spvC genes in S.abortusovis and S. infantis isolated from animals and poultry in Iran. In epidemiologically unrelated isolates from different states in the United States, 76 % of the blood isolates carried spv genes, about twice the percentage of fecal isolates [7]. In the present study, the prevalence of these three genes, spvB, spvC and spvR in all of the salmonella serotypes were 43.3 % (26/60), 73.3 % (44/60) and 46.6 % (28/60) respectively. Zahraei et al. [27] revealed that spvB and spvC genes were present in 90 % of the isolates (18/20). They reported that the prevalence of these genes in poultry and bovine S. enteritidis isolates were 88.6 and 100 % respectively, while in the present study the presence of spvB and spvC genes in poultry isolated S. enteritidis was 46.6 % (7/15) and 93.3 % (14/15) respectively. Another study has reported the lack of spvC gene in 7.2 % (8/110) of the S. enteritidis samples from human, pig, and poultry sources [28]. Zahraei et al. [27] showed that the spv genes were not detected in 5.9 % of isolates of the S. enteritidis as compared with 7.4 % of the isolates reported by Pan and Liu [29]. A study reported in 2000 has shown that among a total of 17 isolates of S. enteritidis and S.typhimurium, all samples possessed spvC [30]. Ling [31] analyzed 152 isolates of S. enteritidis from human feces in which only 4 isolates (8 %) lacked spvC. Although, Zahraei et al. [27], have proposed the increase in spv genes in S. enteritidis in recent years these prevalence diversities of one gene may be due to genetic differences between strains from different geographic areas. Findings showed that, among animal S. enteritidis isolates, 28.57 % (2/7) and 85.7 % (6/7) had spvB and spvC virulence genes, respectively. Prevalence of spvR gene in poultry and animal S. enteritidis isolates was 60 % (9/15) and 42.8 % (3/7) respectively and 46.6 % (28/60) in total of strains, which is against the results of Bacci et al. [32] that showed 100 % presence of spvR gene in different serovars. They reported that some plasmid-negative strains had spv genes, and which be due to the creation of episome mode [32]. Unlike them, we suggested that the lack of some spv genes in salmonella serotypes could be due to the existence of incomplete spv locus, rather than the transfer of genes into the chromosomal DNA. Among twelve S. abortusovis serovars studied in this study, distribution of spvB, spvC and spvR genes was 66.6, 83.3 and 53.3 % respectively and 41.6 % (5/12) of them had three spv genes simultaneously, which may increase the propensity of these strains to be of major clinical relevance in coordination with the results of Gebreyes et al. [33]. Furthermore, all 28 strains with spvR gene simultaneously had one or both of the other spv genes. Although spvR is a positive transcriptional regulator of spvABCD, it seems that these serovars could express their related spv genes and may be more virulent in pathogenicity [8]. S. colindal and S. virchow serotype in the present study did not show the presence of spv genes. To clarify the subject, more investigations are proposed for the presence or absence of spv locus genes in these serovars. One of two S. bardo isolated from human showed only the presence of spvB gene. In addition, three human S. enteritis serovars did not have spvB gene, but two of them indicated concurrent presence of spvC and spvR. However, one out of five S. infantis strains obtained from poultry had both spvB and spvC genes and neither had spvR gene. The evidence taken from this study confirms the results of other studies which show a higher distribution for the virulence plasmid from animal-origin isolates than that of human-origin [26, 27]. The findings of the present study suggest a dissimilar distribution of spvB, spvC and spvRgenes among Salmonella serotypes from different sources. Genetic variations in Salmonella could be derived from the transfer of virulence plasmid from animal-origin strains to human-origin strains or vice versa, which remains to be investigated. It is becoming clear that epidemiological investigations about bacterial virulence factor genes are essential to understand the biology of bacterial abnormalities, rapid diagnosis of infections, for treatment of their disorders and producing ideal vaccines against them. Results demonstrated that the prevalence of spv genes is different among various salmonella serovars. Strains isolated from animals showed a higher prevalence of these genes.

Acknowledgments

This work was supported by a Grant from Shiraz University. The authors are grateful to Mr. Shahed for his excellent technical assistance.

References

  • 1.Madadgar O, Zahraei Salehi T, Tadjbaksh H, Mahzounieh M, Feizabadi M. Genomic and phenotypic evaluation of Salmonella typhimurium and Salmonella enteritidis in Iran. Comp Clin Pathol. 2008;17:229–235. doi: 10.1007/s00580-008-0745-z. [DOI] [Google Scholar]
  • 2.Coburn B, Grassl GA, Finlay BB. Salmonella, the host and disease: a brief review. Immunol Cell Biol. 2007;85:112–118. doi: 10.1038/sj.icb.7100007. [DOI] [PubMed] [Google Scholar]
  • 3.Ranjbar R, Giammanco GM, Aleo A, Plano MR, Naghoni A, Owlia P, Mammina C. Characterization of the first extended—spectrum beta lactamase—producing nonthyphoidal Salmonella strains isolated in Tehran, Iran. Foodborne Pathog Dis. 2010;7(1):91–95. doi: 10.1089/fpd.2009.0382. [DOI] [PubMed] [Google Scholar]
  • 4.Malkawi HI, Gharaibeh R. Rapid and simultaneous Identification of two Salmonella enterica serotypes Enteritidis and Typhimurium from chicken and meat product by multiplex PCR. Biotechnology. 2004;3(1):44–48. doi: 10.3923/biotech.2004.44.48. [DOI] [Google Scholar]
  • 5.Guiney DG, Fang FC, Krause M, Libby SJ, Buchmeier N, Fierer J. Biology and clinical significance of virulence plasmids in Salmonella. Clin Infect Dis. 1995;21:146–151. doi: 10.1093/clinids/21.Supplement_2.S146. [DOI] [PubMed] [Google Scholar]
  • 6.Heithoff DM, Shimp WR, lau PW, Badie G, Enioutina EY, Daynes RA, Barbara RA, Byrne A, House J, Mahan MJ. Human Salmonella clinical isolates distinct from those of animal origin. Appl Environ Microbiol. 2008;10:1757–1766. doi: 10.1128/AEM.02740-07. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Guiney DG, Fierer J. The role of the spv genes in Salmonella pathogenesis. Front Microbiol. 2011;2(129):1–10. doi: 10.3389/fmicb.2011.00129. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8.Libby SJ, Adams LG, Ficht TA, Allen C, Whitford HA, Buchmeier NA, Bossie S, Guiney DG. The spv genes on the Salmonella Dublin virulence plasmid are required for severe enteritis and systemic infection in the natural host. Infect Immun. 1997;65(5):1786–1792. doi: 10.1128/iai.65.5.1786-1792.1997. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Krause M, Fang FC, Guiney DG. Regulation of plasmid virulence gene expression in Salmonella dublin involves an unusual operon structure. J Bacteriol. 1992;174:4482–4489. doi: 10.1128/jb.174.13.4482-4489.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Libby SJ, Lesnick M, Hasegawa P, Kurth M, Belcher C, Fierer J, Guiney DG. Characterization of the spv locus in Salmonella enterica serovar Arizona. Infect Immun. 2002;70:3290–3294. doi: 10.1128/IAI.70.6.3290-3294.2002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Roudier C, Fierer J, Guiney DG. Characterization of translation termination mutations in the spv operon of the Salmonella virulence plasmid pSDL2. J Bacteriol. 1992;174:6418–6423. doi: 10.1128/jb.174.20.6418-6423.1992. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Hochmann H, Pust S, von Figura G, Aktories K, Barth H. Salmonella enterica SpvB ADP-ribosylates actin at position arginine-177-characterization of the catalytic domain within the SpvB protein and a comparison to binary clostridial actin-ADP-ribosylating toxins. Biochemistry. 2006;45:1271–1277. doi: 10.1021/bi051810w. [DOI] [PubMed] [Google Scholar]
  • 13.Lesnick ML, Reiner NE, Fierer J, Guiney DG. The SalmonellaspvB virulence gene encodes an enzyme that ADP ribosylates actin and destabilizes the cytoskeleton of eukaryotic cells. Mol Microbiol. 2001;39:1464–1470. doi: 10.1046/j.1365-2958.2001.02360.x. [DOI] [PubMed] [Google Scholar]
  • 14.Paesold G, Guiney DG, Eckmann L, Kagnoff MF. Genes in the Salmonella pathogenicity island 2 and the Salmonella virulence plasmid are essential for Salmonella induced apoptosis in intestinal epithelial cells. Cell Microbiol. 2002;4:771–781. doi: 10.1046/j.1462-5822.2002.00233.x. [DOI] [PubMed] [Google Scholar]
  • 15.Li H, Xu H, Zhou Y, Zhang J, Long C, Li S, Chen S, Zhou JM, Shao F. The phosphothreonine lyase activity of a bacterial type III effector family. Science. 2007;315:1000–1003. doi: 10.1126/science.1138960. [DOI] [PubMed] [Google Scholar]
  • 16.Mazurkiewicz P, Thomas J, Thompson JA, Liu M, Arbibe L, Sansonetti P, Holden DW. SpvC is a Salmonella effector with phosphothreoninelyase activity on host mitogen activated protein kinases. Mol Microbiol. 2008;67:1371–1383. doi: 10.1111/j.1365-2958.2008.06134.x. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Grob P, Guiney DG. In vitro binding of the Salmonella dublin virulence plasmid regulatory protein SpvR to the promoter region of spvA and spvR. J Bacteriol. 1996;178:1813–1820. doi: 10.1128/jb.178.7.1813-1820.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Trafny EA, Kozlowska K, Szpakowska M. A novel Multiplex PCR assay for the detection of Salmonella enteric serovar Enteritidis in human faeces. Lett Appl Microbiol. 2006;43:673–679. doi: 10.1111/j.1472-765X.2006.02007.x. [DOI] [PubMed] [Google Scholar]
  • 19.Lin AW, Usera MA, Barrett TJ, et al. Application of random amplified polymorphic DNA analysis to differentiate strains of Salmonella enteritidis. J Clin Microbiol. 1996;34:870–876. doi: 10.1128/jcm.34.4.870-876.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Swamy SC, Barnhart H, Lee MD, Dreesen DW. Virulence determinants invA and spvC in Salmonellae isolated from poultry products, wastewater, and human sources. Appl Environ Microbiol. 1996;62:3768–3771. doi: 10.1128/aem.62.10.3768-3771.1996. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Huang R, Wu S, Zhang X, Zhang Y. Molecular analysis and identification of virulence gene on pRST98 from multi-drug resistant Salmonella typhi. Cell Mol Immunol. 2005;2:136–140. [PubMed] [Google Scholar]
  • 22.Jones TF, Ingram LA, Cieslak PR, Vugia DJ, Tobin-D’Angelo M, Hurd S, Medus C, Cronquist A, Angulo FJ. Salmonellosis outcomes differ substantially by serotype. J Infect Dis. 2008;198:109–114. doi: 10.1086/588823. [DOI] [PubMed] [Google Scholar]
  • 23.Foley SL, Lynne AM. Food animal associated Salmonella challenges: pathogenicity and antimicrobial resistance. J Anim Sci. 2008;86:173–187. doi: 10.2527/jas.2007-0447. [DOI] [PubMed] [Google Scholar]
  • 24.Clements M, Eriksson S, Tezcan-Merdol D, Hinton JCD, Rhen M. Virulence gene regulation in Salmonella enterica. Ann Med. 2001;33:178–185. doi: 10.3109/07853890109002075. [DOI] [PubMed] [Google Scholar]
  • 25.Fierer J, Guiney DG. Diverse virulence traits underlying different clinical outcomes of Salmonella infection. J Clin Invest. 2001;107:775–780. doi: 10.1172/JCI12561. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26.Del Cerro A, Soto SM, Mendoza MC. Virulence and antimicrobial-resistance gene profiles determined by PCR-based procedures for Salmonella isolated from samples of animal origin. Food Microbiol. 2003;20:431–436. doi: 10.1016/S0740-0020(02)00145-4. [DOI] [Google Scholar]
  • 27.Zahraei Salehi T, Amini K, Nikbakht G, Ranjbar R, Amini J, Ashrafganjooei SB. Molecular detection of invA and spv virulence genes in Salmonella enteritidis isolated from human and animals in Iran. Afr J Microbiol Res. 2008;4(21):2202–2210. [Google Scholar]
  • 28.Castilla KS, Ferreira CSA, Moreno AM, Nunes IA, Ferreira AJP.Distribution of virulence genes sefC, pefA and spvC in Salmonella Enteritidis phage type 4 strains isolated in Brazil Braz J Microbiol 20063721–7. 10.1590/S1517-8382200600020000720445761 [DOI] [Google Scholar]
  • 29.Pan TM, Liu YJ. Identification of Salmonella Enteritidis isolate by polymerase chain reaction and multiplex polymerase chain reaction. J Microbiol Immuno Infect. 2002;35:147–151. [PubMed] [Google Scholar]
  • 30.Jenikova G, Pazlarova J, Demnerova K. Detection of Salmonella in food sample by the combination of immunomagnetic separation and PCR assay. Int Microbiol. 2000;3:225–229. [PubMed] [Google Scholar]
  • 31.Ling JML. Rapid detection of food-borne pathogens in clinical specimens, food and environmental samples. Hong Kong Med J. 2009;15(1):26–29. [PubMed] [Google Scholar]
  • 32.Bacci C, Paris A, Salsi A, Bonardi S, Brindani F. Relation between the presence of extrachromosomal DNA and virulence features in Salmonella enterica strains. Ann Fac Medic Vet Di Parma. 2005;25:175–180. [Google Scholar]
  • 33.Gebreyes WA, Thakur S, Dorr P, Tadesse DA, Post K, Wolf L. Occurrence of spvA virulence Gene and clinical significance for Multidrug-Resistant Salmonella strains. J Clin Microbiol. 2009;10:777–780. doi: 10.1128/JCM.01660-08. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Indian Journal of Microbiology are provided here courtesy of Springer

RESOURCES