Skip to main content
Journal of Bacteriology logoLink to Journal of Bacteriology
. 2013 Mar;195(6):1204–1213. doi: 10.1128/JB.02041-12

Identification of CodY Targets in Bacillus anthracis by Genome-Wide In Vitro Binding Analysis

A Château a,b,c,*, W van Schaik a,b,*, P Joseph c,*, L D Handke c,*, S M McBride c,*, F M H Smeets a,b, A L Sonenshein c,✉, A Fouet a,b,d,e,f,✉
PMCID: PMC3591999  PMID: 23292769

Abstract

In Gram-positive bacteria, CodY is an important regulator of genes whose expression changes under conditions of nutrient limitation. Bacillus anthracis CodY represses or activates directly or indirectly approximately 500 genes. Affinity purification of CodY-DNA complexes was used to identify the direct targets of CodY. Of the 389 DNA binding sites that were copurified with CodY, 132 sites were in or near the regulatory regions governing the expression of 197 CodY-controlled genes, indicating that CodY controls many other genes indirectly. CodY-binding specificity was verified using electrophoretic mobility shift and DNase I footprinting assays for three CodY targets. Analysis of the bound sequences led to the identification of a B. anthracis CodY-binding consensus motif that was found in 366 of the 389 affinity-purified DNA regions. Regulation of the expression of the two genes directly controlled by CodY, sap and eag, encoding the two surface layer (S-layer) proteins, was analyzed further by monitoring the expression of transcriptional lacZ reporter fusions in parental and codY mutant strains. CodY proved to be a direct repressor of both sap and eag expression. Since the expression of the S-layer genes is under the control of both CodY and PagR (a regulator that responds to bicarbonate), their expression levels respond to both metabolic and environmental cues.

INTRODUCTION

The Gram-positive spore-forming pathogen Bacillus anthracis is the causative agent of anthrax. Anthrax is primarily a disease of herbivores, but it can also be found in humans and other mammals (1). B. anthracis spores initiate infection. Once inside the host, the spores germinate, generating vegetative cells that multiply in host tissues. It is during this proliferative stage that B. anthracis produces its key virulence factors, namely, a tripartite toxin and a poly-γ-d-glutamate capsule, which are encoded on the virulence plasmids pXO1 and pXO2, respectively. The production of toxin and capsule responds to environmental cues, such as the presence of CO2 and bicarbonate and a temperature of 37°C (2, 3). The production of toxin components is low during exponential growth and reaches its highest levels during entry into the stationary phase (3, 4). The regulator protein AtxA, which is encoded by pXO1, is essential for the expression of toxin components, and, during in vitro growth, it influences the expression of the capsule (cap) operon (4–7).

The global regulatory protein CodY influences the expression of many metabolic and virulence genes in Gram-positive pathogens in response to the availability of GTP and the branched-chain amino acids (isoleucine, leucine, and valine) (8, 9). In B. anthracis, CodY indirectly activates toxin gene expression, apparently by influencing AtxA stability (10, 11). In contrast, the deletion of codY does not affect B. anthracis capsulation (12). Evidently, the dramatically lowered AtxA levels in the codY mutant do not result in decreased expression of the capsule operon.

Genome-wide transcriptional profiling of the codY mutant strain indicated that a codY-null mutation affected the expression of >200 genes during both the exponential and early stationary phases and approximately 500 genes during at least one of these two growth phases (11). CodY acts as a negative regulator of many of these genes and activates the expression of other genes, including those encoding iron uptake and detoxification systems, in addition to the toxin genes (11). CodY is needed for the uptake of organic iron compounds, and consequently, the deletion of codY may lead to an in vivo growth defect when iron becomes the limiting factor for growth (12).

The transcription profiling experiment revealed that sap and eag, which encode the components Sap and EA1, respectively, of the surface layer (or S-layer) (13, 14), are among the genes repressed by CodY. The S-layer of B. anthracis is a proteinaceous paracrystalline sheath that forms the outermost surface structure of noncapsulated vegetative cells (15). The function of the S-layer of B. anthracis is not completely clear; it might act as a molecular sieve or it might protect the bacterium from the actions of complement (16). However, the deletion of B. anthracis S-layer-encoding genes has no discernible effect on virulence (17). In cells grown in rich medium, sap and eag are temporally regulated. In addition, Sap represses eag transcription (18). In contrast, during the growth of B. anthracis inside the host or in a defined medium containing bicarbonate, eag is expressed at higher levels than sap (14, 19). This differential regulation is due to the indirect action of AtxA on the expression of these genes. The regulator PagR, which binds to the promoter regions of both sap and eag, acts as a repressor of sap and an activator of eag transcription. The pagR gene is the second gene of the AtxA-dependent pagAR operon (19–21).

The in silico analysis of our global transcription results showed that many CodY-controlled genes are associated with a sequence reminiscent of the consensus CodY-binding site first identified in Lactococcus lactis (22, 23); this implies that these genes are direct targets of CodY-mediated regulation. To determine more rigorously which genes are the direct targets of CodY, we used an affinity purification assay (24, 25) and extended this analysis by using gel shift, DNase I footprinting, and lacZ fusion experiments for three target genes. Our results reveal >130 CodY-binding sites that control the expression of 197 genes, as well as additional CodY-binding sites that either control genes under conditions not yet tested or play no role in transcriptional control. The sap and eag genes proved to be among the direct targets of CodY. The sites of CodY binding in their regulatory regions identified by affinity purification were confirmed by DNase I footprinting. Moreover, the transcriptional regulation of sap and eag by CodY was confirmed by an analysis of lacZ transcriptional fusions.

MATERIALS AND METHODS

Strains and growth conditions.

The B. anthracis strain RTC10 (pXO1 lef686 cya346-353, pXO2 ΔcapB) (26) was used to prepare the DNA for the pulldown experiments. The strains harboring lacZ transcriptional fusions were used to assay transcription initiating from the relevant promoters: 7SZ (sap-lacZ) and 7EZ (eag-lacZ) and their codY derivatives, 7SZC and 7EZC (19 and this study). All work with B. anthracis strains was carried out in accordance with the biosafety guidelines mandated by the country in which each assay was performed.

Growth of the cultures was followed by measuring the absorbance at 600 nm (A600). B. anthracis precultures were grown overnight at 37°C in BHI (brain heart infusion) (Difco) medium supplemented with 0.5% glycerol, with rotary shaking at 150 rpm. Experimental cultures were grown at 37°C under a 5% CO2 atmosphere in R medium (27) supplemented with 0.6% sodium bicarbonate (RBic) (2). RBic was inoculated from an overnight culture to a starting A600 of 0.05. Aeration of the culture was achieved by continuous stirring with a magnetic bar at 450 rpm. For DNA extraction, the culture was grown at 37°C in BHI until it reached mid-exponential phase (A600 = 0.8). The antibiotics used were spectinomycin (100 μg/ml) and kanamycin (40 μg/ml).

Generation of codY mutants in B. anthracis.

A null mutation in the codY gene generated by the insertion of a spectinomycin resistance cassette at codon 77 of codY has been described (11). The mutation was transferred by filter mating using E. coli HB101(pRK24)(pCOD30) as the donor and B. anthracis strain 7SZ or 7EZ as the recipient (19, 28, 29).

Overexpression and purification of B. anthracis CodY.

E. coli strain JM107(pJP15) (11) was grown in Luria broth containing ampicillin (50 μg/ml) to an A600 of 0.7. Expression of the codY gene was induced by the addition of arabinose to a final concentration of 0.2%. After 4 h of further incubation, the cells were harvested and CodY-His6 was purified using a previously described method (30). Elution from the Talon Co2+ metal affinity column (Clontech) was carried out using a buffer containing 20 mM Tris-HCl (pH 8.0), 125 mM KCl, 5 mM β-mercaptoethanol, 10% (vol/vol) glycerol, 1 mM phenylmethylsulfonyl fluoride, 2 μM pepstatin-A, and 75 mM imidazole. The purified B. anthracis CodY protein was free of contaminating proteins as tested by SDS-PAGE and was stored in 20-μl aliquots at −80°C. For each experiment, one tube of protein solution was removed from the freezer, thawed, and diluted as needed.

Affinity purification of CodY-DNA complexes and analysis using the Illumina genome analyzer II.

Genomic DNA was extracted from B. anthracis RTC10 as described in reference 31. Four samples of 10 μg of DNA each were dissolved in 500 μl of sterile deionized water and sheared by sonication. The method used was initially developed by Majerczyk et al. (25) and improved by Dineen et al. (24). In brief, adapters were ligated to the ends of the sheared DNA fragments and DNA fragments of 300 to 500 bp were purified. Amplification of the fragments was performed by PCR using primers that were complementary to the adapter sequences. The DNA fragments were incubated with purified His6-tagged B. anthracis CodY (50 or 100 nM) in the presence of the coeffectors, 5 mM GTP and 10 mM each isoleucine, leucine, and valine. A negative control consisted of carrying out the same experiment using purified Bacillus subtilis His10-aconitase (32) in place of B. anthracis CodY. Purification of CodY that was bound to its target genes was performed on a Talon Co2+ metal affinity resin (Clontech). The DNA fragments that copurified with the His-tagged proteins were sequenced bidirectionally by the Tufts University Nucleic Acid and Protein Core Facility using an Illumina genome analyzer II.

The sequence data were analyzed in two ways. First, the sequences of the first 40 bp and last 40 bp of each DNA fragment were determined directly. Then, for each fragment, the sequence between the ends was filled empirically based on the reference sequence of the B. anthracis Sterne strain chromosome (NCBI accession no. NC_005945) and plasmids pXO1 (NCBI accession no. NC_007322) and pXO2 (NCBI accession no. NC_007323). Using the bioinformatics tools available through the Galaxy Project (33–35), the sequence data were filtered for quality using the NGS QC algorithm with a quality cutoff of 7 for 90% of the bases. About 10% of reads were discarded as being of low quality. The remaining reads were aligned against the B. anthracis Sterne genome sequence and pXO1 and pXO2 sequences using the next-generation sequencing (NGS) mapping tool Bowtie (settings, trim 5 nucleotides [nt] from the 3′ end; allow 3 mismatches; quality value = 70; seed length = 23; “best” option). The resulting alignments were then analyzed using Hop-Count, which plots the number of times each nucleotide appears as the first base after the adapter at the 5′ end of the DNA fragment being sequenced. Hop-Count is a script written by K. Bodi and D. Lazinski for the Tufts Nucleic Acid and Protein Core Facility. Following an approach devised by B. Belitsky (unpublished data), the Hop-Count output was manually scanned for regions in which reads appeared on the top strand but not on the bottom strand, followed by a region with counts on the bottom strand but not on the top strand. In >90% of cases, the bases at the junction between the regions on the top and bottom strands had few, if any, reads and were taken to define the nucleotides essential for CodY binding. For the data compilation reported in Table S1 in the supplemental material, only regions detected in at least two independent experiments were included.

In silico analysis.

Of the 389 identified target sequences, 375 binding sites that consisted of ≥8 bp were searched for conserved motifs using the MEME suite v4.8.1 (36). The parameters were as follows: 0 to 1 occurrence per fragment on either strand of DNA and a width of 6 to 50 nt.

Gel mobility shift and DNase I footprinting assays.

For gel mobility shift assays, DNA probes were amplified by PCR using a 5′-end 32P-labeled primer, or the PCR product was labeled after amplification. Methods for primer labeling, binding of CodY to DNA, and electrophoresis of DNA-protein complexes in nondenaturing polyacrylamide gels have been described (30). To locate CodY-binding sites precisely, PCR products labeled at the 5′ end of only one strand were incubated with CodY, treated with RQ1 RNase-free DNase (Promega), and subjected to electrophoresis in urea-polyacrylamide gels as described previously (30, 37). A DNA sequence ladder was run alongside the DNase I digestion products. The ladder was prepared by the Sanger method, using the Sequenase kit (United States Biochemical) and [α-35S]dATP, as recommended by the manufacturer. The primers used were oPJ37 (GGTATGGTAATTTTGAAAAATCTAACGCTA) and oPJ38 (CGACAAAAAAGTGAATTTTCACAATTCTAA) for the sap gene, oPJ36 (CCTCCTTCAGGAATATGCTACTAGTTTTAC) and oPJ33 (GCGCTTTCAAAAATAGAAGAATACCTCATT) for the eag gene, and oPJ29 (GCTATTTCAATAGAAGAAACAAAAAACCAA) and oPJ44 (CGATGGATATCGGTGTTAGCATGTC) for the atxA gene.

β-Galactosidase assays.

The accumulation of β-galactosidase by the various lacZ fusion strains was determined as described previously (3) in samples taken during growth in RBic at 37°C in a 5% CO2 atmosphere. All experiments were performed at least in triplicate; the representative results are shown below (see Fig. 4).

Fig 4.

Fig 4

CodY affects transcription of sap and eag. B. anthracis 7EZ (eag-lacZ) and 7SZ (sap-lacZ) (circles) and their respective codY mutants (squares) were grown in RBic medium under a 5% CO2 atmosphere. Growth was followed by A600 measurements (open symbols), and the transcription of sap and eag was determined by measuring β-galactosidase activity (closed symbols). The results shown are representative of three independent experiments.

RESULTS

Genome-wide identification of direct CodY targets.

Previous genome-wide transcriptional profiling showed that >200 genes are differentially expressed during the exponential and early stationary growth phases and that >500 genes are differentially expressed during at least one of these growth phases in a codY-null mutant of B. anthracis compared to in its parent strain (11). However, this analysis did not distinguish between direct (binding of CodY to target promoters) and indirect regulation of transcription. To identify genes that are directly controlled by CodY, we performed an affinity purification experiment using purified His6-tagged B. anthracis CodY as bait, based on a method developed by Majerczyk et al. and Dineen et al. (24, 25). Three hundred eighty-nine CodY-binding regions were detected in at least two of three independent experiments (see Table S1 in the supplemental material). In 16 cases, more than one region was identified upstream of a single gene. Of the 389 regions identified (see Table S1), 132 regions were within the putative regulatory regions of 131 transcription units, containing 197 genes (Table 1) whose expression was shown previously to be affected by the disruption of codY (11). Thus, all of these genes appeared to be under the direct control of CodY. Of these 197 genes, 182 were repressed by and 15 were activated by CodY. The repressed genes include those encoding proteins involved in amino acid biosynthesis and transport, as well as nucleic acid metabolism, the pentose pathway, the tricarboxylic acid cycle, acetyl coenzyme A synthesis, and oxidative stress functions. Nine genes coding for regulatory proteins appeared to be repressed directly by CodY, including nprR and sinR. Furthermore, CodY bound to sites upstream of and within BAS0093, the gene that encodes the RNA polymerase sigma factor σH. Our analysis also revealed that the S-layer genes sap and eag are direct targets of CodY. Transcriptional profiling previously indicated that CodY represses the expression of these genes (11).

Table 1.

Regions of the B. anthracis genome selected by in vitro binding of CodY

Coordinates (start to end)a Position relative to coding sequence Potential targetb,c gene Putative target gene function Fold-change microarrayd,e
A600 = 0.2 A600 = 1.0
Chromosome
    15371–15390 Upstream BAS0011 (guaB) IMP dehydrogenase 6.5 4.7
    41312–41347 Upstream BAS0036 (abrB) Transition state regulator ND 0.41
    73440–73533 Upstream BAS0067 (cysK-1) Cysteine synthase A ND 0.36
    102880–102952 Upstream BAS0093 (sigH) RNA polymerase sigma-H factor 0.29 0.6
    103459–103483 Within BAS0093 (sigH) RNA polymerase sigma-H factor 0.29 0.6
    218863–219056 Upstream BAS0218 Oligopeptide ABC transporter substrate-binding protein ND 0.13
    226686–226720 Upstream BAS0226 (hpp)* 4-Hydroxyphenylpyruvate dioxygenase 0.07 0.13
    230217–230315 Upstream BAS0229 Major facilitator family transporter 0.37 0.37
    338219–338258 Upstream BAS0314 Aminopeptidase AmpS 0.33 ND
    525660–525695 Upstream BAS0498 Glutamate synthase, large subunit 0.25 0.46
    548451–548475 Upstream BAS0518 Hypothetical protein 0.2 0.43
    611816–612018 Upstream BAS0566 (nprR)* Transcriptional regulator 0.19 0.33
    613543–613558 Upstream BAS0567 (nprB) Neutral protease 0.15 0.29
    628955–628973 Upstream BAS0580 Proton/peptide symporter family protein 17.9 13.6
    660284–660452 Upstream BAS0610 Amino acid ABC transporter permease 0.46 0.47
    688599–688933 Upstream BAS0638 (inhA2) Immune inhibitor A metalloprotease 0.06 0.09
    714089–714124 Upstream BAS0660 Xanthine/uracil permease family protein 4.3 4.3
    723269–723285 Upstream BAS0669 Quinol oxidase subunit II ND 2.5
    831170–831178 Upstream BAS0779 Amino acid permease 0.04 ND
    859284–859309 Upstream BAS0809 ABC transporter ATP-binding protein/permease 0.19 ND
    896336–896512 Upstream BAS0841 (sap) S-layer protein, Sap 0.18 ND
    899355–899413 Upstream BAS0842 (eag) S-layer protein, EA1 0.04 ND
    899525–899553 Upstream BAS0842 (eag) S-layer protein, EA1 0.04 ND
    909509–909607 Upstream BAS0847 Hypothetical protein 0.26 ND
Upstream BAS0848* Enoyl-CoA hydratase 0.34 ND
    1075667–1075805 Within BAS1022 Wall-associated protein 11.9 ND
    1141119–1141158 Upstream BAS1089 Hypothetical protein 0.33 ND
    1160748–1160829 Upstream BAS1107 Oligopeptide ABC transporter substrate-binding protein 7.5 11
    1240253–1240257 Upstream BAS1196 (sinI)* SinI protein 0.14 0.28
Upstream BAS1197 (inhA1) Immune inhibitor A metalloprotease 0.01 0.01
    1262756–1262940 Upstream BAS1216 Hypothetical protein 0.39 ND
    1272738–1272770 Upstream BAS1228* PadR family transcriptional regulator 0.41 ND
Upstream BAS1229* PhaR protein 0.07 0.18
    1296547–1296595 Upstream BAS1255 Hypothetical protein 0.07 0.40
    1316059–1316118 Upstream BAS1281 Hypothetical protein 0.31 ND
    1327364–1327404 Upstream BAS1293 Bla/Mec family transcriptional regulator 0.22 0.35
    1339040–1339093 Upstream BAS1307* Branched-chain amino acid aminotransferase 0.01 0.01
    1345169–1345198 Upstream BAS1312 3-Isopropylmalate dehydrogenase 0.01 0.01
    1350300–1350370 Within BAS1316 (hisG) ATP phosphoribosyltransferase ND 0.28
    1408429–1408467 Upstream BAS1376* Hypothetical protein 0.27 0.31
    1408807–1408869 Upstream BAS1377 Hypothetical protein 0.38 0.46
    1414452–1414476 Upstream BAS1384 ResB protein 0.34 0.42
    1544764–1544827 Upstream BAS1512* Cold shock protein CspB ND 3.8
    1547523–1547563 Upstream BAS1517 Hypothetical protein ND 0.34
    1594231–1594417 Upstream BAS1573 Hypothetical protein 0.44 0.41
    1730383–1730439 Upstream BAS1713 Branched-chain amino acid aminotransferase 0.13 0.08
    1731059–1731100 Upstream BAS1713 Branched-chain amino acid aminotransferase 0.13 0.08
    1737014–1737109 Within BAS1718 Threonine dehydratase 0.10 0.06
    1784227–1784259 Upstream BAS1763 Xaa-Pro aminopeptidase 0.28 0.34
    1845838–1845875 Upstream BAS1820 Aminoglycoside 6-adenylyltransferase 0.45 ND
    1850239–1850264 Upstream BAS1825* Homoserine dehydrogenase ND 0.28
    1851801–1851869 Within/upstream BAS1825*/BAS1826 Homoserine dehydrogenase/threonine synthase ND 0.28/0.31
    1878275–1878294 Upstream BAS1853* Hypothetical protein ND 0.34
    1887952–1888031 Upstream BAS1866 Ribosome-associated GTPase 0.33 0.45
    1894901–1894936 Upstream BAS1873 Hypothetical protein ND 0.32
    1916527–1916633 Upstream/start BAS1895 Fosfomycin resistance protein FosB ND 0.49
    1933891–1933922 Upstream BAS1916 Branched-chain amino acid transport system II carrier protein ND 0.35
    1946712–1946796 Upstream BAS1932 Alanine racemase ND 0.38
    1980054–1980077 Upstream BAS1975* Hypothetical protein 0.06 0.06
    2076907–2075914 Upstream BAS2067 Aspartate racemase 0.40 0.39
    2103632–2103712 Upstream BAS2100 d-Amino acid aminotransferase 0.19 0.25
    2115360–2115409 Upstream BAS2113 Hypothetical protein 0.36 ND
    2122151–2122209 Upstream BAS2122* Azoreductase 0.18 0.32
    2182362–2182473 Upstream BAS2188 Citrate synthase 3 0.01 0.02
    2211175–2211213 Within BAS2208 Nonribosomal peptide synthetase DhbF 33.3 ND
    2260117–2260143 Upstream BAS2261 HAD superfamily hydrolase ND 0.29
    2362344–2362368 Upstream BAS2360* Hypothetical protein 0.17 ND
    2370310–2370337 Upstream BAS2369* Acyl-CoA dehydrogenase 0.11 0.36
    2567845–2568001 Upstream BAS2567* Kynureninase 0.31 0.34
    2569082–2569180 Upstream BAS2569 MutT/Nudix family protein 0.49 0.45
    2649951–2649973 Upstream BAS2664 Hypothetical protein 0.24 ND
    2652172–2652185 Upstream BAS2667 X-prolyl-dipeptidyl aminopeptidase 0.04 0.05
    2701105–2701226 Upstream BAS2722* Aminoglycoside N3-acetyltransferase 0.38 0.48
    2765653–2765696 Upstream BAS2785 IclR family transcriptional regulator 0.32 0.30
    2765754–2765801 Upstream BAS2785 IclR family transcriptional regulator 0.32 0.30
    2809027–2809179 Upstream BAS2830 MutT/Nudix family protein 0.05 0.41
    2811584–2811656 Upstream BAS2835* GntR family transcriptional regulator 0.03 0.37
    2956380–2956449 Upstream BAS2983 Glyoxylase 0.35 0.49
    3010767–3010790 Upstream BAS3037* Hypothetical protein 0.01 0.01
Upstream BAS3038 LysR family transcriptional regulator ND 0.09
    3053679–3053700 Upstream BAS3072 Isochorismatase family protein 0.24 0.34
    3060852–3061055 Upstream/start BAS3079* Phosphoserine aminotransferase 0.15 0.16
    3201993–3202017 Within BAS3228 Glycosyl transferase family protein 2.7 ND
    3280046–3280069 Upstream BAS3315* Glycolate oxidase subunit GlcD 0.07 0.05
    3318842–3318863 Upstream BAS3348 Aldehyde dehydrogenase 0.09 0.26
    3354721–3354753 Upstream BAS3379 Oligopeptide ABC transporter substrate-binding protein 0.18 0.19
    3381975–3382037 Within BAS3408 Aconitate hydratase 0.30 ND
    3394054–3394086 Upstream BAS3421 Medium-chain-fatty-acid-CoA ligase 0.05 0.06
    3395833–3395844 Upstream BAS3424 Hypothetical protein ND 3.6
    3417205–3417232 Upstream BAS3443 (hutP) Antiterminator HutP 0.15 0.40
    3647195–3647222 Within BAS3682 (xerC) Site-specific tyrosine recombinase XerC ND 0.54
    3647543–3647670 Upstream BAS3682 (xerC) Site-specific tyrosine recombinase XerC ND 0.54
    3800292–3800414 Upstream BAS3850 Hypothetical protein ND 0.43
    3801987–3802007 Upstream BAS3851 (amiF)* Formamidase 0.03 0.05
    3805046–3805095 Within BAS3855 Cytochrome c oxidase subunit I 0.16 0.44
    3806497–3806525 Within BAS3856 Cytochrome c oxidase subunit II 0.17 0.41
    3822014–3822030 Upstream BAS3871* Hypothetical protein 0.10 0.13
    3826974–3827044 Upstream BAS3878 Hypothetical protein ND 0.47
    3843179–3843223 Upstream BAS3894 Hypothetical protein 0.32 ND
    3847974–3848000 Upstream BAS3900 Short chain dehydrogenase 0.13 0.29
    3859657–3859902 Upstream BAS3912 5- Methyltetrahydropteroyltriglutamate-homocysteine S-methyltransferase 0.13 0.07
    3865593–3865622 Upstream BAS3916 Sporulation kinase B 0.12 0.16
Upstream BAS3917 Hypothetical protein 0.37 ND
    3878080–3878289 Upstream BAS3926 Hypothetical protein ND 0.42
    3924839–3924870 Upstream BAS3982* Sodium-dependent symporter family protein 0.02 0.02
    3946199–3946351 Upstream BAS4009 5′-Nucleotidase 0.14 0.17
    3965600–3965617 Upstream BAS4029 Hypothetical protein 0.15 0.31
    4001362–4001531 Within BAS4069 Butyrate kinase 0.37 ND
    4058043–4058167 Within BAS4138 Prolyl 4-hydroxylase subunit alpha 7.4 6.8
    4063390–4063526 Upstream BAS4147 Hypothetical protein 0.19 ND
    4078047–4078075 Upstream BAS4161 ArsR family transcriptional regulator 0.11 0.18
    4080624–4080657 Within BAS4164 Hypothetical protein 0.24 ND
    4108375–4108387 Upstream BAS4193 Cytochrome c-550 0.12 ND
    4108498–4108548 Upstream BAS4193 Cytochrome c-550 0.12 ND
    4167156–4167184 Upstream BAS4253 (phhA) Phenylalanine 4-monooxygenase 0.11 0.11
    4171735–4171781 Upstream BAS4259 Acyl dehydratase MaoC 0.11 0.14
    4204548–4204603 Upstream BAS4293* Rrf2 family protein ND 0.49
    4320800–4320819 Upstream BAS4411 4-Hydroxybenzoyl-CoA thioesterase 0.18 0.20
    4330544–4330717 Upstream BAS4421 TetR family transcriptional regulator 0.16 ND
    4332506–4332520 Upstream BAS4422* Long-chain-fatty-acid-CoA ligase 0.28 ND
    4419232–4419254 Upstream BAS4502 Hypothetical protein 0.19 ND
    4426207–4426226 Upstream BAS4512 Hypothetical protein 0.08 0.16
    4450461–4450480 Upstream BAS4543* Acetyl-CoA synthetase 0.02 0.03
    4466371–4466481 Upstream BAS4560 Acetyl-CoA synthetase 0.05 0.14
Upstream BAS4561* Acetoin utilization protein AcuA 0.08 0.21
    4468996–4469022 Start/within BAS4563 Acetoin utilization protein AcuC 0.07 0.17
    4669518–4669533 Upstream BAS4778* Hypothetical protein 0.13 0.17
    4830500–4830510 Within BAS4949 Iron ABC transporter ATP-binding protein 7.1 ND
    4841944–4841976 Upstream BAS4960 Holin-like protein ND 2.1
    4956684–4956861 Upstream BAS5077 l-Lactate permease 0.26 0.41
    5075428–5075461 Within BAS5194* Ferredoxin, 4Fe-4S 0.10 0.34
    5076900–5076944 Upstream BAS5194* Ferredoxin, 4Fe-4S 0.10 0.34
    5097124–5097156 Upstream BAS5208 Aminopeptidase 0.02 0.03
    5139237–5139259 Upstream BAS5256 Homoserine dehydrogenase ND 0.43
    5152423–5152450 Upstream BAS5269 Carbon starvation protein A 0.12 0.11
    5191639–5191676 Upstream BAS5304 UDP-glucose 4-epimerase 0.10 0.10
    5197185–5197217 Upstream BAS5310 Oligoendopeptidase F 0.13 0.22
pXO1
    125472–125643 Within gbaA_pXO1_0143 (apt) Pseudogene 3.4 3
a

Coordinates of the enriched region.

b

Most probable CodY target; two targets may be possible when the binding region is between two divergently expressed genes.

c

Genes marked with an asterisk are the first genes of a CodY-controlled operon.

d

Expression ratio (B. anthracis 7702 to codY mutant) of the CodY target gene at A600 of 0.2 and 1.0 (11). Boldface type indicates genes that are activated by CodY.

e

ND, no significant difference in expression between B. anthracis 7702 and the codY mutant; CoA, coenzyme A; HAD, haloacid dehalogenase.

Two hundred fifty-seven regions of CodY binding were not linked to genes whose expression levels are known to be controlled by CodY (11). Of these, 52 regions were outside apparent regulatory regions and not close to putatively CodY-controlled genes; 37 of these 52 regions were within a coding sequence (located >150 bp downstream of the translation start codon), and 15 of the 52 regions were located between two convergently transcribed genes. These results suggest that CodY binds in vitro to ≥52 sites at which such binding activity may not affect the transcription of any neighboring genes.

A common motif was sought in the DNA regions that bound CodY using the MEME suite (http://meme.sdsc.edu/meme4_6_1/cgi-bin/meme.cgi). As shown in Fig. 1, a common motif was found in 366 sequences with an overall E value of 1.0 × 10−243. The sequence with the least adherence to the motif had a P value of 3.96 × 10−0.2. Compared to the CodY-binding motifs described for Lactococcus lactis (22, 23), B. subtilis (38), Staphylococcus aureus (25), and Clostridium difficile (24), the motif we retrieved resembles the canonical CodY box without the five nucleotides at the 5′ end.

Fig 1.

Fig 1

B. anthracis CodY-binding motif. A search for common motifs in the 375 chromosomal and plasmid regions enriched in the CodY pulldown experiment was conducted using the MEME suite and the parameters described in Materials and Methods. The motif was found in 366 of the 375 enriched regions, with an E value of 1.0 × 10−243. For reference, the canonical Bacillus CodY box identified previously (38) is shown below the B. anthracis de novo binding motifs.

B. anthracis CodY interacts with the atxA promoter region.

Our affinity purification results indicated that CodY binds to the atxA promoter region. However, our previous results showed that a codY mutation has only a small effect on atxA transcription, specifically during the exponential growth phase (11). We consequently decided to verify the binding of CodY to the atxA promoter region using electrophoretic mobility shift assays (Fig. 2A) and DNase I footprinting experiments (Fig. 2B). The apparent Kd (dissociation constant) for CodY binding to the atxA DNA sequence in the presence of GTP and branched-chain amino acids (BCAAs) was 4 to 8 nM, indicating high-affinity binding. Furthermore, in the absence of the effectors, the Kd was 128 nM; the higher binding activity in the presence of effectors is indicative of specificity. The DNase I footprinting assay revealed a CodY-binding site located between positions +38 and +76 with respect to the P1 promoter (4), which overlaps with the sequence identified in the affinity purification experiment. The apparent contradiction between the transcriptional analysis and the in vitro binding data might be a consequence of the absence of a hypothetical regulatory factor needed for high-level transcription of atxA in exponential-phase cells. Alternatively, a second repressor of atxA might be active in exponential-phase cells. In either case, the inactivation of CodY would have little or no effect on atxA expression during exponential-phase growth.

Fig 2.

Fig 2

Analysis of B. anthracis CodY binding to the atxA promoter region. (A) Electrophoretic mobility shift assays were carried out in the presence of increasing concentrations of CodY and in the presence or absence of CodY coeffectors: 10 mM (each) isoleucine, leucine, and valine and 2 mM GTP. (B) DNase I protection assays of CodY binding to the atxA promoter. A PCR product amplified using the primers oPJ29 and oPJ44 was subjected to treatment with DNase I after incubation with CodY. The concentrations of CodY (nM) in lanes 1 to 10 were 0, 0.5, 1, 2, 4, 8, 16, 32, 64, and 0 nM. Each binding reaction mixture contained 2 mM GTP and 10 mM (each) isoleucine, leucine, and valine. The coordinates denote the regions protected by CodY. The −10 region of the atxA promoter and the transcription start point (bent arrow) are also indicated. A sequencing ladder is shown on the left-hand side of the panel.

B. anthracis CodY interacts with the sap and eag promoter regions.

Repression by the direct binding of CodY to the sap and eag promoter regions, as suggested by the affinity purification results, would explain the overexpression of these genes in the codY mutant, as indicated by the microarray data (11). To confirm the validity of the sequence analysis, we showed by gene-specific PCR that the sap and eag regulatory regions were enriched in the copurified DNA fragments (data not shown). We then tested the ability of purified B. anthracis CodY to interact with these promoter regions using electrophoretic mobility shift assays for sap and DNase I footprinting experiments for both sap and eag (Fig. 3). High-affinity binding of CodY was detected for both promoters. For sap and eag, the apparent Kds for CodY binding in the presence of GTP and BCAAs were 8 nM and 80 nM, respectively (Fig. 3). CodY protected the sap promoter region between positions +48 and +79 with respect to the transcriptional start point, a region that overlapped well with the binding site revealed by affinity purification (Fig. 3B) (Table 2). Since this binding site is located downstream of the transcriptional start site, CodY is very likely to repress sap transcription by acting as a roadblock to RNA polymerase (39). CodY protected two regions of the eag locus, corresponding to positions −86 to −56 and +93 to +123 with respect to the σH-dependent eag transcriptional start site, and positions −316 to −286 and −137 to −107 with respect to the second eag transcriptional start (the major transcriptional start site of eag when cells are grown in RBic medium [18, 19]). Both of these regions were also identified by affinity purification (Fig. 3B) (Table 2). The PagR-binding site (positions +45 to +94 with respect to the σH-dependent transcriptional start site) and the CodY-binding sites identified for eag are directly adjacent to each other.

Fig 3.

Fig 3

Analysis of B. anthracis CodY binding to the sap and eag promoter regions. (A) Electrophoretic mobility shift assays of CodY binding to the sap regulatory region were carried out with increasing concentrations of CodY and in presence or absence of effectors (see legend to Fig. 2). (B) DNase I protection assays of CodY binding to the sap (left panel) and eag (right panel) promoters. Each binding reaction mixture contained 2 mM GTP and 10 mM (each) isoleucine, leucine, and valine. The vertical lines and coordinates denote the regions protected by CodY. Sequencing ladders are shown for each of the probes. For the sap promoter, a 273-bp PCR product was amplified using primers oPJ37 and oPJ38 and was subjected to treatment with DNase I after incubation with CodY. The concentrations of CodY (nM) in lanes 1 to 10 were 0, 2, 4, 8, 16, 32, 64, 128, 256, and 0 nM. For the eag promoter, the DNA fragment was labeled at either extremity. In lanes 1 to 7, the 567-bp probe was synthesized using oPJ36 and radioactively labeled oPJ33; in lanes 8 to 14, the probe was synthesized using oPJ33 and radioactively labeled oPJ36. The CodY concentrations were 0 in lanes 1 and 8, 5 nM in lanes 2 and 9, 10 nM in lanes 3 and 10, 20 nM in lanes 4 and 11, 40 nM in lanes 5 and 12, 80 nM in lanes 6 and 13, and 160 nM in lanes 7 and 14. The positions are given with respect to the transcriptional start site (the σH-dependent start site for eag).

Table 2.

CodY-binding sites in the sap and eag regulatory regionsa

Target gene Binding site by footprinting Binding site by affinity purification MEME-determined CodY motif within canonical CodY box
sap +48 to +79 +21 to +83 +50 TAAAATCAGAATATTT +65
eag −86 to −56 −80 to −53 −79 TGTAGTCTGAAAATTG −64
+93 to +123 +90 to +119 +104 CACATTCTGATAATTC +119
a

Sites of CodY binding determined by DNase I footprinting and affinity purification were associated with motifs corresponding to the MEME-determined consensus motif for B. anthracis CodY-binding sites (in boldface type, TCAGAAAATTC) and the canonical CodY box (AATTTTCNGAAAATT) determined for other bacteria. For the eag gene, the coordinates of the binding sites are relative to the σH-dependent transcription start site.

CodY is a negative regulator of S-layer genes sap and eag.

Previous microarray analyses showed that sap and eag transcription levels are higher in the codY mutant strain than in its parent (11). To confirm and quantitate this result, parental and codY strains carrying sap-lacZ and eag-lacZ reporter fusions were grown in RBic and sampled at multiple time points for the determination of β-galactosidase activity (Fig. 4). Whereas in the parental strain sap was barely expressed during any phase of growth, it was transcribed at high levels during the exponential phase in the codY mutant strain, indicating that this gene is normally repressed by CodY (Fig. 4A). The expression level of sap in the codY mutant dropped when cells entered the stationary phase, but the gene was still transcribed at higher levels in the mutant strain than in the parental strain. The eag gene was also transcribed at a higher level during the exponential phase in the codY mutant strain than in the parental strain, again indicating repression by CodY in the parental strain (Fig. 4B). When cells entered the stationary phase, eag expression dropped in the codY mutant strain but increased in the wild-type strain. This result implies that repression by CodY is not the only regulatory mechanism that is involved in the temporal control of eag expression.

DISCUSSION

CodY targets.

Our genome-wide analysis of in vitro DNA binding of CodY yielded 389 DNA regions that are bound by CodY. Among these, 132 regions are close to 131 transcription units that were identified previously as being regulated by CodY through expression profiling (11), while the remaining 257 regions identified by genome-wide analysis of DNA binding by CodY were not identified previously as targets of CodY-mediated regulation. Majerczyk et al. obtained similar results when they analyzed the S. aureus genome for CodY-binding sites using a similar technique (25). Microarray analysis might underestimate the effects of a regulatory protein for several reasons. For instance, CodY might control some genes whose levels of expression are below the level of detection in microarray experiments under the growth conditions used. Alternatively, the extent of regulation by CodY might be less than the 2-fold cutoff arbitrarily imposed previously, either because CodY has only a small effect on gene expression or because the effect of CodY is masked by those of other regulatory proteins. For instance, atxA was not identified previously as a CodY target by transcription profiling, and lacZ transcriptional fusion data indicated that a codY mutation has only a modest effect on atxA transcription and only during the exponential growth phase (11). Nonetheless, the atxA regulatory region was copurified with CodY, and gel mobility shift and DNase I footprinting assays confirmed this binding activity. The lack of effects of a codY mutation on transcription may be explained by the activity of AbrB, a repressor of atxA transcription during the exponential growth phase (10, 40, 41). AbrB binds to the atxA promoter region upstream of the transcription initiation site. CodY, on the other hand, binds between the transcription and translation start sites; thus, the binding sites of AbrB and CodY do not overlap. An alternative explanation for the minimal effect of a codY mutation on atxA transcription might be that an unidentified positive regulator is needed for significant atxA expression and that this regulator is active only in stationary-phase cells. These explanations for why some CodY-binding sites have not been tied to transcriptional regulation notwithstanding, one needs to consider the possibility that some CodY-binding sites are nonfunctional or have functions unrelated to transcription regulation. In some cases, the CodY-binding sites are located within the coding sequences of genes that do not appear to be under CodY control or between two convergently transcribed genes. It has been suggested that Escherichia coli RutR recognizes numerous nonfunctional binding sites that have not been eliminated by evolution because binding to those sites has no adverse effects (42). It is possible that similar unevolved sites were also identified in our CodY-DNA binding assay.

Applying the MEME algorithm to all 375 affinity-purified sites of ≥8 bp, we found an 11-nucleotide nonpalindromic consensus motif. While this 11-bp sequence might be important for CodY binding, it is unlikely to be sufficient, since it is found with fewer than 2 mismatches at more than 1,600 positions in the B. anthracis genome, i.e., at many more sites than those copurified with CodY. Since perfect palindromes might be unstable in bacteria (43, 44), this sequence might be part of a palindrome in which the nucleotides that are not absolutely required for CodY binding are allowed to vary. Their occurrence might be below the threshold recognized by MEME. It is notable that the CodY-DNA binding motif found here shares 10 of the 15 bases in the consensus sequence described for other bacteria (22–25, 38, 45, 46). This result is not surprising, since the 26-residue helix-turn-helix motifs of B. anthracis CodY and B. subtilis CodY are identical and differ from the S. aureus motif at a single position that is not thought to interact with DNA. On the other hand, a search of the B. anthracis genome for sequences matching the canonical CodY box (AATTTTCWGAAAATT) revealed 1 site with no mismatches, 11 sites with 1 mismatch, and 91 sites with 2 mismatches. There is only a partial correlation between the sequences matching this consensus sequence and those copurified with CodY, however, and the relationship between the motif derived for B. anthracis and the affinity of CodY binding remains unclear.

CodY bound to 131 promoter regions, thus directly controlling 197 genes of the 500 previously shown to be CodY-controlled by microarray analysis. Among the direct targets of CodY are the genes that code for the biosynthesis of the CodY effectors, GTP and the branched-chain amino acids (BCAAs). The GTP biosynthesis gene BAS0011 is positively regulated by CodY, whereas the operons for BCAA biosynthesis (with the promoter-proximal genes BAS1307, BAS1312, and BAS1713) are repressed by CodY. The breadth of metabolic genes regulated directly by CodY in B. anthracis is very reminiscent of those under CodY control in B. subtilis, S. aureus, and C. difficile (11, 24, 25, 47). Among the B. anthracis genes that are indirectly controlled are those involved in iron uptake and detoxification and most of the CodY-controlled genes located on pXO1. We have shown that the three toxin genes carried by pXO1 are indirectly controlled through CodY-dependent accumulation of AtxA (11). B. anthracis is the first example of a bacterium for which CodY activity is needed for virulence (11, 12), due to its indirect control of the expression of its toxin and iron uptake genes and detoxification genes. A recent report showed that Listeria monocytogenes CodY is needed for the expression of the virulence regulatory gene prfA and is therefore also required for virulence (48).

The observation that CodY directly controls the expression of nine genes encoding transcriptional regulators (such as NprR, SinR, and the sigma factor σH) probably accounts for its indirect control of many of the remaining genes. For example, NprR controls the expression of nprA in Bacillus cereus, a close relative of B. anthracis, and nprA was found to be repressed 7-fold in our microarray analysis (11, 49); SinR is a pleiotropic regulator in B. subtilis and in B. anthracis (50, 51); and σH, as an RNA polymerase cofactor, presumably controls a substantial regulon, which, in B. subtilis, consists of 87 genes (52). The exact role of σH in B. anthracis is uncertain. Involvement in the regulation of the atxA gene has been proposed (53), but that conclusion is controversial (54). Only two B. anthracis homologs of genes dependent on σH for their transcription in B. subtilis (53) were among the genes shown to be under CodY control (spoVG in BA0047 and citG in BA1767) (11). They are repressed and activated, respectively, by CodY during the exponential phase. Since neither of these genes was associated with a CodY-binding site in the present study, spoVG might be regulated indirectly by CodY through σH, whereas activation of the expression of citG in a codY mutant might reflect the control of citG by an unidentified regulatory protein. Interestingly, eag, which has a σH-dependent promoter, is under direct CodY control, raising the possibility that CodY regulates eag in two ways, by directly and indirectly controlling σH synthesis.

CodY directly represses expression of S-layer genes.

The microarray results indicated that expression levels of the S-layer genes sap and eag are derepressed in the absence of CodY (11). The data presented here show that CodY represses the expression levels of both of these genes during the exponential phase. Furthermore, affinity purification and in vitro assays of CodY binding to the sap and eag promoter regions indicate that CodY acts directly on these genes. From the early stationary phase onwards, the regulation of the expression of sap and eag becomes more complex. In the parental strain, the regulator PagR, which is encoded by a small open reading frame that lies in an operon with pagA, is responsible for the downregulation of sap transcription and the activation of eag expression (18, 20). In a codY mutant, the pagAR operon is not as highly expressed as it is in the parental strain (11) and the reduced levels of PagR that result from this might explain the limited repression of sap transcription and the limited activation of eag that are seen when the codY mutant reaches the stationary phase. The intervention of two regulators, one responding to bicarbonate and one to nutritional and energy cues, suggests that the expression of the S-layer genes is tightly controlled and depends on diverse cues.

Our data further show the extraordinary complexity of the mechanisms used by B. anthracis to regulate the expression of genes under conditions that mimic those prevalent in the mammalian host. CodY has an important role in these processes, but additional regulatory pathways exist, many of which remain to be elucidated.

Supplementary Material

Supplemental material

ACKNOWLEDGMENTS

We thank Kip Bodi, David Lazinski, and Marc Monot for bioinformatics analysis, Boris Belitsky for sharing his approach to identifying CodY-binding sites in affinity purification experiments, and Marie-Agnès Petit for helpful discussions.

W.V.S. was funded through an EMBO long-term fellowship and A.C. through a fellowship from the DGA and an EMBO short-term fellowship (ASTF 82-2010). This work was supported in part by a research grant (R01 GM042219) from the National Institute of General Medical Sciences of the National Institutes of Health.

The content of this article is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health.

Footnotes

Published ahead of print 4 January 2013

Supplemental material for this article may be found at http://dx.doi.org/10.1128/JB.02041-12.

REFERENCES

  • 1. Mock M, Fouet A. 2001. Anthrax. Annu. Rev. Microbiol. 55:647–671 [DOI] [PubMed] [Google Scholar]
  • 2. Fouet A, Mock M. 1996. Differential influence of the two Bacillus anthracis plasmids on regulation of virulence gene expression. Infect. Immun. 64:4928–4932 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Sirard JC, Mock M, Fouet A. 1994. The three Bacillus anthracis toxin genes are coordinately regulated by bicarbonate and temperature. J. Bacteriol. 176:5188–5192 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Koehler TM, Dai Z, Kaufman-Yarbray M. 1994. Regulation of the Bacillus anthracis protective antigen gene: CO2 and a trans-acting element activate transcription from one of two promoters. J. Bacteriol. 176:586–595 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Fouet A, Mock M. 2006. Regulatory networks for virulence and persistence of Bacillus anthracis. Curr. Opin. Microbiol. 9:160–166 [DOI] [PubMed] [Google Scholar]
  • 6. Guignot J, Mock M, Fouet A. 1997. AtxA activates the transcription of genes harbored by both Bacillus anthracis virulence plasmids. FEMS Microbiol. Lett. 147:203–207 [DOI] [PubMed] [Google Scholar]
  • 7. Uchida I, Makino S, Sasakawa C, Yoshikawa M, Sugimoto C, Terakado N. 1993. Identification of a novel gene, dep, associated with depolymerization of the capsular polymer in Bacillus anthracis. Mol. Microbiol. 9:487–496 [DOI] [PubMed] [Google Scholar]
  • 8. Sonenshein AL. 2005. CodY, a global regulator of stationary phase and virulence in Gram-positive bacteria. Curr. Opin. Microbiol. 8:203–207 [DOI] [PubMed] [Google Scholar]
  • 9. Stenz L, Francois P, Whiteson K, Wolz C, Linder P, Schrenzel J. 2011. The CodY pleiotropic repressor controls virulence in gram-positive pathogens. FEMS Immunol. Med. Microbiol. 62:123–139 [DOI] [PubMed] [Google Scholar]
  • 10. Fouet A. 2010. AtxA, a Bacillus anthracis global virulence regulator. Res. Microbiol. 161:735–742 [DOI] [PubMed] [Google Scholar]
  • 11. van Schaik W, Château A, Dillies MA, Coppée JY, Sonenshein AL, Fouet A. 2009. The global regulator CodY regulates toxin gene expression in Bacillus anthracis and is required for full virulence. Infect. Immun. 77:4437–4445 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Château A, van Schaik W, Six A, Aucher W, Fouet A. 2011. CodY regulation is required for full virulence and heme iron acquisition in Bacillus anthracis. FASEB J. 25:4445–4456 [DOI] [PubMed] [Google Scholar]
  • 13. Etienne-Toumelin I, Sirard JC, Duflot E, Mock M, Fouet A. 1995. Characterization of the Bacillus anthracis S-layer: cloning and sequencing of the structural gene. J. Bacteriol. 177:614–620 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Mesnage S, Tosi-Couture E, Mock M, Gounon P, Fouet A. 1997. Molecular characterization of the Bacillus anthracis main S-layer component: evidence that it is the major cell-associated antigen. Mol. Microbiol. 23:1147–1155 [DOI] [PubMed] [Google Scholar]
  • 15. Mesnage S, Tosi-Couture E, Gounon P, Mock M, Fouet A. 1998. The capsule and S-layer: two independent and yet compatible macromolecular structures in Bacillus anthracis. J. Bacteriol. 180:52–58 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Ray KC, Mesnage S, Washburn R, Mock M, Fouet A, Blaser M. 1998. Complement binding to Bacillus anthracis mutants lacking surface structures, poster B-418, p 126 Abstr. 98th Gen. Meet. Am. Soc. Microbiol American Society for Microbiology, Washington, DC [Google Scholar]
  • 17. Fouet A. 2009. The surface of Bacillus anthracis. Mol. Aspects Med. 30:374–385 [DOI] [PubMed] [Google Scholar]
  • 18. Mignot T, Mesnage S, Couture-Tosi E, Mock M, Fouet A. 2002. Developmental switch of S-layer protein synthesis in Bacillus anthracis. Mol. Microbiol. 43:1615–1627 [DOI] [PubMed] [Google Scholar]
  • 19. Mignot T, Mock M, Fouet A. 2003. A plasmid-encoded regulator couples the synthesis of toxins and surface structures in Bacillus anthracis. Mol. Microbiol. 47:917–927 [DOI] [PubMed] [Google Scholar]
  • 20. Mignot T, Couture-Tosi E, Mesnage S, Mock M, Fouet A. 2004. In vivo Bacillus anthracis gene expression requires PagR as an intermediate effector of the AtxA signalling cascade. Int. J. Med. Microbiol. 293:619–624 [DOI] [PubMed] [Google Scholar]
  • 21. Hoffmaster AR, Koehler TM. 1999. Autogenous regulation of the Bacillus anthracis pag operon. J. Bacteriol. 181:4485–4492 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. den Hengst CD, van Hijum SA, Geurts JM, Nauta A, Kok J, Kuipers OP. 2005. The Lactococcus lactis CodY regulon: identification of a conserved cis-regulatory element. J. Biol. Chem. 280:34332–34342 [DOI] [PubMed] [Google Scholar]
  • 23. Guedon E, Sperandio B, Pons N, Ehrlich SD, Renault P. 2005. Overall control of nitrogen metabolism in Lactococcus lactis by CodY, and possible models for CodY regulation in Firmicutes. Microbiology 151:3895–3909 [DOI] [PubMed] [Google Scholar]
  • 24. Dineen SS, McBride SM, Sonenshein AL. 2010. Integration of metabolism and virulence by Clostridium difficile CodY. J. Bacteriol. 192:5350–5362 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Majerczyk CD, Dunman PM, Luong TT, Lee CY, Sadykov MR, Somerville GA, Bodi K, Sonenshein AL. 2010. Direct targets of CodY in Staphylococcus aureus. J. Bacteriol. 192:2861–2877 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Candela T, Mock M, Fouet A. 2005. CapE, a 47-amino-acid peptide, is necessary for Bacillus anthracis polyglutamate capsule synthesis. J. Bacteriol. 187:7765–7772 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Ristroph JD, Ivins BE. 1983. Elaboration of Bacillus anthracis antigens in a new, defined culture medium. Infect. Immun. 39:483–486 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Pezard C, Berche P, Mock M. 1991. Contribution of individual toxin components to virulence of Bacillus anthracis. Infect. Immun. 59:3472–3477 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Trieu-Cuot P, Carlier C, Martin P, Courvalin P. 1987. Plasmid transfer by conjugation from Escherichia coli to Gram-positive bacteria. FEMS Microbiol. Lett. 48:289–294 [Google Scholar]
  • 30. Joseph P, Ratnayake-Lecamwasam M, Sonenshein AL. 2005. A region of Bacillus subtilis CodY protein required for interaction with DNA. J. Bacteriol. 187:4127–4139 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Fouet A, Sonenshein AL. 1990. A target for carbon source-dependent negative regulation of the citB promoter of Bacillus subtilis. J. Bacteriol. 172:835–844 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Serio AW, Pechter KB, Sonenshein AL. 2006. Bacillus subtilis aconitase is required for efficient late-sporulation gene expression. J. Bacteriol. 188:6396–6405 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Blankenberg D, Von Kuster G, Coraor N, Ananda G, Lazarus R, Mangan M, Nekrutenko A, Taylor J. 2010. Galaxy: a web-based genome analysis tool for experimentalists. Curr. Protoc. Mol. Biol. 89:19.10.1–19.10.21 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Giardine B, Riemer C, Hardison RC, Burhans R, Elnitski L, Shah P, Zhang Y, Blankenberg D, Albert I, Taylor J, Miller W, Kent WJ, Nekrutenko A. 2005. Galaxy: a platform for interactive large-scale genome analysis. Genome Res. 15:1451–1455 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Goecks J, Nekrutenko A, Taylor J, Galaxy Team 2010. Galaxy: a comprehensive approach for supporting accessible, reproducible, and transparent computational research in the life sciences. Genome Biol. 11:R86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Bailey TL, Elkan C. 1994. Fitting a mixture model by expectation maximization to discover motifs in biopolymers. Proc. Int. Conf. Intell. Syst. Mol. Biol. 2:28–36 [PubMed] [Google Scholar]
  • 37. Handke LD, Shivers RP, Sonenshein AL. 2008. Interaction of Bacillus subtilis CodY with GTP. J. Bacteriol. 190:798–806 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Belitsky BR, Sonenshein AL. 2008. Genetic and biochemical analysis of CodY-binding sites in Bacillus subtilis. J. Bacteriol. 190:1224–1236 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39. Belitsky BR, Sonenshein AL. 2011. Roadblock repression of transcription by Bacillus subtilis CodY. J. Mol. Biol. 411:729–743 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40. Saile E, Koehler TM. 2002. Control of anthrax toxin gene expression by the transition state regulator abrB. J. Bacteriol. 184:370–380 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41. Strauch MA, Ballar P, Rowshan AJ, Zoller KL. 2005. The DNA-binding specificity of the Bacillus anthracis AbrB protein. Microbiology 151:1751–1759 [DOI] [PubMed] [Google Scholar]
  • 42. Shimada T, Ishihama A, Busby SJ, Grainger DC. 2008. The Escherichia coli RutR transcription factor binds at targets within genes as well as intergenic regions. Nucleic Acids Res. 36:3950–3955 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43. Robin S, Rodolphe F, Schbath S. 2005. DNA, words and models: statistics of exceptional words. Cambridge University Press, Cambridge, United Kingdom [Google Scholar]
  • 44. Elhai J, Wolk CP. 1988. A versatile class of positive-selection vectors based on the nonviability of palindrome-containing plasmids that allows cloning into long polylinkers. Gene 68:119–138 [DOI] [PubMed] [Google Scholar]
  • 45. Frenzel E, Doll V, Pauthner M, Lücking G, Scherer S, Ehling-Schulz M. 2012. CodY orchestrates the expression of virulence determinants in emetic Bacillus cereus by impacting key regulatory circuits. Mol. Microbiol. 85:67–88 [DOI] [PubMed] [Google Scholar]
  • 46. Lindbäck T, Mols M, Basset C, Granum PE, Kuipers OP, Kovács AT. 2012. CodY, a pleiotropic regulator, influences multicellular behaviour and efficient production of virulence factors in Bacillus cereus. Environ. Microbiol. 14:2233–2246 [DOI] [PubMed] [Google Scholar]
  • 47. Pohl K, Francois P, Stenz L, Schlink F, Geiger T, Herbert S, Goerke C, Schrenzel J, Wolz C. 2009. CodY in Staphylococcus aureus: a regulatory link between metabolism and virulence gene expression. J. Bacteriol. 191:2953–2963 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 48. Lobel L, Sigal N, Borovok I, Ruppin E, Herskovits AA. 2012. Integrative genomic analysis identifies isoleucine and CodY as regulators of Listeria monocytogenes virulence. PLoS Genet. 8:e1002887 doi:10.1371/journal.pgen.1002887 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 49. Perchat S, Dubois T, Zouhir S, Gominet M, Poncet S, Lemy C, Aumont-Nicaise M, Deutscher J, Gohar M, Nessler S, Lereclus D. 2011. A cell-cell communication system regulates protease production during sporulation in bacteria of the Bacillus cereus group. Mol. Microbiol. 82:619–633 [DOI] [PubMed] [Google Scholar]
  • 50. Bai U, Mandic-Mulec I, Smith I. 1993. SinI modulates the activity of SinR, a developmental switch protein of Bacillus subtilis, by protein-protein interaction. Genes Dev. 7:139–148 [DOI] [PubMed] [Google Scholar]
  • 51. Pflughoeft KJ, Sumby P, Koehler TM. 2011. Bacillus anthracis sin locus and regulation of secreted proteases. J. Bacteriol. 193:631–639 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 52. Britton RA, Eichenberger P, Gonzalez-Pastor JE, Fawcett P, Monson R, Losick R, Grossman AD. 2002. Genome-wide analysis of the stationary-phase sigma factor (sigma-H) regulon of Bacillus subtilis. J. Bacteriol. 184:4881–4890 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 53. Hadjifrangiskou M, Chen Y, Koehler TM. 2007. The alternative sigma factor sigmaH is required for toxin gene expression by Bacillus anthracis. J. Bacteriol. 189:1874–1883 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 54. Bongiorni C, Fukushima T, Wilson AC, Chiang C, Mansilla MC, Hoch JA, Perego M. 2008. Dual promoters control expression of the Bacillus anthracis virulence factor AtxA. J. Bacteriol. 190:6483–6492 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Supplemental material

Articles from Journal of Bacteriology are provided here courtesy of American Society for Microbiology (ASM)

RESOURCES